ID: 1062587097

View in Genome Browser
Species Human (GRCh38)
Location 9:137254339-137254361
Sequence GGCCAGCGGCAAGAGAGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062587091_1062587097 1 Left 1062587091 9:137254315-137254337 CCTCGCCCTAGGGCTGACCAACT No data
Right 1062587097 9:137254339-137254361 GGCCAGCGGCAAGAGAGCTGTGG No data
1062587090_1062587097 2 Left 1062587090 9:137254314-137254336 CCCTCGCCCTAGGGCTGACCAAC No data
Right 1062587097 9:137254339-137254361 GGCCAGCGGCAAGAGAGCTGTGG No data
1062587094_1062587097 -5 Left 1062587094 9:137254321-137254343 CCTAGGGCTGACCAACTTGGCCA No data
Right 1062587097 9:137254339-137254361 GGCCAGCGGCAAGAGAGCTGTGG No data
1062587093_1062587097 -4 Left 1062587093 9:137254320-137254342 CCCTAGGGCTGACCAACTTGGCC No data
Right 1062587097 9:137254339-137254361 GGCCAGCGGCAAGAGAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062587097 Original CRISPR GGCCAGCGGCAAGAGAGCTG TGG Intergenic