ID: 1062587100

View in Genome Browser
Species Human (GRCh38)
Location 9:137254354-137254376
Sequence AGCTGTGGTAGCCATGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062587098_1062587100 -10 Left 1062587098 9:137254341-137254363 CCAGCGGCAAGAGAGCTGTGGTA No data
Right 1062587100 9:137254354-137254376 AGCTGTGGTAGCCATGGCCTTGG No data
1062587093_1062587100 11 Left 1062587093 9:137254320-137254342 CCCTAGGGCTGACCAACTTGGCC No data
Right 1062587100 9:137254354-137254376 AGCTGTGGTAGCCATGGCCTTGG No data
1062587096_1062587100 -1 Left 1062587096 9:137254332-137254354 CCAACTTGGCCAGCGGCAAGAGA No data
Right 1062587100 9:137254354-137254376 AGCTGTGGTAGCCATGGCCTTGG No data
1062587090_1062587100 17 Left 1062587090 9:137254314-137254336 CCCTCGCCCTAGGGCTGACCAAC No data
Right 1062587100 9:137254354-137254376 AGCTGTGGTAGCCATGGCCTTGG No data
1062587094_1062587100 10 Left 1062587094 9:137254321-137254343 CCTAGGGCTGACCAACTTGGCCA No data
Right 1062587100 9:137254354-137254376 AGCTGTGGTAGCCATGGCCTTGG No data
1062587091_1062587100 16 Left 1062587091 9:137254315-137254337 CCTCGCCCTAGGGCTGACCAACT No data
Right 1062587100 9:137254354-137254376 AGCTGTGGTAGCCATGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062587100 Original CRISPR AGCTGTGGTAGCCATGGCCT TGG Intergenic