ID: 1062589555

View in Genome Browser
Species Human (GRCh38)
Location 9:137267228-137267250
Sequence CCCCGGGCGCAGGTTTCTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062589555 Original CRISPR CCCCGGGCGCAGGTTTCTGC AGG Exonic
900375548 1:2352907-2352929 CCAGGCGGGCAGGTTTCTGCAGG + Intronic
900417841 1:2543243-2543265 CCCCGGGCCGAGAGTTCTGCTGG + Intergenic
900607183 1:3529097-3529119 CCCAGGGAGCAAGCTTCTGCAGG - Intronic
901049992 1:6421089-6421111 CCCCTGGCCCAGGCTTCTCCGGG - Intronic
902690990 1:18110011-18110033 ACCCGGGAGCAGGGTTCTTCTGG + Intronic
903349901 1:22711154-22711176 CGCCGGGCGCAGGTGGCCGCGGG + Intronic
904492864 1:30871220-30871242 CCCTGGCAGCAGATTTCTGCAGG - Intronic
907394189 1:54178147-54178169 CCCCAGGGGCTGGGTTCTGCAGG - Intronic
910427726 1:87132703-87132725 CCCAGGGCGCTGGTTTAGGCCGG + Intronic
910842120 1:91570950-91570972 CCCAGGGCCCAGGTTACTGCTGG - Intergenic
917429279 1:174948771-174948793 CCCCTGCCTCAGGCTTCTGCTGG - Intronic
919944906 1:202311969-202311991 CCCCGGGGACAGCTGTCTGCTGG - Intronic
920612475 1:207454771-207454793 CCCCGCCCCCAGGATTCTGCAGG + Intronic
922153186 1:223022272-223022294 CCCCGGGGTCAGGTCTCTGCAGG + Intergenic
1063120244 10:3100886-3100908 CCCTGGCCCCAGGTTCCTGCTGG + Intronic
1063516917 10:6705886-6705908 GCCCCTGCGCAGGTTGCTGCAGG + Intergenic
1067478617 10:46581640-46581662 CCCAGGGGGCAGGACTCTGCTGG + Intronic
1067616120 10:47760161-47760183 CCCAGGGGGCAGGACTCTGCTGG - Intergenic
1068954875 10:62813589-62813611 CGCCGGTCGCAGCCTTCTGCTGG + Exonic
1069743230 10:70698845-70698867 CCCCGGACCCAGGGTCCTGCGGG + Intronic
1070678634 10:78433398-78433420 CCCAGAGAGCAGATTTCTGCAGG + Intergenic
1073057124 10:100710049-100710071 CGCGGGGCGCGGGTTTCTCCCGG - Intergenic
1074875347 10:117609322-117609344 TCCCGGCCTCAGGTCTCTGCTGG + Intergenic
1076745089 10:132508965-132508987 CCCCGGGCCCAGCTTTATTCCGG - Intergenic
1076776966 10:132703280-132703302 CCGCGGGCACAGGGTTGTGCAGG - Intronic
1077011698 11:381657-381679 CCCCGGCCCCAGGGTCCTGCAGG + Exonic
1079903990 11:26222585-26222607 CCCCTGCAGCAGGTTTCTGCCGG + Intergenic
1083171816 11:60927725-60927747 ACCCGGGCGTAGGGCTCTGCTGG - Exonic
1084088644 11:66866204-66866226 CCCCGCGCGCAGCTTCCAGCCGG - Exonic
1089198206 11:116707653-116707675 CCCCTCGCGCGGGTTCCTGCCGG - Intergenic
1092462229 12:8697443-8697465 CCTCGGGCGCAGGGTCCTGCCGG - Intronic
1095954736 12:47799567-47799589 CCCTGGGCACAGGGTTCTGCAGG - Intronic
1096195753 12:49647878-49647900 CCCTGGGCTCTGCTTTCTGCAGG - Intronic
1096490262 12:52009185-52009207 CCCAGGGCTCAGGATTCCGCTGG + Exonic
1101591305 12:106127867-106127889 CCCCGTGCCCAGGCTGCTGCAGG + Intronic
1102193147 12:111004465-111004487 CCCTCGGCTCTGGTTTCTGCTGG - Intergenic
1103967069 12:124646704-124646726 CCCCGCGCTCGGGTTTCTGTGGG - Intergenic
1104956069 12:132466450-132466472 CCCCGGTCACAGGTGTCTCCAGG - Intergenic
1105943423 13:25170730-25170752 CCCCGGGCGCCGGTGTCGCCGGG + Exonic
1107145877 13:37059799-37059821 GCCCGGACGCAAGTCTCTGCGGG - Intergenic
1113815864 13:113170698-113170720 CGCTGGGCCCAGGCTTCTGCTGG - Intronic
1114556708 14:23566404-23566426 CCCCTGGCTCAGGTCACTGCAGG + Exonic
1118514196 14:66508473-66508495 CTCCGGGCTCCGGTTTCTCCCGG + Exonic
1120857283 14:89223414-89223436 CCCAGGGTGCAGGTTGCTGATGG + Intronic
1122631676 14:103110112-103110134 CCCCGGCCGCAGCTCTCAGCAGG - Exonic
1124027597 15:25981268-25981290 CCCTGGGAGCAGGTTTAAGCTGG - Intergenic
1129296998 15:74605016-74605038 GCCAGGGTGAAGGTTTCTGCAGG - Intronic
1132527813 16:426168-426190 CCCCGGGCGCAGGCTCATCCAGG - Exonic
1132760776 16:1507594-1507616 CCCCTGGCGCACGTAGCTGCCGG - Exonic
1132968637 16:2673663-2673685 CCCCGGGGGCGGGGCTCTGCGGG + Intergenic
1134124961 16:11610205-11610227 CCCCTGGGACAGGTTTCTGAGGG - Intronic
1141509920 16:84505361-84505383 CCCCGGGACCAGGTTTCGGTGGG - Intronic
1142752803 17:1998525-1998547 CCCAGCGCGCAGGTCCCTGCCGG + Intronic
1151805091 17:76400169-76400191 CCCTGGGCGCAGTTTTTTTCTGG + Exonic
1152662219 17:81547825-81547847 CCCCAGGGGCATGTTTCTCCCGG + Intronic
1152697359 17:81803859-81803881 CCGCGGGCTCAGGGGTCTGCAGG + Intergenic
1156239841 18:35242644-35242666 CCCGGGGCCCAGGTGTCTCCTGG - Exonic
1160584175 18:79903633-79903655 CACCTGGAGCAGGTTCCTGCAGG + Exonic
1160775486 19:853255-853277 CACCGCGCGGACGTTTCTGCCGG - Exonic
1160847810 19:1174069-1174091 CCCCGGGCGCAGGGGTCCGCGGG + Intronic
1162853303 19:13448576-13448598 CCCTGGGGGCTGGCTTCTGCTGG - Intronic
1165422999 19:35731715-35731737 CCCCTGGCCCAGGTGTGTGCAGG + Intronic
1167293504 19:48636759-48636781 CCCCGCACGCAGGTTTCTATGGG + Intronic
927455536 2:23246037-23246059 GCCAGGGCCCAAGTTTCTGCTGG - Intergenic
934545018 2:95207430-95207452 CCCCGGGAGCAGGTGGCCGCAGG + Intergenic
934618885 2:95792148-95792170 TCCCCGGCTCAGGTTTCTGTGGG + Intergenic
934642008 2:96032409-96032431 TCCCCGGCTCAGGTTTCTGTGGG - Intronic
937050326 2:118883100-118883122 CCCCGGGGGCAGTTTCCTGTTGG + Intergenic
939536359 2:143435256-143435278 ACCCGGGTGCATTTTTCTGCGGG + Intronic
943603012 2:189943457-189943479 CCCCTGAAGCAGGCTTCTGCCGG - Intronic
949042480 2:241855687-241855709 CCCCGGGCGGAGGAACCTGCTGG + Intronic
1174204086 20:48827106-48827128 CCCCATGCACAGGTTTTTGCTGG - Intronic
1175457067 20:59123559-59123581 CCCCCGGCGCTGCTGTCTGCTGG - Intergenic
1176076557 20:63250952-63250974 CCCCGGGCCCAGGTGTCTTTTGG - Intronic
1176203900 20:63877868-63877890 CCGAGGGCGATGGTTTCTGCCGG + Intronic
1176203922 20:63877936-63877958 CCGAGGGCGATGGTTTCTGCCGG + Intronic
1176203933 20:63877970-63877992 CCGAGGGCGGTGGTTTCTGCCGG + Intronic
1180014824 21:45075006-45075028 GCCCGGGCGCAGCTTCCTCCGGG - Intronic
1180821787 22:18833828-18833850 CCCCGGGAGCAGATTTCTCATGG - Intergenic
1181191190 22:21142217-21142239 CCCCGGGAGCAGATTTCTCATGG + Intergenic
1181208009 22:21268293-21268315 CCCCGGGAGCAGATTTCTCATGG - Intergenic
1181785274 22:25222160-25222182 CCCCGGGCACAGGTTCCTTCAGG + Intronic
1183699836 22:39445031-39445053 CCCCTGGCGCGTGTTGCTGCTGG - Intergenic
1184753535 22:46502940-46502962 CCCCGGGAGCAGGTCCCCGCAGG + Intronic
1203218913 22_KI270731v1_random:27123-27145 CCCCGGGAGCAGATTTCTCATGG + Intergenic
1203271914 22_KI270734v1_random:59704-59726 CCCCGGGAGCAGATTTCTCATGG - Intergenic
956741498 3:72279655-72279677 CTCAGGCCGCAGGTTTCTGATGG - Intergenic
957630511 3:82711170-82711192 CCCAGGGGACAGTTTTCTGCAGG - Intergenic
969096216 4:4734773-4734795 CCCCAGGCGAAGTCTTCTGCTGG - Intergenic
969143417 4:5099885-5099907 CTCCTGGCTCAGGTTCCTGCAGG - Intronic
975609886 4:76193295-76193317 CCCTTGGAGCAGGCTTCTGCTGG - Intronic
975909293 4:79248610-79248632 CTCCAGGCACAGGTTTGTGCCGG - Intronic
976752342 4:88462242-88462264 CCCTTGGCTCAGATTTCTGCCGG + Exonic
981800718 4:148652309-148652331 GCCTGGGGGCAGGTTTCTGAGGG + Intergenic
985796301 5:1964499-1964521 CCCGGGGCACAGGTCTGTGCAGG + Intergenic
985844753 5:2335928-2335950 CCCCGGGGTAAGGTGTCTGCAGG + Intergenic
992504213 5:77369389-77369411 CCCTGAGCGAAGGTTTCTGCTGG + Intronic
994525858 5:100903859-100903881 ACCCTGGCTCAGGATTCTGCAGG + Intergenic
1005955419 6:30660049-30660071 CCCCGGACGCAGGTTTCCTGTGG - Exonic
1006836050 6:36999347-36999369 CCTCTGGCACAGGTTTCAGCTGG + Intergenic
1016590115 6:145735169-145735191 CGCCGGGGGCAGGCGTCTGCTGG + Intronic
1019145269 6:169971847-169971869 ACCCGGGCGCTGGGCTCTGCAGG - Intergenic
1019486983 7:1293992-1294014 CCCCGGGCGCCGAGTTCCGCCGG + Intergenic
1019917747 7:4144376-4144398 CTCTAGGCGCAGGTGTCTGCAGG - Intronic
1026969845 7:74461159-74461181 CCCCGGGGGCAGGTCTGTGGTGG + Intronic
1026981887 7:74531763-74531785 GCCCTGGCCCAGGTATCTGCAGG + Intronic
1027624765 7:80532139-80532161 CCCAGGGAGAAGTTTTCTGCAGG + Intronic
1036155136 8:6334795-6334817 CCCAGGGAGCATGTTTTTGCTGG - Intergenic
1036556416 8:9863843-9863865 CCCAGGACGCAGATTTCTACAGG - Intergenic
1037977559 8:23224522-23224544 CCCCGGGCCCAGCCTCCTGCGGG + Intronic
1040544768 8:48390299-48390321 CCCCGGCCACAGGTTCCAGCAGG + Intergenic
1044609794 8:94080237-94080259 ACCTGGGGGCTGGTTTCTGCGGG + Intergenic
1048894313 8:138975827-138975849 CCCCGGACCCAGGTTATTGCTGG + Intergenic
1049125176 8:140780106-140780128 CCTCGGGAGCAGGCTTCTCCTGG - Intronic
1049164593 8:141118130-141118152 CCCAGGGCAGAGGCTTCTGCTGG - Intronic
1049410059 8:142469894-142469916 CCCTGGGCACAGGTCTCAGCTGG - Intronic
1053408974 9:37903701-37903723 CCCCGGGCGCAGGCAGCTCCCGG + Exonic
1056125986 9:83537347-83537369 CCCAGGACCCAGGTTCCTGCAGG + Intronic
1061010135 9:127949876-127949898 CCCCGGGGGCAGGTTTCCAGTGG - Intronic
1062238796 9:135525125-135525147 CCTGGAGAGCAGGTTTCTGCAGG - Exonic
1062374253 9:136254836-136254858 CCCCAGACGAAGGTTTCAGCTGG - Intergenic
1062539480 9:137035250-137035272 CCCCGGGTGCCGCTGTCTGCAGG - Exonic
1062589555 9:137267228-137267250 CCCCGGGCGCAGGTTTCTGCAGG + Exonic
1186747386 X:12583730-12583752 ACCCGGGCCCAGCTGTCTGCAGG + Intronic
1190261113 X:48797538-48797560 CTCAGGGCACAGGTTCCTGCTGG - Intergenic
1198028349 X:132730921-132730943 CCCCTGGGGCAGGGCTCTGCAGG - Intronic
1200073294 X:153539319-153539341 CCCCTGGCTCAGGTTTCTTCAGG - Intronic