ID: 1062587106

View in Genome Browser
Species Human (GRCh38)
Location 9:137254374-137254396
Sequence TGGGAGCTCGGCCCGGCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062587096_1062587106 19 Left 1062587096 9:137254332-137254354 CCAACTTGGCCAGCGGCAAGAGA No data
Right 1062587106 9:137254374-137254396 TGGGAGCTCGGCCCGGCTTGTGG No data
1062587098_1062587106 10 Left 1062587098 9:137254341-137254363 CCAGCGGCAAGAGAGCTGTGGTA No data
Right 1062587106 9:137254374-137254396 TGGGAGCTCGGCCCGGCTTGTGG No data
1062587094_1062587106 30 Left 1062587094 9:137254321-137254343 CCTAGGGCTGACCAACTTGGCCA No data
Right 1062587106 9:137254374-137254396 TGGGAGCTCGGCCCGGCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062587106 Original CRISPR TGGGAGCTCGGCCCGGCTTG TGG Intergenic