ID: 1062587093

View in Genome Browser
Species Human (GRCh38)
Location 9:137254320-137254342
Sequence GGCCAAGTTGGTCAGCCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062587093_1062587097 -4 Left 1062587093 9:137254320-137254342 CCCTAGGGCTGACCAACTTGGCC No data
Right 1062587097 9:137254339-137254361 GGCCAGCGGCAAGAGAGCTGTGG No data
1062587093_1062587099 5 Left 1062587093 9:137254320-137254342 CCCTAGGGCTGACCAACTTGGCC No data
Right 1062587099 9:137254348-137254370 CAAGAGAGCTGTGGTAGCCATGG No data
1062587093_1062587100 11 Left 1062587093 9:137254320-137254342 CCCTAGGGCTGACCAACTTGGCC No data
Right 1062587100 9:137254354-137254376 AGCTGTGGTAGCCATGGCCTTGG No data
1062587093_1062587104 24 Left 1062587093 9:137254320-137254342 CCCTAGGGCTGACCAACTTGGCC No data
Right 1062587104 9:137254367-137254389 ATGGCCTTGGGAGCTCGGCCCGG No data
1062587093_1062587101 12 Left 1062587093 9:137254320-137254342 CCCTAGGGCTGACCAACTTGGCC No data
Right 1062587101 9:137254355-137254377 GCTGTGGTAGCCATGGCCTTGGG No data
1062587093_1062587102 19 Left 1062587093 9:137254320-137254342 CCCTAGGGCTGACCAACTTGGCC No data
Right 1062587102 9:137254362-137254384 TAGCCATGGCCTTGGGAGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062587093 Original CRISPR GGCCAAGTTGGTCAGCCCTA GGG (reversed) Intergenic
No off target data available for this crispr