ID: 1062587090

View in Genome Browser
Species Human (GRCh38)
Location 9:137254314-137254336
Sequence GTTGGTCAGCCCTAGGGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062587090_1062587100 17 Left 1062587090 9:137254314-137254336 CCCTCGCCCTAGGGCTGACCAAC No data
Right 1062587100 9:137254354-137254376 AGCTGTGGTAGCCATGGCCTTGG No data
1062587090_1062587101 18 Left 1062587090 9:137254314-137254336 CCCTCGCCCTAGGGCTGACCAAC No data
Right 1062587101 9:137254355-137254377 GCTGTGGTAGCCATGGCCTTGGG No data
1062587090_1062587097 2 Left 1062587090 9:137254314-137254336 CCCTCGCCCTAGGGCTGACCAAC No data
Right 1062587097 9:137254339-137254361 GGCCAGCGGCAAGAGAGCTGTGG No data
1062587090_1062587104 30 Left 1062587090 9:137254314-137254336 CCCTCGCCCTAGGGCTGACCAAC No data
Right 1062587104 9:137254367-137254389 ATGGCCTTGGGAGCTCGGCCCGG No data
1062587090_1062587099 11 Left 1062587090 9:137254314-137254336 CCCTCGCCCTAGGGCTGACCAAC No data
Right 1062587099 9:137254348-137254370 CAAGAGAGCTGTGGTAGCCATGG No data
1062587090_1062587102 25 Left 1062587090 9:137254314-137254336 CCCTCGCCCTAGGGCTGACCAAC No data
Right 1062587102 9:137254362-137254384 TAGCCATGGCCTTGGGAGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062587090 Original CRISPR GTTGGTCAGCCCTAGGGCGA GGG (reversed) Intergenic