ID: 1062587094

View in Genome Browser
Species Human (GRCh38)
Location 9:137254321-137254343
Sequence TGGCCAAGTTGGTCAGCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062587094_1062587101 11 Left 1062587094 9:137254321-137254343 CCTAGGGCTGACCAACTTGGCCA No data
Right 1062587101 9:137254355-137254377 GCTGTGGTAGCCATGGCCTTGGG No data
1062587094_1062587102 18 Left 1062587094 9:137254321-137254343 CCTAGGGCTGACCAACTTGGCCA No data
Right 1062587102 9:137254362-137254384 TAGCCATGGCCTTGGGAGCTCGG No data
1062587094_1062587100 10 Left 1062587094 9:137254321-137254343 CCTAGGGCTGACCAACTTGGCCA No data
Right 1062587100 9:137254354-137254376 AGCTGTGGTAGCCATGGCCTTGG No data
1062587094_1062587104 23 Left 1062587094 9:137254321-137254343 CCTAGGGCTGACCAACTTGGCCA No data
Right 1062587104 9:137254367-137254389 ATGGCCTTGGGAGCTCGGCCCGG No data
1062587094_1062587099 4 Left 1062587094 9:137254321-137254343 CCTAGGGCTGACCAACTTGGCCA No data
Right 1062587099 9:137254348-137254370 CAAGAGAGCTGTGGTAGCCATGG No data
1062587094_1062587097 -5 Left 1062587094 9:137254321-137254343 CCTAGGGCTGACCAACTTGGCCA No data
Right 1062587097 9:137254339-137254361 GGCCAGCGGCAAGAGAGCTGTGG No data
1062587094_1062587106 30 Left 1062587094 9:137254321-137254343 CCTAGGGCTGACCAACTTGGCCA No data
Right 1062587106 9:137254374-137254396 TGGGAGCTCGGCCCGGCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062587094 Original CRISPR TGGCCAAGTTGGTCAGCCCT AGG (reversed) Intergenic