ID: 1062591997

View in Genome Browser
Species Human (GRCh38)
Location 9:137278444-137278466
Sequence CCTGCGGAGGGGCGGAGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 930
Summary {0: 1, 1: 0, 2: 5, 3: 90, 4: 834}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062591985_1062591997 -1 Left 1062591985 9:137278422-137278444 CCCGAGAGATTTGCATCGGGGCC 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1062591997 9:137278444-137278466 CCTGCGGAGGGGCGGAGGGGCGG 0: 1
1: 0
2: 5
3: 90
4: 834
1062591986_1062591997 -2 Left 1062591986 9:137278423-137278445 CCGAGAGATTTGCATCGGGGCCC 0: 1
1: 0
2: 0
3: 4
4: 45
Right 1062591997 9:137278444-137278466 CCTGCGGAGGGGCGGAGGGGCGG 0: 1
1: 0
2: 5
3: 90
4: 834
1062591976_1062591997 29 Left 1062591976 9:137278392-137278414 CCTCAAGGCCCGCGGCCGTTTAT 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1062591997 9:137278444-137278466 CCTGCGGAGGGGCGGAGGGGCGG 0: 1
1: 0
2: 5
3: 90
4: 834
1062591980_1062591997 20 Left 1062591980 9:137278401-137278423 CCGCGGCCGTTTATGGGAAGACC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1062591997 9:137278444-137278466 CCTGCGGAGGGGCGGAGGGGCGG 0: 1
1: 0
2: 5
3: 90
4: 834
1062591981_1062591997 14 Left 1062591981 9:137278407-137278429 CCGTTTATGGGAAGACCCGAGAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1062591997 9:137278444-137278466 CCTGCGGAGGGGCGGAGGGGCGG 0: 1
1: 0
2: 5
3: 90
4: 834
1062591979_1062591997 21 Left 1062591979 9:137278400-137278422 CCCGCGGCCGTTTATGGGAAGAC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1062591997 9:137278444-137278466 CCTGCGGAGGGGCGGAGGGGCGG 0: 1
1: 0
2: 5
3: 90
4: 834

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062591997 Original CRISPR CCTGCGGAGGGGCGGAGGGG CGG Intronic
900088675 1:909972-909994 CCTGGGCAGGGGCGGCGGCGCGG + Intergenic
900095975 1:940299-940321 TCCGCGGCGGGGCGGGGGGGGGG - Intronic
900309359 1:2025848-2025870 CTGGCGGGCGGGCGGAGGGGGGG + Intronic
900420269 1:2553190-2553212 CCAGGGGAGGGGAGGAGGTGGGG + Intergenic
900424160 1:2568468-2568490 CCAGGGGAGGGGAGGAGGTGGGG - Intergenic
900438768 1:2643225-2643247 CCTGCCGAGGGGCGGGGCGCAGG + Intronic
900462195 1:2807036-2807058 CCTGCGGGGTGGGGGTGGGGTGG + Intergenic
900513192 1:3069834-3069856 GCCGGGGAGGGGCGGAGGAGGGG + Intronic
900583080 1:3418898-3418920 CCTGCTGAGGCCAGGAGGGGAGG - Intronic
900589864 1:3454780-3454802 GGGGCGGAGGGACGGAGGGGCGG - Exonic
900616830 1:3569273-3569295 CCGGCTGAGGGGCGGCGGGGTGG - Intronic
900627847 1:3617472-3617494 CCTGTGGAGGGGTGGTGGGGAGG + Intergenic
900833343 1:4980605-4980627 CCTGAGGAGGGGCAGCTGGGTGG + Intergenic
901005439 1:6169600-6169622 GCTGTGGAGGGGCTGTGGGGAGG + Intronic
901018801 1:6245747-6245769 CCTCCGGAGGGGCTGGGAGGGGG + Intergenic
901049601 1:6419702-6419724 TCTGCGGACGGGCGGCGCGGTGG + Exonic
901067484 1:6501206-6501228 CCTGCGGTGGGGCGACGGAGTGG - Intronic
901162721 1:7192377-7192399 GCTGCGGAGGGGCAGAGCGGAGG + Intronic
901426887 1:9187612-9187634 TCTGCGGAGGCGCGGAGTGGAGG - Intergenic
901479962 1:9518452-9518474 CCTGCGAAGGTGCAGAGGAGGGG + Intergenic
901798346 1:11692936-11692958 CCTGTGGAGGAAGGGAGGGGAGG + Intronic
901853448 1:12030006-12030028 CCTGCGCAGGGGGGCAGTGGGGG - Exonic
901875861 1:12166892-12166914 TCTGGGGAGGGGCGTGGGGGAGG + Intergenic
902283041 1:15388324-15388346 CCTGGGGAGGGGAGGGAGGGAGG - Intronic
902319692 1:15652442-15652464 GCTCCGGAGGGGGGGGGGGGGGG + Intronic
902534829 1:17113595-17113617 CCTGGTGTGGGGCAGAGGGGAGG + Intronic
902702828 1:18184332-18184354 CCTGGGGAGGGGGAGAAGGGAGG - Intronic
903328816 1:22586536-22586558 GCTGCGGAGTGGCTGTGGGGAGG - Exonic
903349584 1:22710169-22710191 CCTGGGGTGGGGCTGGGGGGAGG - Intergenic
903438716 1:23371140-23371162 CCTGCGGGGCGGGGGCGGGGTGG + Exonic
903504759 1:23825486-23825508 ACGGCGGAGGGGCGGGGGCGGGG - Intronic
903542529 1:24105081-24105103 CCTGGGGAGGGGCGGGGCAGGGG - Intronic
903746869 1:25592931-25592953 CCTGCTGAGGGGACGAGGCGAGG + Intergenic
903971890 1:27124173-27124195 CCTGGGGTGGGGCAGAGGTGGGG + Intronic
904054304 1:27660026-27660048 ACGGCGGTGGGGCGGTGGGGCGG - Intergenic
904325837 1:29727211-29727233 GCTGGGGAGGGGTGGAGGGAAGG + Intergenic
904325850 1:29727238-29727260 GCTGGGGAGGGGTGGAGGGAAGG + Intergenic
904326078 1:29727798-29727820 CTTGGGGAGGGGTGGAGGGAAGG + Intergenic
904893974 1:33800285-33800307 CCTGGGGTGAGGAGGAGGGGAGG + Intronic
905028266 1:34865711-34865733 CCCGCGGGGTGGGGGAGGGGGGG + Exonic
905037950 1:34929706-34929728 CCTGCGCGGGGGCGGGGGCGGGG - Intergenic
905478327 1:38244403-38244425 CCTGCCGTGCGGGGGAGGGGCGG - Intergenic
905668689 1:39777740-39777762 GCTGGGGAGGGTCTGAGGGGAGG - Intronic
906250275 1:44305740-44305762 GCTGCTGAGGGGAGAAGGGGAGG + Intronic
906293094 1:44632402-44632424 CCGGGGGTGGGGCGGAGGGAGGG - Intronic
906495646 1:46302582-46302604 CAAGCCGATGGGCGGAGGGGAGG - Intronic
906536593 1:46554302-46554324 CCTTGGGAGGGGTGGAGGGTTGG - Intergenic
906667708 1:47633087-47633109 CCTGCTCAGAGGCAGAGGGGAGG + Intergenic
907406240 1:54255146-54255168 ATTGCGGGGGGGCGGGGGGGGGG + Intronic
907682409 1:56577411-56577433 TCTGTGGAAGGGTGGAGGGGTGG - Intronic
908501276 1:64745448-64745470 CGTCCCGAGGGGCGGCGGGGCGG + Intronic
909222286 1:72980625-72980647 TCTGTGGAGGGGAGGAGTGGGGG + Intergenic
910432690 1:87174678-87174700 GCTGCGGAGGGTGGGTGGGGAGG + Intergenic
911498766 1:98661527-98661549 CCTGGGGCGGGCTGGAGGGGCGG - Intergenic
912016903 1:105050169-105050191 GCTGGGGAGGGGAGGAGGGAAGG - Intergenic
912361595 1:109100338-109100360 CGGGAGGAGGGGCGCAGGGGTGG - Intergenic
912514579 1:110210101-110210123 CCGGCGGAAGCGCGCAGGGGCGG + Intergenic
912845715 1:113073185-113073207 CGTGGGGAGGGGCGGACGAGAGG + Intergenic
914667552 1:149843449-149843471 CCCGCGGAGGGAGGGAGGGAGGG - Intronic
914668215 1:149850341-149850363 CCCGCGGAGGGAGGGAGGGAGGG + Intronic
915121908 1:153634485-153634507 CCTGCGAAGGGGCGGGGGAGGGG + Intronic
915309812 1:155001298-155001320 CCTGCGGAGGGGGGTTGGGAGGG + Intergenic
915326814 1:155085005-155085027 CCTGGGGAGGGGCTGCGGAGCGG + Intronic
915474883 1:156147469-156147491 CCTGGGGTGGGAGGGAGGGGCGG + Intronic
915517379 1:156421249-156421271 CCATGAGAGGGGCGGAGGGGAGG + Intronic
916441468 1:164829617-164829639 CCTGTTGAGGGGAAGAGGGGAGG + Intronic
916666995 1:166975590-166975612 CGGGCGGCGGGGCGGAGGCGCGG - Intronic
918088504 1:181266120-181266142 CCTGTTGAGGGGTGGGGGGGTGG - Intergenic
918202526 1:182280435-182280457 GCTGGGGAGGGGTAGAGGGGAGG + Intergenic
918406210 1:184214036-184214058 CCTGAGGAGGGGAGGGGGGCAGG - Intergenic
918885737 1:190191403-190191425 CCTGTTGAGGGGTGGAGGTGAGG - Intronic
919699826 1:200620642-200620664 CCTGCGGAGGGGCGAAGTTTCGG - Exonic
919768873 1:201144514-201144536 CCTGCAGAGGGGCTGATGGGAGG - Intronic
919830742 1:201538898-201538920 CCCGCAGAGGGGCGGAGGCATGG - Intergenic
919855554 1:201703908-201703930 ACTGCGGAGGAGCAGAGGTGAGG + Intronic
920211518 1:204332064-204332086 CCTCCTGAGGGGCGGAGTGCTGG + Intronic
920255624 1:204652261-204652283 GCGGCGGGGGGGCGGGGGGGGGG - Intronic
920313813 1:205064111-205064133 GGTGGTGAGGGGCGGAGGGGGGG + Intronic
920333657 1:205229533-205229555 TCTGTGAAGGGGCGGGGGGGGGG + Intronic
920496770 1:206460468-206460490 CCTGAGTTGGGGAGGAGGGGCGG + Intronic
920498290 1:206470711-206470733 CGTGCGGAGGGGGGTGGGGGTGG + Intronic
920907734 1:210187810-210187832 CCTTCTTAAGGGCGGAGGGGTGG - Intergenic
921007908 1:211112296-211112318 CCGGGGGAGGGGTGGAGGGGTGG - Intronic
921122332 1:212147929-212147951 ACTGCGGTGGGGCGGGGGTGTGG - Intergenic
922502843 1:226109921-226109943 CCGGCGGAGGAGCGCAGAGGAGG + Intergenic
922796776 1:228343368-228343390 CAGGCGGAGGCGCTGAGGGGCGG + Intronic
922872444 1:228914035-228914057 CCTGGGGAGGGGCCTTGGGGAGG + Intergenic
923008037 1:230067485-230067507 CGGGCGGAGGAGCGCAGGGGCGG - Intronic
923046565 1:230360364-230360386 CCTGTGGAGGGAGGGAGGGAGGG + Intronic
923052023 1:230395895-230395917 CGTGAGGAGGGGAGGAGGGTGGG - Intronic
923149221 1:231218884-231218906 GCTGTGGTGGGGCGGAGGGCAGG - Intronic
923493777 1:234507346-234507368 CTTGGGGTGGGGCGGGGGGGGGG - Intergenic
1062774732 10:135571-135593 TCGGCGGCGGGGCGGCGGGGCGG + Intronic
1062838309 10:650621-650643 CCTGCCGAGGGCCGGAGGCGGGG + Intronic
1062843683 10:689395-689417 CCTGCGGCGGGGCGGGGGCCGGG - Intronic
1062843791 10:689722-689744 GCTGAGGAGGCGCCGAGGGGAGG - Intronic
1063094259 10:2895756-2895778 CCTGGGGAGAGGCTGAGAGGAGG + Intergenic
1063230692 10:4063241-4063263 CCTGCAGAGGGAGGGAAGGGGGG - Intergenic
1063365618 10:5488588-5488610 CCTGCCCAGGGGCAGAAGGGAGG + Intergenic
1063544552 10:6967769-6967791 ACTGCGGGGGGGTGGGGGGGAGG + Intergenic
1063664711 10:8054452-8054474 CCGGCGGAGGGGCGGCGGGCAGG - Intronic
1063821126 10:9837333-9837355 CCTGAGGAGAGGAGGAGAGGTGG - Intergenic
1063872999 10:10439781-10439803 CCTGGGGCGGGGGAGAGGGGAGG + Intergenic
1064714744 10:18165256-18165278 CCTGTGGAAGGGCAGAGAGGAGG + Intronic
1065239853 10:23694672-23694694 CCCGCGGAGGAGCGGCGCGGAGG - Intergenic
1065342691 10:24722759-24722781 GGGGCGGAGGGGCGGAGGGGCGG - Intronic
1065342871 10:24723344-24723366 CGGGCGGCGGGGCGGAGGGAAGG - Intronic
1065915214 10:30349342-30349364 CATGCGTCGGGGGGGAGGGGGGG + Intronic
1066649857 10:37643730-37643752 ACTGGGGAGTGGGGGAGGGGTGG + Intergenic
1066956282 10:42177082-42177104 GCCGGGGAGGGGCGGGGGGGGGG - Intergenic
1067032745 10:42889277-42889299 ACTGGGGAGTGGAGGAGGGGTGG + Intergenic
1067066021 10:43104813-43104835 CCTGTGGAGCGGAGGAGGGGAGG + Intronic
1067495128 10:46754823-46754845 CCTGCTGAGGGGCTGGGGGTGGG - Intergenic
1067599526 10:47585573-47585595 CCTGCTGAGGGGCTGGGGGTGGG + Intergenic
1068855987 10:61797957-61797979 CCTGCGCAGGGGAGGATGGTTGG - Intergenic
1069114138 10:64483525-64483547 TCTGCTGGGGGGCGGCGGGGGGG - Intergenic
1069374880 10:67783671-67783693 CCTGCGGAAAGGCGGTGAGGTGG + Intergenic
1069639113 10:69943643-69943665 TCTGCGGTGGGCCGGTGGGGTGG + Intronic
1069874491 10:71553325-71553347 GCTGCAGAGGAGCTGAGGGGTGG - Intronic
1070165243 10:73892701-73892723 CCTGGTGAGGGGCGGAGGAGCGG - Intergenic
1071651056 10:87393455-87393477 CCTGCTGAGGGGCTGGGGGTGGG + Intergenic
1071890631 10:90002800-90002822 GCTGGGGAGGGGCCGAGTGGGGG + Intergenic
1071979547 10:90989564-90989586 TCTGCAGAGGGGAGGAGGGGAGG - Intergenic
1072161648 10:92772196-92772218 CCTGGGGAGGGATGGAGGGTTGG + Intergenic
1072690211 10:97567830-97567852 CCTGGGGAGGGGAGGGGAGGGGG + Intronic
1072790302 10:98312869-98312891 ACTGCGGAGGGCCAGAGGAGTGG - Intergenic
1072806998 10:98429979-98430001 CGGGTGGAGGGGTGGAGGGGTGG - Intronic
1073043274 10:100621580-100621602 CGGGCGGCGGGGCGGCGGGGCGG + Intergenic
1073062271 10:100739884-100739906 CCGGCCTAGGGGAGGAGGGGAGG + Intronic
1073150982 10:101311248-101311270 ACTGCGGAGTGGGGGTGGGGTGG + Intergenic
1073329012 10:102658787-102658809 CCTTGGGAGGGGTGGAGGTGGGG + Intergenic
1074112876 10:110434718-110434740 CCTGCGGAAGGGCTAATGGGAGG + Intergenic
1074772205 10:116741842-116741864 CCTGGGGATGGGCGGGGAGGTGG + Intronic
1074899533 10:117804340-117804362 CCTGGGGATCGGGGGAGGGGTGG - Intergenic
1075090375 10:119441102-119441124 CCTGTGGAGGGGCGGTCGGAGGG + Intronic
1075519442 10:123135275-123135297 CCTGCGGGAGGGGGGAGGGGCGG - Intergenic
1075576463 10:123581210-123581232 CCAGAGAAGGGGCAGAGGGGAGG - Intergenic
1075656229 10:124162975-124162997 GCTGCGGAGGGAGGGAGGGAGGG + Intergenic
1075669922 10:124257188-124257210 CCTGGGGAGGGGCTCAGGGAGGG + Intergenic
1075952516 10:126493931-126493953 CCAGCGGAGCTGGGGAGGGGTGG - Intronic
1076074840 10:127525074-127525096 CCTGCTGTGGGCAGGAGGGGTGG + Intergenic
1076560553 10:131360469-131360491 CCGGGGCAGGGGCGGTGGGGAGG + Intergenic
1076603862 10:131676999-131677021 CCTGGGGCGGGGCCGGGGGGAGG - Intergenic
1076606791 10:131694641-131694663 TGTGGGGAGGGGCGGAGGGAAGG + Intergenic
1076659723 10:132047676-132047698 CCTGCGGGGGGCGGGACGGGAGG - Intergenic
1076802431 10:132836714-132836736 CCTGGGGTGGGGCTGAGGTGTGG + Intronic
1077011234 11:380245-380267 CCCGGGGAGGAGCGGAGGGCGGG + Intronic
1077172639 11:1174771-1174793 CCGGCCGAGGAGGGGAGGGGAGG + Intronic
1077188539 11:1246162-1246184 TCTCCGGAGTGGAGGAGGGGTGG - Exonic
1077189501 11:1249933-1249955 TCTCCGGAGTGGAGGAGGGGTGG - Exonic
1077244171 11:1527953-1527975 CCTGCAGAGGGGCAGAGGACAGG - Intergenic
1077380888 11:2236877-2236899 CCTGAGGTGGGGCGGCGAGGGGG - Intergenic
1077409127 11:2395344-2395366 CCTGGGGCGGGGCGGGGTGGGGG + Intronic
1077971600 11:7198129-7198151 CCTGGGGAGGGAAGGAGGGAAGG - Intergenic
1078984673 11:16581443-16581465 CCTGTGGAGGGTGGAAGGGGAGG + Intronic
1079363868 11:19792346-19792368 CCTTCGGAGGGCAGGAGGAGGGG - Intronic
1079695575 11:23478040-23478062 CCTGAGGAGGCTGGGAGGGGAGG + Intergenic
1080386399 11:31813377-31813399 CTTGCGGGGGGGCGGGGGGGGGG + Intronic
1080647070 11:34195071-34195093 CCGGCGGGGGGGGGGAGTGGGGG + Intronic
1080663742 11:34317935-34317957 CGTGGGGAGGGGAGGAGTGGGGG - Intronic
1081569157 11:44278823-44278845 CCTGGGGAGGGGAGGAGAGGGGG + Intronic
1081862090 11:46339089-46339111 CCTGCAGAGGGGCTGGGGGCAGG + Intronic
1081940471 11:46936957-46936979 TATGGGGAGGGGCGGAGAGGCGG + Intronic
1081989235 11:47328759-47328781 CCTTCGGACAGGAGGAGGGGAGG + Intronic
1083476933 11:62921138-62921160 CCTGGGGAGCGGGGGAGGGCAGG - Intronic
1083647078 11:64178259-64178281 CCTGGGGAGGGGAGATGGGGTGG - Intergenic
1083684781 11:64369634-64369656 TCGGCGGCGGGGCGGAGCGGTGG + Intronic
1083967579 11:66052086-66052108 CCGGCGGCGGGCCGGAGGGCGGG - Intronic
1084178802 11:67436639-67436661 CCGGGGGAGGGGAGGATGGGAGG - Intronic
1084431473 11:69113847-69113869 CCTGAAGAGGGGCGTCGGGGTGG - Intergenic
1084600461 11:70142524-70142546 CCTGGGGAGTGGCGGGGCGGGGG - Intronic
1084665340 11:70573312-70573334 CCAGCGGTGGGGGGGGGGGGCGG + Intronic
1085423132 11:76380864-76380886 CCTGAGGAGGCGGGGAGGGGAGG - Exonic
1085523316 11:77150624-77150646 CCTGTGGAGGGACGGGGTGGGGG + Intronic
1085786533 11:79456583-79456605 CCTGCTGAGGGCTGGAGGGAAGG - Intergenic
1086106937 11:83157017-83157039 CCTGCGGAAGGGCCGGGGGCGGG + Exonic
1086545971 11:87967868-87967890 CCTGCGGTGGGTAGGAGGGTTGG + Intergenic
1088953164 11:114590591-114590613 CCTACAGAGGGGCTGAGGGCTGG - Intronic
1089067797 11:115675073-115675095 CCTGCAGAGGGGAGGGTGGGTGG + Intergenic
1089191978 11:116660101-116660123 CCTGAGGAGGGGCGGGGAGGAGG - Intergenic
1089401273 11:118166094-118166116 TCAGCTGAGGGGCTGAGGGGTGG - Exonic
1089610172 11:119664534-119664556 CATGGGGAAGGGCGGAGGAGAGG + Exonic
1090352583 11:126116610-126116632 CCAGAGGATGGGGGGAGGGGGGG - Intergenic
1090702980 11:129312918-129312940 GCTGTGGTGTGGCGGAGGGGTGG + Intergenic
1090799043 11:130159553-130159575 CCCCTGGAGGGCCGGAGGGGTGG + Exonic
1090829114 11:130408691-130408713 CCTGCCGGGGGGCGGGGGTGTGG + Intronic
1090972447 11:131655032-131655054 CCGGCGGAGTGGCGGGGGCGGGG - Intronic
1091108550 11:132944176-132944198 CCTACAGAGGGGCGGGGTGGGGG + Intronic
1091124403 11:133082513-133082535 GATGAGGAGGGGAGGAGGGGAGG - Intronic
1091807044 12:3364337-3364359 CCAGCTGAGGAGGGGAGGGGAGG - Intergenic
1092024873 12:5232060-5232082 CCTGGGGTGGAGCAGAGGGGAGG - Intergenic
1094836050 12:34322559-34322581 CCTGCGCAGGGGCTGCTGGGAGG + Intergenic
1094844831 12:34356851-34356873 CCTGCGCATGCGCGGTGGGGTGG + Intergenic
1094847392 12:34367316-34367338 CCTGCGTATGCGCGGTGGGGAGG + Intergenic
1094850204 12:34378946-34378968 CCTGCGTATGCGCGGTGGGGAGG + Intergenic
1094855280 12:34400168-34400190 CCTGCGCATGTGCGGTGGGGAGG - Intergenic
1095283132 12:40380353-40380375 CCTGTTGGGGGGCGGAGGGAGGG + Intergenic
1096533943 12:52258829-52258851 CCGGCGGAGGGGCGGACAGGTGG - Intronic
1096539138 12:52294470-52294492 CATGGGGAAGGGAGGAGGGGAGG + Intronic
1096572598 12:52532461-52532483 CTTGAGGAGGGGCAGAGGGGAGG - Intergenic
1096616588 12:52836531-52836553 TCTGTGGAGGGCAGGAGGGGAGG - Intergenic
1096677722 12:53234510-53234532 CCTGGGGAGGGGCGGTAGAGGGG - Intergenic
1096699266 12:53371518-53371540 CCTGGGGGCGGGCGGAGGGCCGG - Intergenic
1096789068 12:54034040-54034062 CAGCCGGAGGGGCTGAGGGGGGG - Intronic
1096817548 12:54210948-54210970 GCTAAGGAGGGGCTGAGGGGTGG - Intergenic
1097071766 12:56360295-56360317 CCTGCGGAGGGGCGGAGTTGCGG - Intergenic
1097234393 12:57529429-57529451 GCTTCGGGGGGGCGGGGGGGTGG - Exonic
1097598529 12:61664212-61664234 CCTGGGGAGGGTTGGAGGAGGGG - Intergenic
1098108988 12:67101899-67101921 CCTGCTGTGGGGTGGAGAGGTGG + Intergenic
1099365199 12:81759177-81759199 GCGGCGGGGGGGCGGCGGGGGGG - Intronic
1102880947 12:116484317-116484339 CCGGGGGAGGGGGGGCGGGGTGG + Intergenic
1103212095 12:119174677-119174699 CCTGGGGAGGGGCTGGGGGCTGG + Intergenic
1103433098 12:120904345-120904367 CCCGCCGAGGGGAGGAGGGGCGG + Exonic
1103616379 12:122155529-122155551 CCTGCTGAGGGCAGGAGAGGAGG - Intergenic
1103667612 12:122582457-122582479 CTTGCTGAGGTGGGGAGGGGAGG + Intronic
1103851608 12:123937147-123937169 CCTGCGGCGGGGTGGCGTGGTGG + Exonic
1103883286 12:124182919-124182941 CCGGGGGAGGGGCGGGGGTGGGG - Intronic
1104031245 12:125066776-125066798 CCAGCGGAGGGGGTGAGGAGGGG - Intronic
1104058028 12:125245372-125245394 CCTGCAGAGGGGTGGGCGGGAGG - Intronic
1104127514 12:125861783-125861805 CCTGCGCAGGCGCAGAGCGGAGG + Intergenic
1104602358 12:130162323-130162345 CCCGCGGCGGGGCGGCGGGGAGG + Intergenic
1104692303 12:130836140-130836162 CCTGGGGCGGGGCGGGGGAGGGG + Intronic
1104986034 12:132598171-132598193 CGCGCGGAGAGGAGGAGGGGCGG - Intergenic
1104987245 12:132603979-132604001 CCTGCGGAGCCGCGGGGAGGGGG - Intronic
1105210662 13:18254954-18254976 CCTGAGGAGGTGGGGAGGGAGGG + Intergenic
1105215306 13:18280681-18280703 GCTGCGGGGGTGGGGAGGGGGGG + Intergenic
1105514306 13:21076427-21076449 ACAGTGCAGGGGCGGAGGGGCGG + Intergenic
1105520226 13:21124745-21124767 CCTGTCGGGGGGCGGGGGGGGGG - Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1105986824 13:25575696-25575718 CATGGGGAGGGGAGGAGGGATGG + Intronic
1106157522 13:27171856-27171878 CCTGCGCCGGGGCGGAGCCGGGG - Exonic
1106349111 13:28910537-28910559 CCTGCTGGGGGGCTGGGGGGAGG - Intronic
1106810133 13:33350678-33350700 CCAACGGAGGGGAGGAGGGGAGG - Intergenic
1107014029 13:35694893-35694915 ACTGCGGGGGGGGGGGGGGGGGG - Intergenic
1107603919 13:42040488-42040510 CGGGAGGAGGGGCGGCGGGGGGG + Intronic
1108555087 13:51584248-51584270 CCCGGGGAGTCGCGGAGGGGAGG + Intergenic
1108572825 13:51767774-51767796 CCTGGGGCGGGGGGGGGGGGGGG + Intergenic
1109025170 13:57146299-57146321 CTTGGGGTGGGGCGGGGGGGGGG - Intronic
1109833613 13:67826367-67826389 CCTGCCGTGGGGTGGGGGGGAGG + Intergenic
1110884077 13:80610948-80610970 CATGGGGCGGGGGGGAGGGGGGG - Intergenic
1110999809 13:82165035-82165057 CCCACGGAGGGGCTGGGGGGAGG + Intergenic
1111308338 13:86446561-86446583 CTTGCAGAGGGGAGGAGGCGAGG - Intergenic
1111672497 13:91348156-91348178 CCGGCGGAGGGGGGCAGGGCCGG + Intergenic
1111812004 13:93102796-93102818 GCGGGGGCGGGGCGGAGGGGGGG + Intergenic
1111928187 13:94485120-94485142 TCTGCTGGGGGGCGGTGGGGGGG + Intergenic
1112070718 13:95846411-95846433 CGTGCAGAGGGGAGGAGGGGAGG + Intronic
1112494547 13:99894729-99894751 CCTGAGGCGGGGGGGGGGGGGGG + Exonic
1112805914 13:103163757-103163779 CCTGCGGTGGGGAGCAGGGGAGG - Intergenic
1113143728 13:107183836-107183858 CCTGTCGAGGGGAGGAGGGCTGG + Intronic
1113561243 13:111283325-111283347 GCAGCTGAGGGCCGGAGGGGAGG - Exonic
1113897912 13:113777481-113777503 ACTGCTGTGGGGCCGAGGGGAGG + Intronic
1113940327 13:114015416-114015438 CGTGGGGAGGGGCTGAGGGCGGG + Intronic
1114259666 14:21027082-21027104 CCTACGCAGGGGCGCAGGGCAGG + Intronic
1114556489 14:23565310-23565332 CCTGTGGAGGTGAGGAGGTGGGG - Intronic
1114620664 14:24094379-24094401 CCTGGGCAGGGGCTGCGGGGTGG - Exonic
1114901196 14:27061170-27061192 CCTGTTGAGGGGTGGAGGGCTGG - Intergenic
1115238293 14:31229724-31229746 ACTGGGGAGGAGCAGAGGGGTGG - Intergenic
1116323692 14:43502854-43502876 ACTGGAGAGGAGCGGAGGGGAGG + Intergenic
1116898713 14:50341443-50341465 CCTGGGGAGGGTCTGGGGGGGGG + Intronic
1117315407 14:54567110-54567132 GCTGCGAAGGGGCGCGGGGGTGG - Intronic
1118186555 14:63543154-63543176 CGTGGGGAGGGGGGGAAGGGAGG + Exonic
1118366758 14:65102723-65102745 CCCGGGGAGGGGGGGGGGGGCGG + Intergenic
1118749474 14:68795630-68795652 CCCGGGGAGAGGGGGAGGGGAGG - Intronic
1118760766 14:68879180-68879202 CATGCGGAGGGAGGGTGGGGGGG + Intronic
1118854613 14:69611542-69611564 CCCGCGGAGGGGAGGGGGCGGGG - Intergenic
1119231480 14:72983346-72983368 CCTGTGGTGGGGTGGGGGGGAGG - Intronic
1119484380 14:74978393-74978415 CCTGGCGAGGTGCGGAGGGGTGG - Intergenic
1119520108 14:75278942-75278964 CCGGGCGAGGGGCCGAGGGGCGG - Exonic
1119527458 14:75333843-75333865 CCTGGGGAGGAGGGGAGGGGGGG + Intergenic
1119767624 14:77200348-77200370 TGTGCCGAGGGGCTGAGGGGTGG - Intronic
1119821006 14:77616383-77616405 CTGGCGGAGGGGCGGCCGGGCGG - Intronic
1119984857 14:79126317-79126339 CGTGGGGTGGGGCGGGGGGGAGG - Intronic
1120181160 14:81343371-81343393 CCTGGGGAGGGGGAGAGGGGAGG + Intronic
1121539006 14:94711225-94711247 CAGGCGGAGGGGTGGAGAGGGGG - Intergenic
1121539278 14:94712914-94712936 CTTGTGGAGGGGCGGGGGTGTGG + Intergenic
1121559513 14:94864345-94864367 TCAGCGGTGGGGTGGAGGGGAGG + Intergenic
1121578898 14:95011640-95011662 CCCGGGGAGGGGAGGAGGGGAGG - Intergenic
1121797902 14:96750954-96750976 CCAGCAGTGGGGCAGAGGGGTGG - Intergenic
1122027328 14:98887202-98887224 CCTGAGGAGGGAAGGTGGGGCGG + Intergenic
1122647870 14:103207209-103207231 CCTGTGGCGCGGGGGAGGGGCGG - Intergenic
1122651692 14:103230072-103230094 TATGGGGAGGGGAGGAGGGGGGG + Intergenic
1122789108 14:104176916-104176938 CATGCGGAGGGGCCGAGGCCGGG - Exonic
1122834875 14:104425674-104425696 CCTGGGAAGGGGCGGAGAAGAGG + Intergenic
1122837214 14:104436182-104436204 CCTGCAGATGGGCGGAGCTGAGG + Intergenic
1122860986 14:104582310-104582332 CCTGCAGTGGGGCGTGGGGGCGG - Intronic
1122937584 14:104967184-104967206 GCTGCGGAGGGACGGGGAGGCGG - Intronic
1122986675 14:105214815-105214837 CGTGGGGAGGGGTGGTGGGGAGG - Intronic
1123423257 15:20148297-20148319 GCGGCGGCGCGGCGGAGGGGCGG + Intergenic
1123676409 15:22714517-22714539 CCTGCAGGGGCGCGGGGGGGAGG + Intergenic
1124123417 15:26912049-26912071 TCTGAGGTGGGGTGGAGGGGAGG - Intronic
1124328624 15:28788778-28788800 CCTGCAGGGGCGCGGGGGGGAGG + Intergenic
1124619648 15:31266425-31266447 GCTGGGGCGGGGCGGGGGGGGGG - Intergenic
1124638151 15:31378132-31378154 CTTTCGGATGGACGGAGGGGTGG - Intronic
1125483057 15:40093573-40093595 GCTGGGGAGGGGAGGAGAGGGGG - Intronic
1125728507 15:41880304-41880326 CCTGCGGAGCTGGGGAGAGGTGG + Exonic
1125759675 15:42088120-42088142 CGTCCGGAAGGGCTGAGGGGTGG - Intronic
1126407075 15:48332123-48332145 CCCGGGGAGGGGCGGTGGGTGGG + Intronic
1126808960 15:52381418-52381440 ACTGTGGAGGGGGTGAGGGGTGG + Intronic
1127259787 15:57319532-57319554 CCTGCGGAGGGAGGGAAGGAGGG - Intergenic
1127380977 15:58430324-58430346 ACTGCGGAGTGGTGGATGGGTGG - Intronic
1127480323 15:59372012-59372034 GCAGCGGAGCGGCGGCGGGGAGG + Intronic
1128211978 15:65909348-65909370 CCTGCAGAGGGAGGGAGGGAGGG - Intronic
1128367397 15:67013997-67014019 CCTGCAGTGGGGCTGAGGGAGGG + Intergenic
1128582180 15:68818195-68818217 CCCGCGCCGGGGAGGAGGGGCGG + Intronic
1128742744 15:70095467-70095489 CCTGCGGCTGGGCGGTGGTGGGG + Intronic
1128743016 15:70096399-70096421 TCTCCGACGGGGCGGAGGGGGGG + Intronic
1129222022 15:74136556-74136578 CGGGCGGGGGGGCGGATGGGCGG + Exonic
1129334122 15:74842507-74842529 CCCGGGGAGGGGCGGGGTGGGGG - Intronic
1129412022 15:75355524-75355546 GCTGGGGAGGGGCCGAAGGGTGG - Exonic
1129424517 15:75454343-75454365 CCTGCAGGGGAGCTGAGGGGCGG - Intronic
1130283642 15:82538424-82538446 CCTGGGGAGAGGAGGAGGAGAGG - Intronic
1130467508 15:84199952-84199974 GCTGCGGGGGGGGGGGGGGGAGG + Intergenic
1131263901 15:90904415-90904437 CCAGCGGGGGGTGGGAGGGGAGG - Intronic
1131714608 15:95094813-95094835 GGTGGGGAGGGGTGGAGGGGTGG - Intergenic
1132150872 15:99457407-99457429 CCTGGGGAGGGGGGCGGGGGTGG - Intergenic
1132522294 16:397333-397355 CCGGCGGGGACGCGGAGGGGAGG + Intronic
1132589124 16:718742-718764 CCTGAGGAGGGGCAGAAGGTGGG - Exonic
1132627970 16:901320-901342 CCTGCACAGGGGCAGAGGGTGGG - Intronic
1132663181 16:1070554-1070576 CCTTTGGAGGAGCGGAGGGAGGG + Intergenic
1132687698 16:1169155-1169177 CCTGCGGCGGGGTGGGGGTGGGG + Intronic
1132833958 16:1943236-1943258 CCTCGGGAGGGGCGGGGAGGTGG - Exonic
1132839960 16:1974115-1974137 CCTGGGGAAGGGCAGTGGGGCGG + Intronic
1132868458 16:2104993-2105015 CTAGGGGAGGGGAGGAGGGGAGG + Intronic
1132973880 16:2702030-2702052 CCTGAGCTGGGGCGGAGGGAGGG - Intronic
1133097651 16:3458216-3458238 CCTGCGGCGGGGCGCCGAGGGGG + Intronic
1133328773 16:4958354-4958376 GCTGTGGAAGGCCGGAGGGGCGG - Exonic
1133650191 16:7805504-7805526 CCTTCAGGGGGGCGGGGGGGTGG + Intergenic
1133774097 16:8884474-8884496 CCTCTGCAGCGGCGGAGGGGCGG - Intergenic
1134285677 16:12860181-12860203 CCTCCGGAGGGGAGGAAGGCTGG - Intergenic
1134524366 16:14932806-14932828 CCTGCAGAGGCGCGGGAGGGAGG - Intronic
1134548534 16:15128135-15128157 CCTGCAGAGGCGCGGGAGGGAGG + Intronic
1134711955 16:16331293-16331315 CCTGCAGAGGCGCGGGAGGGAGG - Intergenic
1134719813 16:16374586-16374608 CCTGCAGAGGCGCGGGAGGGAGG - Intergenic
1134947613 16:18337299-18337321 CCTGCAGAGGCGCGGGAGGGAGG + Intergenic
1134954873 16:18377401-18377423 CCTGCAGAGGCGCGGGAGGGAGG + Intergenic
1135047868 16:19168977-19168999 CCAGGGGAGGGGCCGTGGGGAGG + Intronic
1135321868 16:21502543-21502565 CCTGCGGTGGGGGGGGGGGGGGG + Intergenic
1135766220 16:25179852-25179874 CAGGCGGCGGGGCGGTGGGGGGG - Intergenic
1135911942 16:26569353-26569375 TCTGCGGGGGTGTGGAGGGGCGG + Intergenic
1136237732 16:28925016-28925038 CCTGCGGATGGGGGGTGGAGAGG - Intronic
1136267621 16:29130602-29130624 CCTGGCGAGGGGCGGCAGGGCGG + Intergenic
1136381841 16:29899575-29899597 CCTGGGGACGGGCGGAGGGAGGG + Intergenic
1136387265 16:29936738-29936760 ACTGCAGAGGGGAGGAAGGGAGG + Intergenic
1137291949 16:47057776-47057798 CCTGCGGAGGGCAGGAAGGTTGG + Intergenic
1137439226 16:48483880-48483902 ACTGTGGAGGGACGGAGAGGGGG + Intergenic
1137655203 16:50153366-50153388 TCGGCGGAGGGGCGGAGGGGCGG + Intronic
1137655207 16:50153374-50153396 GGGGCGGAGGGGCGGAGGGAGGG + Intronic
1137686739 16:50391713-50391735 CCTGGGGAGGGTTGGGGGGGCGG + Intergenic
1138231020 16:55336348-55336370 GCTGTGGATGGGCAGAGGGGTGG + Intergenic
1138398885 16:56730008-56730030 CCGGGGGCGGGGCGGAGGTGGGG - Intronic
1138516205 16:57536577-57536599 CCGCCGGAGGGGCCGAGGGAGGG + Exonic
1138766533 16:59612265-59612287 GCTGGGGCGGGGTGGAGGGGGGG - Intergenic
1139475239 16:67199615-67199637 CCTGCGGAGGGCGGGAGGGCAGG + Intronic
1139528096 16:67528776-67528798 CCAGGGGAGGGGCGGCGGGGCGG + Intronic
1139546635 16:67652874-67652896 GGGGCGGAGGGGCAGAGGGGCGG + Intronic
1139549816 16:67666975-67666997 CCTCGGCAGGGGCGGAGAGGCGG + Exonic
1141430721 16:83969062-83969084 CCGGTGGAGGGGCGGAGGAGGGG - Intronic
1141834747 16:86531405-86531427 GCTGGGGAGGGGAAGAGGGGAGG + Exonic
1142070925 16:88090946-88090968 CCTGGCGAGGGGCGGCAGGGCGG + Intronic
1142170161 16:88617672-88617694 CCTGCGGTGGGGTTGTGGGGTGG + Intronic
1142240311 16:88941734-88941756 CCTGCGGAGGGGGAGAGGGTGGG - Intronic
1142292548 16:89199655-89199677 CCTGAGAGTGGGCGGAGGGGAGG + Intronic
1142307468 16:89293633-89293655 GCTGCGGAGGGGAGGAGGCGGGG + Intronic
1142412517 16:89923739-89923761 CCTGCGGAGGCCCGGTGGAGGGG - Intronic
1142482382 17:227083-227105 CCTGTGGAGGGGCCCAGGAGGGG - Intronic
1142611258 17:1110060-1110082 CCTGCGGTGGGGTGGCTGGGGGG - Intronic
1142697975 17:1643967-1643989 CCTGCGGGGGTGGGGACGGGAGG + Exonic
1142869343 17:2810022-2810044 CCTGGGGTGGGGCGGGGGGAGGG - Intronic
1143174769 17:4949604-4949626 CCTGGGGAGGGCGGGACGGGCGG + Intronic
1143385930 17:6530472-6530494 CTTGGGGAGTGGGGGAGGGGAGG + Intronic
1143399461 17:6633869-6633891 CCTCTGGAGGGGAGGAGTGGGGG + Intronic
1143477666 17:7211814-7211836 GCTGCGGCGGGGGGGGGGGGGGG + Intronic
1143754965 17:9060182-9060204 GCTGAGGAGGAGAGGAGGGGTGG - Intronic
1145733853 17:27212671-27212693 CGTCCGGGAGGGCGGAGGGGGGG + Intergenic
1145998243 17:29116728-29116750 CCGGCGGGGGGGGGGGGGGGGGG - Intronic
1146164079 17:30574655-30574677 CCTGCGGGGTGGAGGGGGGGTGG - Intergenic
1146197192 17:30824148-30824170 CCTGCGGTGGGTAGGCGGGGAGG - Intronic
1146956716 17:36940268-36940290 CCTGCGGGGGGGTGGGGGTGGGG - Exonic
1147141256 17:38461716-38461738 CCTGGGGAAGGGAGGAGGTGGGG + Intronic
1147145899 17:38484322-38484344 CGTGAGGAGAGGCGGAAGGGAGG + Intronic
1147172643 17:38631051-38631073 CCTCCGGAAGGGAGGTGGGGGGG + Intergenic
1147184787 17:38707200-38707222 CCTGAGGTGGGGCAGAGGGAGGG - Intronic
1147588571 17:41666891-41666913 CTTGCGGAGGGGGGAGGGGGTGG - Intergenic
1147668826 17:42165176-42165198 TCTGGGGTGGGGCTGAGGGGTGG + Intronic
1147738879 17:42659223-42659245 ACTGCGCAGGCGCGGAGCGGTGG + Intergenic
1147793044 17:43025182-43025204 CTGGGGGCGGGGCGGAGGGGGGG + Intergenic
1148108161 17:45130464-45130486 GCCGCGGAAGGGCTGAGGGGAGG - Intronic
1148203634 17:45766038-45766060 CCTGGGGCGGGGCTGTGGGGTGG + Intergenic
1148740783 17:49891106-49891128 CCTGAGGAGGGAAGGAGGTGTGG - Intergenic
1148774557 17:50088203-50088225 ACTGCGGAGGGGAGGAGGTGGGG - Intronic
1148851804 17:50559240-50559262 ACTGCGGAGAGGCGGCGGGATGG - Intergenic
1148860955 17:50604133-50604155 CCTGGGGAGGGGAGGGAGGGAGG - Exonic
1149547946 17:57518318-57518340 CCTGGGGAGGGGAGGGGGAGAGG - Intronic
1149569614 17:57663162-57663184 CCAGTGGCGGGGTGGAGGGGCGG + Intronic
1150277990 17:63911858-63911880 CTTGGGGCGGGGCGGAGGGAGGG + Intronic
1150613106 17:66749285-66749307 GCTCCGGAGGGGTGGAGGGCAGG - Intronic
1151366105 17:73617322-73617344 CCTGCGGAGGGGAGGGGAGAGGG + Intronic
1151558645 17:74859711-74859733 GCTGCGGAGGGGAGGGGGCGGGG - Intronic
1151692241 17:75693814-75693836 CCAGCGGAGAGGGGGAGGAGGGG - Intronic
1152024551 17:77800281-77800303 GCTGCGGAGGTGGGGCGGGGCGG + Intergenic
1152198773 17:78933292-78933314 TCTGCGGAGGGGCGGTAGGTTGG - Intergenic
1152212119 17:79008269-79008291 CCTGCGGTGGGGCTGCAGGGAGG + Intronic
1152363528 17:79843120-79843142 CCTCCAGAAGGGTGGAGGGGCGG - Intergenic
1152613434 17:81327150-81327172 CTGGCGGGGGGGCGGAGGGTGGG - Intronic
1152636608 17:81432855-81432877 CCTGGGGATGGGGGGAAGGGTGG - Intronic
1152636635 17:81432904-81432926 CCTGGGGATGGGGGGAAGGGTGG - Intronic
1152643593 17:81458999-81459021 CCTGGGGAGGGGTGGTGGGTAGG + Intronic
1152777582 17:82212579-82212601 GCTGCGGCGGGGCGGGGCGGGGG - Intronic
1152782632 17:82232906-82232928 CCTGGGGGGCGGCGGGGGGGGGG + Intronic
1152902564 17:82951791-82951813 CCTGAGGAGGGGTGGGGTGGGGG + Intronic
1152910645 17:83003288-83003310 ACTGCGGAGGGCGGGAGGGCGGG - Intronic
1152910747 17:83003704-83003726 CATGCGGAGGGCGGGAGGGCGGG - Intronic
1152910818 17:83003984-83004006 CATGCGGAGGGCGGGAGGGCGGG - Intronic
1152911014 17:83004745-83004767 ACTGCGGAGGGTGGGAGGGCGGG - Intronic
1152932969 17:83119917-83119939 CCTGGGGAGGGGCTGGGGCGGGG + Intergenic
1153202160 18:2656783-2656805 TCTGGGGCGGGGCGGCGGGGGGG + Intronic
1153267316 18:3284065-3284087 CCTGTGGAGGGGAGGGGCGGAGG + Intergenic
1153285184 18:3450073-3450095 GCGGGGGAGGGGCGGAGGAGCGG + Intronic
1153382469 18:4454877-4454899 CCCGCGGAGGGGCTGCGGGCTGG - Intronic
1153914662 18:9734657-9734679 CCTGCGGGGGAGCAGTGGGGTGG + Intronic
1154377348 18:13821266-13821288 CCTGCGGAGGGAGGGATGGGAGG - Intergenic
1155090320 18:22502955-22502977 CCTGCGGGGTTGCGGAGGTGTGG - Intergenic
1155654472 18:28177633-28177655 GCAGCGGAGGCGCGGAGTGGCGG - Intergenic
1156325056 18:36067432-36067454 CACGCGGTGGGGCCGAGGGGAGG + Exonic
1157610499 18:48952144-48952166 CGAGCAGAGGGCCGGAGGGGGGG - Intergenic
1157613791 18:48975519-48975541 GCGGCGGAGGGGCCGAGGGGTGG + Intergenic
1157723668 18:49945737-49945759 CTGGTGGAGGGGAGGAGGGGAGG + Intronic
1158475086 18:57772851-57772873 CCTGCAGAGGTGAGGAGGTGGGG + Intronic
1159178152 18:64865958-64865980 CCTGCTGTGGGGTGGAGGGAGGG - Intergenic
1159400769 18:67931040-67931062 CCTGTGGAGGTGCGGTGGGCAGG + Intergenic
1159586556 18:70288720-70288742 CCAGCGGAGGGGCGCGGGGGTGG + Intergenic
1160146282 18:76367612-76367634 ACTATGGAGGGGCGGAGGGATGG - Intronic
1160521669 18:79511587-79511609 GCTGTGGAGGGGTGGAGGGCAGG + Intronic
1160551004 18:79693883-79693905 CCTGCAGGGGAGCGGAGGGGCGG - Intronic
1160691914 19:464125-464147 CCTGCGGGGGGCGGGCGGGGGGG + Exonic
1160714624 19:570658-570680 GTTGGGGAGGGGCGGAGGGGTGG + Intergenic
1160761720 19:788866-788888 CCTGCAGAGTGGGGGTGGGGCGG - Intergenic
1160803457 19:980711-980733 CCCAGGGAGGGGAGGAGGGGAGG + Intergenic
1160807472 19:998751-998773 ACTGGGGAGGGACGGAGGGAGGG - Intergenic
1160816874 19:1040147-1040169 CCTGCTGCTGGGCGGAGGGAAGG + Exonic
1160844896 19:1161894-1161916 CCTGGGGAGCCGCGGGGGGGGGG + Intronic
1160866374 19:1258047-1258069 GCTGGGGCGGGGCGGAGGGCAGG - Exonic
1160867608 19:1262722-1262744 GCAGGGGAGGGACGGAGGGGCGG - Intronic
1160896939 19:1407551-1407573 CGTGCGCAGGGGCGGCGGCGCGG + Intronic
1160981025 19:1816644-1816666 CCTGGGGAGAGGCGGCTGGGAGG + Intronic
1161076842 19:2289957-2289979 CCCGCGGGGGAGGGGAGGGGAGG + Exonic
1161206179 19:3042307-3042329 GCGGGGGAGGGGCAGAGGGGCGG + Intronic
1161210532 19:3062971-3062993 CCTGGGGTGGGGCGGGGCGGGGG + Exonic
1161226711 19:3150315-3150337 CGTGGGGAGGGGCTGAGGGCAGG + Intronic
1161265143 19:3360316-3360338 TCTGCCGAGGGGCGGGGCGGGGG - Intronic
1161266362 19:3366522-3366544 CCGGCCGCGGGGCGGGGGGGGGG + Intronic
1161378795 19:3953632-3953654 GCTGCAGGGGGGCGGGGGGGGGG + Intergenic
1161410414 19:4113851-4113873 CCTGCGGGGTGGCGGCCGGGGGG - Intronic
1161462960 19:4409737-4409759 TCTGCGGAGGGGCGTGGAGGTGG - Exonic
1161582546 19:5088658-5088680 TTTGCGGGGGGGGGGAGGGGGGG - Intronic
1161723770 19:5917170-5917192 CCTGGGCAGGGGCAGAGGGCTGG + Exonic
1161733057 19:5974025-5974047 CCTGGGGAGTGGGGGTGGGGAGG - Intronic
1161801501 19:6418876-6418898 CCTGGGAAGGGGAGGAGCGGGGG + Exonic
1162033644 19:7927767-7927789 GCTGCAGAGGGGCCGAGAGGGGG + Exonic
1162126533 19:8502466-8502488 CCTGTGGAGGGGCGGGCGGGGGG - Intronic
1162535983 19:11262850-11262872 CCTGAGGAGGGAGGGAGGGAAGG + Intergenic
1162780045 19:13002224-13002246 CGGGAGGAGGGGAGGAGGGGAGG - Intronic
1162909729 19:13842499-13842521 CCTACGGAGCGGGGGAAGGGCGG - Intergenic
1162956728 19:14102914-14102936 CCTGGGAAGGGAAGGAGGGGAGG + Exonic
1163135795 19:15310363-15310385 CCTTCGGGGGGGGGGGGGGGGGG - Intronic
1163687143 19:18718149-18718171 GCTGGGGAGGAGAGGAGGGGAGG - Intronic
1164551051 19:29212835-29212857 CCTGCTGGGGGCCGGAGGAGCGG + Intronic
1164813489 19:31176264-31176286 GCTGTGTAGGGGAGGAGGGGTGG + Intergenic
1165246225 19:34500043-34500065 ACGGGGGAGGGACGGAGGGGAGG - Intronic
1165404016 19:35619071-35619093 CTTGTGGAGGGCCAGAGGGGAGG + Intronic
1165757736 19:38304196-38304218 CCTGCAGAGGAGCGGAGCAGGGG - Exonic
1166304092 19:41928000-41928022 CCGGCGCAGGGGCGGGGAGGGGG - Intronic
1166523169 19:43495002-43495024 CCTGAGGAGGGGCTGGGGGCTGG + Intronic
1166837658 19:45677283-45677305 GCTGCGGCGGGGTGGGGGGGCGG + Intronic
1167270175 19:48501953-48501975 CCAGGGGAGGGGGGCAGGGGAGG - Intronic
1167293653 19:48637377-48637399 TGCGCGGAGGGGCGGAGGAGGGG + Exonic
1167306855 19:48714560-48714582 CCTGGGGAGGGGCGGGGCGTGGG + Exonic
1167438069 19:49491403-49491425 ACTGCGGGGGGGGGGGGGGGGGG - Exonic
1167575389 19:50315366-50315388 CCAGTGGAGGGGGGGAAGGGCGG - Intronic
1167602959 19:50465176-50465198 CAGGCGGAGGGGCGCTGGGGCGG - Intronic
1168063814 19:53908531-53908553 CCCGCCGAGGGTCGGAGCGGGGG - Intergenic
1168063982 19:53909258-53909280 ACTGCGGAGGAGGGGAGGGGCGG - Intergenic
1168245466 19:55111135-55111157 CGTGGGGTGGGGGGGAGGGGGGG + Intronic
1168258334 19:55179322-55179344 CCTGCGGAGGGGCGAGGACGAGG - Intronic
1168332317 19:55577918-55577940 CAGGCGGAGCGGCGGAGGGCAGG + Exonic
1168377249 19:55890788-55890810 CCACCGGAGGGGCTGACGGGGGG + Intergenic
1168394649 19:56037842-56037864 CCTGAGGGAGGGAGGAGGGGAGG + Intronic
1168467721 19:56617812-56617834 CCAGCAGAGGGACAGAGGGGAGG - Intronic
1168728740 19:58607229-58607251 CCGGCGGAGGCGCAGAGAGGGGG - Intergenic
1202693095 1_KI270712v1_random:105053-105075 GCGGCGGAGAGGCGGAGAGGCGG + Intergenic
926189881 2:10721012-10721034 CCTGTGGATGGGGGGTGGGGGGG - Intergenic
926707085 2:15844604-15844626 GGTGGGGTGGGGCGGAGGGGGGG - Intergenic
926794979 2:16611758-16611780 TGGGCGGAGGGGCGGAGGTGGGG + Intronic
927022198 2:19029009-19029031 ACTGTGGAGGGGCGGGGGCGGGG - Intergenic
927070108 2:19519580-19519602 CTTGCGGGGGGGCGGCGGTGGGG - Intergenic
927142438 2:20139625-20139647 GCTGGGGAGCGGCTGAGGGGAGG + Intergenic
927490999 2:23520994-23521016 CCTGAGGGGGAGCGGGGGGGGGG - Intronic
927658443 2:24971701-24971723 CCTGCTCGGGGGCGGAGAGGAGG + Intronic
927703446 2:25282551-25282573 CCTGCTGGGGGGCAGAAGGGCGG - Exonic
927878165 2:26672644-26672666 CCTGGGGAGAGGCAGAAGGGAGG - Intergenic
927948096 2:27149372-27149394 CCTGCAGAGGGGTCCAGGGGAGG + Intronic
928096259 2:28406911-28406933 TCTGAGGAGGTGGGGAGGGGAGG + Intronic
930081679 2:47454835-47454857 CCTGTTGAGGGGTGGAGGGAGGG - Intronic
930931739 2:56892993-56893015 CCTGCTGTGGGGTGGAGGGAAGG - Intergenic
931638788 2:64363363-64363385 CCTGCTGAGGGGATGAGTGGAGG + Intergenic
932574748 2:72956411-72956433 CCTGTGGAGGGGAGGAGGGCTGG + Intronic
932699889 2:73985182-73985204 GCTCCGGAGTGGGGGAGGGGCGG + Intergenic
932893195 2:75613343-75613365 CCTGCGGGGGGGGGGGGGGGGGG + Intergenic
933701129 2:85256090-85256112 GCTCAGGAGGGGAGGAGGGGTGG + Intronic
933901392 2:86852914-86852936 CCTGGGGAAGGAAGGAGGGGAGG + Intronic
933974459 2:87497221-87497243 TCTGGGGAGGGGCGGAGGTGAGG - Intergenic
934299558 2:91769019-91769041 CTGGGGGAGGGGCGGGGGGGAGG - Intergenic
934656013 2:96117043-96117065 CCTGCGGAGAGGTGGGGGAGCGG + Intergenic
934857746 2:97739538-97739560 CCTGGGGTGGGGCTGAGGGTGGG - Exonic
935779158 2:106496323-106496345 CCTGGGGAAGGAAGGAGGGGAGG - Intergenic
936319365 2:111453598-111453620 TCTGGGGAGGGGCGGAGGTGAGG + Intergenic
937150939 2:119685210-119685232 CCTGCAAAGGGGGGGGGGGGCGG - Intronic
937216395 2:120316216-120316238 CCTGGCAAGGGCCGGAGGGGTGG + Intergenic
937237930 2:120441942-120441964 CCTGGAGAGGGACGGAGGGGTGG - Intergenic
937248055 2:120506219-120506241 CCTGCGGGAAGGCTGAGGGGTGG - Intergenic
937316000 2:120932465-120932487 ACTCCGGAGGGGCAGAGGGCAGG - Intronic
937478236 2:122234141-122234163 CTGGCGGGGGGGCGGGGGGGCGG + Intergenic
937867789 2:126767048-126767070 CCTGCAGAGGGGAGGAGTAGCGG - Intergenic
937910405 2:127073018-127073040 CCTGCTGTGGGGGGGAGGTGGGG - Intronic
937930936 2:127204860-127204882 CATGCGGAGGTGTGGAGGTGTGG - Intronic
937950878 2:127387512-127387534 GCCGCGCTGGGGCGGAGGGGCGG - Intronic
938255589 2:129857869-129857891 GCTGTGGAGGGGTGGTGGGGGGG - Intergenic
938309052 2:130274296-130274318 CCTGCTAAGGGGTGGGGGGGTGG - Intergenic
938639882 2:133266943-133266965 CCGGCGGAGGGGAGGGGAGGGGG - Intronic
940160781 2:150711129-150711151 TCTGCGTGGGGGTGGAGGGGTGG + Intergenic
940574288 2:155479779-155479801 CCTGTTGTGGGGTGGAGGGGAGG + Intergenic
941603054 2:167563784-167563806 CCTCCGGGGGGGAGGTGGGGGGG - Intergenic
941666462 2:168247632-168247654 CCGGCGGAGGCGGGGAAGGGAGG + Exonic
941806623 2:169716824-169716846 CCTGGGGCGGGGTGGGGGGGTGG - Intronic
942314202 2:174682951-174682973 CATGTGGCGGGGCGGCGGGGGGG - Intergenic
943682882 2:190786390-190786412 CCGGGGGTGGGGAGGAGGGGCGG - Intergenic
944562731 2:200957005-200957027 CCTGCGGGTGGGTGGAGGGAGGG + Intronic
944697731 2:202217990-202218012 GATGGGGAGGGGGGGAGGGGAGG + Intronic
946407195 2:219498029-219498051 CCTGCGGAAGGGCGGCGGGGAGG - Intronic
946409955 2:219510929-219510951 GCTGTGCAGGGGCCGAGGGGCGG - Intergenic
946481398 2:220060264-220060286 CATGCTGAGGGGCTGATGGGAGG - Intergenic
947398639 2:229711848-229711870 CCTGGGGTGGTGGGGAGGGGAGG - Intronic
947841309 2:233209574-233209596 GCTGCGGGGGGGTGGGGGGGGGG - Intergenic
947912322 2:233809453-233809475 CATGCAGAGGGGCTGGGGGGCGG + Intronic
948854756 2:240724927-240724949 CCGGCGGCGGGGGGGGGGGGGGG + Intronic
948920715 2:241064731-241064753 CCTGCGTGGGTGTGGAGGGGCGG - Intronic
948953800 2:241272314-241272336 CCGCCGGAGCGGGGGAGGGGAGG + Intronic
948995487 2:241576214-241576236 CCAGGGGAGGGGTGGAGGGCTGG - Intergenic
949040063 2:241843996-241844018 GCTGGGGTGGGGCGCAGGGGTGG + Intergenic
1169081604 20:2800661-2800683 GCTGCGGAGGGGCGGGGGGCAGG - Intergenic
1170578461 20:17681506-17681528 CCGGCCGAGGGGAGGAGGGCGGG - Intronic
1171012045 20:21514114-21514136 CCTGGGGAGGCGGGGAGAGGGGG + Intergenic
1171035688 20:21710681-21710703 CCTGGGGAGTGGGGGTGGGGTGG + Intronic
1171185501 20:23121524-23121546 CATGCGGGGGGCAGGAGGGGAGG - Intergenic
1171447752 20:25216808-25216830 CCTGCTGAGGTGCTGCGGGGTGG + Intronic
1171878258 20:30598154-30598176 CCTTAGGAGGGGAGGAGGGCAGG - Intergenic
1171974801 20:31587720-31587742 GCTGGGGAAGGGCGGAGGGAAGG + Intergenic
1172146578 20:32762209-32762231 CGCGGAGAGGGGCGGAGGGGAGG + Intergenic
1172320943 20:33994475-33994497 CCCGGCGAGGGGCGGAGGGAGGG + Intronic
1172360783 20:34311509-34311531 GGCGCGGAGGGGCGGAGAGGGGG + Intronic
1172589256 20:36105931-36105953 CCTGGGGAGGAGGGGAGGAGAGG - Intronic
1172638808 20:36428570-36428592 CCAGCTGAGGGGCAGAGGGTGGG - Intronic
1173166287 20:40689124-40689146 CGCGCGGTGGGGCTGAGGGGAGG + Exonic
1173579539 20:44137398-44137420 CCTGGGGAGGGGCGGGAGGCGGG - Intronic
1174140288 20:48408356-48408378 CCTGGGGAGGGGGAGAGGGTGGG - Intergenic
1174384557 20:50179437-50179459 CCTGTGGCGGGGCGTGGGGGTGG + Intergenic
1174426318 20:50433991-50434013 CCTGCAGGGGAGGGGAGGGGAGG - Intergenic
1175073365 20:56353470-56353492 CCTGCTGAGGGGCACAGTGGTGG - Intergenic
1175231038 20:57473435-57473457 CCTGCGGGGGGACGCTGGGGAGG + Intergenic
1175268990 20:57720441-57720463 CCCGCGGGGGGGGGGTGGGGGGG + Intergenic
1175521235 20:59604056-59604078 CCTGCCGGGGGGCGGGGGGGCGG - Intronic
1175715824 20:61253410-61253432 CCTGGGCGGAGGCGGAGGGGCGG + Intronic
1175765246 20:61587876-61587898 CCTGGGCGGGGGCGGAGTGGGGG - Intronic
1175928614 20:62482788-62482810 CCAGAGGAGGGAGGGAGGGGAGG - Intergenic
1176059771 20:63167518-63167540 GCTGAGGAGGGGCTGAGGTGGGG - Intergenic
1176523542 21:7846877-7846899 CCTGTTGTGGGGTGGAGGGGGGG + Intergenic
1176547967 21:8209493-8209515 GCCGCGGACGGGCGGACGGGAGG - Intergenic
1176555861 21:8253708-8253730 GCCGCGGACGGGCGGACGGGAGG - Intergenic
1176556826 21:8257549-8257571 TCGGAGGAGGGGCGGCGGGGAGG - Intergenic
1176566759 21:8392104-8392126 CCGGCGGCGCGGCGCAGGGGTGG - Intergenic
1176566898 21:8392528-8392550 GCCGCGGACGGGCGGACGGGAGG - Intergenic
1176574798 21:8436742-8436764 GCCGCGGACGGGCGGACGGGAGG - Intergenic
1176575765 21:8440590-8440612 TCGGAGGAGGGGCGGCGGGGAGG - Intergenic
1176611412 21:8988035-8988057 GCCGCGGACGGGCGGACGGGAGG - Intergenic
1178416822 21:32411741-32411763 CCGGCGGAAGGGAGGAGGGCGGG - Intergenic
1178657562 21:34476889-34476911 CCTGTTGTGGGGTGGAGGGGGGG + Intergenic
1178891289 21:36523042-36523064 CCTGGGGAGGTGGGGAGGGGTGG - Intronic
1179137932 21:38696981-38697003 CCTGTGGTGGGGCAGAGGGGAGG + Intergenic
1179170135 21:38966587-38966609 TCTGCGGGGGGGGGGGGGGGGGG - Intergenic
1179714228 21:43279630-43279652 CCGCCCGAGGGCCGGAGGGGAGG + Intergenic
1179802255 21:43816593-43816615 GTTGGGGAGGGGTGGAGGGGAGG - Intergenic
1179874687 21:44261949-44261971 CCCGCGGGGGCGGGGAGGGGCGG + Exonic
1179880109 21:44290028-44290050 ACTGGGGAGGGCCAGAGGGGCGG - Exonic
1180066584 21:45415501-45415523 CATGCGCAGGGGCGGCGGAGCGG + Intronic
1180232626 21:46436471-46436493 CCAGCGGGGGGGGGGGGGGGGGG - Intronic
1180780724 22:18517931-18517953 CCTGAGGAGGTGGGGAGGGAGGG + Exonic
1180994659 22:19959541-19959563 GCTGGGGCGGGGCGGAGCGGAGG + Intronic
1181094214 22:20495092-20495114 CCCGCGGAGGGCCGGAGCGAGGG + Intronic
1181182826 22:21079354-21079376 CCTGAGAAGGGGCGGAGAGCCGG - Intergenic
1181199619 22:21209568-21209590 CCTGAGGAGGTGGGGAGGGAGGG + Intronic
1181299251 22:21867656-21867678 CCGGCGGGCGGGCGGAGGGAGGG + Intronic
1181400141 22:22646290-22646312 CCTGAGGAGGTGGGGAGGGAGGG - Intronic
1181462780 22:23095195-23095217 CCTGAGGTGGGGCTGCGGGGAGG + Intronic
1181556457 22:23674446-23674468 CCTGGGGAGGCGGGGAGGAGAGG - Intergenic
1181639661 22:24189960-24189982 GGTGCGGGGAGGCGGAGGGGTGG - Intergenic
1181649223 22:24249500-24249522 CCTGAGGAGGTGGGGAGGGAGGG + Intergenic
1181673211 22:24435701-24435723 CCTGAGGAGGGTTGGAGGCGTGG + Intronic
1181702113 22:24627388-24627410 CCTGAGGAGGTGGGGAGGGAGGG - Intronic
1183311692 22:37113235-37113257 CCTGGTGAGGGGATGAGGGGAGG + Intergenic
1183452860 22:37906275-37906297 CGAGGGGAGGGGCGGAGGCGGGG - Exonic
1183492704 22:38125084-38125106 CCTGTGCAGGGGCTGAGGTGAGG - Intronic
1183710869 22:39502464-39502486 CCGGCGGCTGGGCGGCGGGGAGG + Intronic
1183829523 22:40410426-40410448 CCTGCGGTGGGGCTGAGGGGTGG - Exonic
1184245667 22:43234694-43234716 CCTGGTGTGGGGCGGTGGGGTGG - Intronic
1184472357 22:44702855-44702877 CCGGCGGGTGGGCGGCGGGGTGG + Intronic
1184481795 22:44752519-44752541 TGGGCGGAGGGGCGGGGGGGCGG + Intronic
1184663510 22:45976244-45976266 CCTGCGGAGGCCCGGGAGGGCGG - Intronic
1184663811 22:45977320-45977342 CCTGGGGAGGGGGGGCCGGGGGG - Intergenic
1184785237 22:46668437-46668459 CCTGGCCAGGGGCGGTGGGGAGG - Intronic
1184863324 22:47189153-47189175 CCTCAGGAGGGACAGAGGGGCGG + Intergenic
1185080838 22:48708534-48708556 CCTGCAGAGGGGCAGAGGAGGGG + Intronic
1185271017 22:49929373-49929395 CCTGCGGCAGGGCCGAGGCGAGG + Intergenic
1203252846 22_KI270733v1_random:125793-125815 GCCGCGGACGGGCGGACGGGAGG - Intergenic
1203253816 22_KI270733v1_random:129644-129666 TCGGAGGAGGGGCGGCGGGGAGG - Intergenic
1203260902 22_KI270733v1_random:170879-170901 GCCGCGGACGGGCGGACGGGAGG - Intergenic
1203261872 22_KI270733v1_random:174723-174745 TCGGAGGAGGGGCGGCGGGGAGG - Intergenic
949287477 3:2423926-2423948 CCTGCTGTGGGGTGGAGGGAGGG + Intronic
949533449 3:4978704-4978726 CTTGGGGAGGGACCGAGGGGCGG - Intergenic
949616140 3:5755775-5755797 CCTGTGGCAGGGCGGTGGGGTGG + Intergenic
950188682 3:10961200-10961222 CCTGTGGCAGGGCGAAGGGGAGG - Intergenic
950837677 3:15936274-15936296 CCTGGGTAGGGGCTGAGGGGAGG - Intergenic
951140098 3:19148402-19148424 CCCGCGGAGGGACGGTGGGGGGG + Intergenic
951497668 3:23348991-23349013 CCTGCGGGGAGGTGGTGGGGGGG - Intronic
951906959 3:27715435-27715457 CCTGGGGCGCGGCGGAGCGGGGG - Intergenic
952815569 3:37444347-37444369 CTTGCAGAGAGGCGGAGGGAGGG - Intergenic
952912796 3:38204771-38204793 CCTGGGGTGGGGGGAAGGGGTGG + Intronic
953319751 3:41961558-41961580 CCTGGGGAGCGGGGGGGGGGGGG - Intronic
953671363 3:44964966-44964988 CCTGGGGAGGGGCGGGGGTAAGG + Intronic
954146583 3:48637431-48637453 CCTGCAGAGGGTCGGTGGAGGGG - Exonic
954793471 3:53149330-53149352 CCTCCTGAGGGGAGGAGGGAAGG - Intergenic
955111779 3:55957717-55957739 GCTGCAGTGGGGAGGAGGGGGGG + Intronic
955950653 3:64239235-64239257 CCTGCTGGGGGGCGGGGGGCTGG + Intronic
956035802 3:65089967-65089989 CCTGAAGTGGGGTGGAGGGGGGG - Intergenic
956813532 3:72887956-72887978 GCTGCGGGCGGGCGGAGGGGCGG + Intergenic
957193500 3:77039732-77039754 CCCGGGGAGGGGCGGGGGCGAGG - Intronic
957452767 3:80401308-80401330 GCTGCGGGGGGGTGGGGGGGTGG + Intergenic
959246829 3:103881416-103881438 CCTGTCGAGGGGCGGGGGAGGGG - Intergenic
960146648 3:114210891-114210913 CCTGTTGAGGGGTGGAGGGCTGG + Intergenic
960989606 3:123301911-123301933 CCAGGGGTGGGGCGGAGCGGGGG + Intronic
961000963 3:123373763-123373785 CCTGCGGGGGGGTCGGGGGGGGG - Intronic
961353813 3:126321377-126321399 CCTGCTGTGGGGAGGAGGTGGGG + Intergenic
962314324 3:134349702-134349724 CCCGCTGAGGGGCGAAGGGCAGG - Intergenic
962686427 3:137852486-137852508 CCAGGGAAGGGGCGGAGGGAGGG - Intergenic
962751209 3:138435676-138435698 CCGGCGGAGGGAGGGAGGGAAGG - Intronic
964912024 3:161794638-161794660 CCTGGGGAGGGGAGGAGTGGAGG - Intergenic
966079230 3:175978599-175978621 CCGGCGGTGGGGCGGCGAGGGGG + Intergenic
966119443 3:176506072-176506094 CCTGCGGCGGGGCGGGGGGAGGG + Intergenic
966304246 3:178513123-178513145 CAGGAGGAGGAGCGGAGGGGGGG - Intronic
966734803 3:183179968-183179990 CCTGAGGAGGGGGAGAGGGATGG + Intronic
966883392 3:184361998-184362020 TCTTCGGAGGGGCAGAGGGGAGG - Intronic
967033714 3:185631601-185631623 GCTGCGGGGGGGGGGGGGGGAGG - Exonic
968518957 4:1027208-1027230 CCTGAGGAGGGGCTGGGGAGTGG - Intergenic
968552279 4:1229828-1229850 CCTGCGGTGGGCAGGAGGGAAGG - Intronic
968583234 4:1404459-1404481 TCTGCGCAGGGGCCGAGGCGCGG - Intronic
968598251 4:1496328-1496350 CCTGCGGTGGGGTGGAGCTGGGG - Intergenic
968820122 4:2843880-2843902 CGAGCGGAGGGGCTGAGGGGCGG + Exonic
968963620 4:3758268-3758290 CCGGCTGAGGCGGGGAGGGGCGG + Intergenic
969325911 4:6443767-6443789 ACTCCGGGGGGGCGGTGGGGTGG - Intronic
969329198 4:6463352-6463374 CCTGAGGAGGGGTGGGGGTGGGG + Intronic
969477071 4:7427841-7427863 GGTGCGGGGGGGCGGGGGGGCGG - Intronic
969643473 4:8412873-8412895 GCTGTGGAGGGGCACAGGGGTGG - Intronic
969643612 4:8413370-8413392 GCTGTGGAGGGGCACAGGGGTGG - Intronic
969643681 4:8413632-8413654 GCTGTGGAGGGGTGGAGGGGTGG - Intronic
969866803 4:10081651-10081673 CCCGGGGAGGGGTGGGGGGGGGG + Intronic
970485402 4:16520131-16520153 CTGGCGGTGGGGCGGCGGGGAGG - Intronic
970531427 4:16989422-16989444 GTTGGGGAGGGGCGGGGGGGTGG - Intergenic
972324199 4:37999604-37999626 CCTGTGGGGGGAGGGAGGGGAGG + Intronic
974577418 4:63744748-63744770 CTGGCGGAGGGGCGGGTGGGAGG + Intergenic
975765762 4:77666213-77666235 CCTGTTGAGGGGCGGGAGGGTGG + Intergenic
977705088 4:100061825-100061847 GCAGGGGAGGGGCGGCGGGGGGG - Intergenic
978147340 4:105391178-105391200 CCTGCTGGTGGGGGGAGGGGAGG + Intronic
979715483 4:123832347-123832369 CATGACGGGGGGCGGAGGGGGGG + Intergenic
980321923 4:131290690-131290712 ATTGCGGTGGGGCGGGGGGGGGG + Intergenic
980993963 4:139762885-139762907 CCTGAGGAGGGCTGGAGAGGGGG + Intronic
981300851 4:143184843-143184865 GGGGCGGAGGGGCAGAGGGGCGG + Intergenic
981300855 4:143184851-143184873 GGGGCAGAGGGGCGGAGGGGCGG + Intergenic
981429821 4:144645971-144645993 CCTGCTGCGGCGGGGAGGGGCGG - Intergenic
981513232 4:145580304-145580326 CCTGTGGTGGGGTGGAGGGCTGG + Intergenic
981884137 4:149652289-149652311 CCTGTTGAGGGGTGGAGGGAAGG + Intergenic
983484542 4:168318409-168318431 CGTGGGGAGGGGCGGAGGAAAGG - Intronic
984823724 4:183906287-183906309 CGTGCGGGAGGCCGGAGGGGCGG - Exonic
984923411 4:184785594-184785616 CCTGGGCGGGGGCGGGGGGGGGG + Intronic
984999710 4:185471349-185471371 GCTGGGGCGGGGCGGAGGGATGG + Intronic
985557951 5:567097-567119 CCTGCCGAGGGGCGGGAGAGTGG + Intergenic
985575375 5:671241-671263 CCTGGGGAGGGGCGGGGGTGGGG + Intronic
985580772 5:694145-694167 TCTGGGGAGCGGGGGAGGGGCGG - Intergenic
985595394 5:785477-785499 TCTGGGGAGCGGGGGAGGGGCGG - Intergenic
985749730 5:1667330-1667352 CGCGGGGAGGGGAGGAGGGGAGG - Intergenic
985791592 5:1931145-1931167 CCTGCGGAGAGGCACGGGGGCGG - Intergenic
986027827 5:3866806-3866828 CCTGGGGTGGGGCTGAGGGTGGG + Intergenic
987050384 5:14143490-14143512 CTGGCCGAGGGGCGGAGGCGCGG - Intergenic
988030455 5:25756862-25756884 CCTGTAGAGGGGCGGGGTGGGGG + Intergenic
990075580 5:51842927-51842949 CCTGCGGGGGGGGGGGGGGGGGG - Intergenic
990351200 5:54918563-54918585 CCTGCGGGGGGGTGGGGGGAGGG + Intergenic
990446521 5:55898317-55898339 GGTGCGGGGGGGCGGGGGGGTGG - Intronic
991084931 5:62639990-62640012 CCTGCAGAGGGTAGGAGGAGAGG - Intergenic
991899942 5:71450649-71450671 CTTGCGGAGGCGGAGAGGGGCGG + Intergenic
992837406 5:80654603-80654625 CGTGCGCCGGGGCGGGGGGGCGG - Exonic
993356778 5:86922782-86922804 CCTGCGGGGGTGCAGAGGGAGGG - Intergenic
993624209 5:90204836-90204858 CCTGCTGTGGGGCTGAGGGTGGG - Intergenic
994621383 5:102166944-102166966 CCTGCTGTGGGGTGGAGGGAGGG + Intergenic
995021329 5:107370599-107370621 CCTGTGGCGGGGGGGCGGGGAGG - Intergenic
997657924 5:135569017-135569039 TCTGCTGAGGGGTGGAGGAGGGG - Intergenic
997711060 5:136005361-136005383 TTTGAGGAGGGGTGGAGGGGTGG - Intergenic
998138689 5:139688097-139688119 GCTGCGGGTGGGCGGGGGGGGGG - Intergenic
998165397 5:139839783-139839805 CCTGCGGTGGGGTGGCTGGGGGG + Intronic
998353180 5:141514132-141514154 GCTGCGGAGGGGCGGGGTGCCGG + Intergenic
998451106 5:142235439-142235461 ACTGTTGAGGGGCGGTGGGGGGG + Intergenic
1000340798 5:160275774-160275796 CCTGAGGAGGGAGGGAGGGTTGG - Intronic
1001191641 5:169637497-169637519 CCTGCGGCGGGGCCTCGGGGCGG + Intronic
1001285888 5:170423788-170423810 CCTGTGGAGGGGAGGGGGTGAGG - Intronic
1001296710 5:170503956-170503978 ACTACGGAGGGGCGGGGCGGGGG - Intronic
1001314693 5:170633709-170633731 GGGGCGGGGGGGCGGAGGGGGGG + Intronic
1001401922 5:171451049-171451071 CCGGCGGCGGGGTGGGGGGGCGG - Intronic
1002190069 5:177473347-177473369 CCGGCGGCGGGGCGGCGGGGCGG + Intronic
1002559575 5:180072136-180072158 CCAGCGGGGGGGCGGGGCGGCGG - Intergenic
1002888164 6:1313406-1313428 CGGGCGGCGGGGCGGCGGGGAGG - Exonic
1002926235 6:1607108-1607130 GCTGGGGAGGGGCGGAGTGTGGG + Intergenic
1003049188 6:2765184-2765206 GCGGGGGAGGGGCGGGGGGGGGG - Intergenic
1003369553 6:5510950-5510972 CCTGCTGAGGGAGGGAGAGGAGG - Intronic
1003573051 6:7268570-7268592 CCTCAGGAGGGGCGGTGGAGGGG - Intronic
1003579032 6:7322701-7322723 GCTGCGGAGGGGAGTAGTGGTGG - Intronic
1004044743 6:12012607-12012629 AGGGCGGCGGGGCGGAGGGGGGG + Intronic
1004562476 6:16762568-16762590 CAGGCGGAGGGGCGGGGTGGTGG - Intergenic
1005990117 6:30897292-30897314 CCTGAGGTGGGGCAGGGGGGTGG + Intronic
1006007081 6:31011018-31011040 CATGTGGTGGGGCGGTGGGGCGG + Intronic
1006186759 6:32185846-32185868 CGTCCGGAGGGGCGGGGGTGGGG + Exonic
1006271744 6:32970867-32970889 CGGGGGGAGGGGAGGAGGGGAGG + Exonic
1006677955 6:35777285-35777307 CCTGCTGAGGGGCCGGGGTGGGG + Intronic
1006891533 6:37433337-37433359 GCTGCCGGGGAGCGGAGGGGGGG - Exonic
1007614565 6:43172310-43172332 CCCGGGGAGGGCCGAAGGGGAGG + Intronic
1011054742 6:83193339-83193361 CCTGCGGCGAGGCGGGGGCGGGG - Intronic
1011607453 6:89118313-89118335 GCTGCGGCTGGGCGGAGGTGGGG + Intergenic
1011983543 6:93416879-93416901 CCGTCGGAGGGGCGGGGCGGGGG + Intronic
1013465287 6:110412634-110412656 TGTGCCCAGGGGCGGAGGGGAGG - Intronic
1014001738 6:116371741-116371763 CCCGGGGAGGGGAGGAGGCGGGG + Intronic
1015508168 6:134010613-134010635 CTTGTGGGGGGGCGGAGGTGTGG + Intronic
1015973101 6:138762522-138762544 CATGGGGAGGGGAGGAAGGGGGG - Intronic
1016010832 6:139135786-139135808 GCCGCGGCGGGGCGGAGGGGCGG - Intronic
1017041815 6:150314258-150314280 CCTGCAGAAGGGGAGAGGGGAGG + Intergenic
1017719681 6:157235992-157236014 GCTGCCCAGGAGCGGAGGGGAGG + Intergenic
1017719736 6:157236181-157236203 CCTGCTGAAGGGCGCTGGGGTGG - Intergenic
1018653291 6:166008690-166008712 CCTGCGGGGCGCCGGAGGGGTGG + Intergenic
1018698001 6:166405626-166405648 CCTGCAGAGTGGTGAAGGGGAGG + Intergenic
1018715484 6:166529414-166529436 CCTGTGGTGGGGTGGAGGGATGG + Intronic
1018876650 6:167827291-167827313 GCGGCGGCGGGGGGGAGGGGCGG - Intronic
1019194187 6:170271729-170271751 CCTGCTGATGGGCAGAGGGAAGG - Intergenic
1019279207 7:191968-191990 CCCGCGGGTGGGCGGGGGGGGGG + Intergenic
1019473269 7:1232508-1232530 TTTGCGGAGGGGCGGGGAGGCGG + Intergenic
1019515705 7:1438967-1438989 CCTGCGGCGGGGTGGGGAGGGGG + Exonic
1019653448 7:2173297-2173319 CCTGCGGGGCGGCAGAGGGGTGG - Intronic
1019780075 7:2934474-2934496 CCTGCGCTGGGGCGGATGGTAGG + Exonic
1019801566 7:3091808-3091830 CCTGCCGGAGGGTGGAGGGGTGG - Intergenic
1019994067 7:4711933-4711955 CCGGGGGAGGGGCAGAGGGCAGG + Intronic
1020130167 7:5555210-5555232 CCGGCCGAGGGGCGGGGTGGGGG - Intronic
1020257242 7:6509090-6509112 CCTGCGGCTGGGCGGGCGGGTGG + Exonic
1020347653 7:7182770-7182792 CCTCCTGGGGGGCGGAGAGGGGG - Exonic
1021450956 7:20783961-20783983 CCTGGGGGGTGGAGGAGGGGAGG + Intronic
1021825287 7:24544779-24544801 GCAGCAGAGGGGCTGAGGGGAGG + Intergenic
1023069252 7:36412759-36412781 CCTGTGGAGGAGCAGTGGGGAGG - Intronic
1023837567 7:44077302-44077324 CGTGCAGAGGGGCAGAGGGGAGG + Intronic
1023842232 7:44104224-44104246 GCTGCGGGGGGGCGGGGGGCGGG - Intergenic
1023926759 7:44675080-44675102 CCTGGGGGGAGGGGGAGGGGGGG + Intronic
1026941247 7:74289351-74289373 CCTGGGGCGGGCGGGAGGGGGGG - Intergenic
1026945731 7:74314834-74314856 GCTGCAGGGGGCCGGAGGGGTGG - Intronic
1027390335 7:77697064-77697086 CGTGCGGGGAGGGGGAGGGGAGG + Intronic
1028299675 7:89181561-89181583 TCTGCGGAATGGGGGAGGGGTGG + Intronic
1028734696 7:94194784-94194806 CCTGTGGTGGGGTGGAGGGAAGG + Intergenic
1028987963 7:97022703-97022725 CCTGGGGAGGGGCGGAAACGCGG - Intronic
1029110527 7:98211308-98211330 CCTGCGGGCGGGCGGGCGGGAGG - Intergenic
1029116876 7:98242087-98242109 CCTGCTGAAGGGCGGTGGCGAGG - Intronic
1029148529 7:98464034-98464056 CTTGGGGAGGGTTGGAGGGGCGG + Intergenic
1029283208 7:99449860-99449882 CCTGCGGAGGGGCCTGGGGAAGG + Intronic
1029354392 7:100040712-100040734 CCTGAGGAGGGGCCGAGGAAAGG + Exonic
1029432431 7:100539661-100539683 CGAGGTGAGGGGCGGAGGGGAGG + Intronic
1029956423 7:104644965-104644987 ACTGCAGAGGGGCTGTGGGGTGG - Intronic
1030379958 7:108800718-108800740 CCAGGGGAGGGGAGAAGGGGAGG - Intergenic
1030655408 7:112162283-112162305 CCTGCAGAGTGGAGGAGGGGAGG - Intronic
1031288410 7:119901192-119901214 CCTGGGGCTGGGTGGAGGGGCGG + Intergenic
1032405571 7:131653066-131653088 ATTGTGGAGGGGGGGAGGGGGGG + Intergenic
1034268133 7:149790997-149791019 CCTGCAGAGGGGCAGAAAGGCGG - Intergenic
1034449496 7:151129692-151129714 CCCGCGGTGGGGAGGTGGGGGGG - Intronic
1034535415 7:151723014-151723036 CCTGCGGTGGAGGGGAGGAGTGG - Intronic
1034620285 7:152451663-152451685 CCTGCGGCGGGGGGCGGGGGGGG - Intergenic
1034628693 7:152514059-152514081 CCTGTGGAGGGTGGGAGGGAAGG - Intergenic
1034962863 7:155373360-155373382 CCTGCGGAGGGACTGTGTGGGGG - Intergenic
1034976183 7:155450330-155450352 TCTGTGGAGGGGCGGTGTGGGGG - Intergenic
1035021693 7:155804284-155804306 CCTGCGGAGGGGCGGGGGCGGGG + Intronic
1035573374 8:688365-688387 CCTGCGGAGGGACCGGGGGGCGG - Intronic
1036733380 8:11285079-11285101 CCTGCGGAGCTGGGGTGGGGCGG - Intronic
1037808585 8:22072467-22072489 CCTGCACAGGGGTGGAGGGTGGG - Intronic
1037835173 8:22211410-22211432 CCTGGGGAGGGGAGGAGGCGTGG - Intronic
1038311692 8:26449973-26449995 CCAGGGGCGGGGCGGCGGGGTGG + Intronic
1038420292 8:27430221-27430243 TCTGGGGAGGGGTGGAGGAGAGG - Intronic
1038424845 8:27458498-27458520 CCTGCAGAGTGACGGAGGGTGGG + Exonic
1038444360 8:27593072-27593094 CCTGCGCGGGGCCGGGGGGGCGG + Intergenic
1038479278 8:27890671-27890693 CCTGCTCAGGGTGGGAGGGGTGG + Intronic
1040444828 8:47483003-47483025 ACTGTGGAGGGGCAGAGGGGCGG - Intronic
1041023066 8:53657741-53657763 TCTGCGGAGGGGAGGCCGGGTGG - Intergenic
1042837794 8:73093204-73093226 GCTGGGGAGGGGCGGCGCGGAGG - Exonic
1042903331 8:73748890-73748912 GGTGGGGAGGGGCGGGGGGGGGG - Intronic
1042962900 8:74321612-74321634 CCCGGGGAGGGGACGAGGGGCGG - Intronic
1043303341 8:78762459-78762481 CCTGAGGAGGCGGGGAGGGGAGG - Intronic
1043388063 8:79767682-79767704 CCTGGGGAGGGTCGGCGCGGCGG + Exonic
1044147352 8:88733424-88733446 ACTGGGGTGGGGCTGAGGGGAGG + Intergenic
1044430756 8:92103478-92103500 CCCGCGGCGGGGCGTGGGGGAGG + Intergenic
1045507243 8:102787467-102787489 CCTGGGGGGGGGGGGGGGGGGGG + Intergenic
1045674215 8:104589493-104589515 CCAGCGGGTGGGGGGAGGGGGGG + Intergenic
1046302854 8:112320638-112320660 CCTGTCGTGGGGTGGAGGGGAGG - Intronic
1047138500 8:122107936-122107958 TCTGCTGTGGGGTGGAGGGGAGG + Intergenic
1047182607 8:122603999-122604021 CCTGCGGAGGTGGGGTAGGGAGG - Intergenic
1049064408 8:140301689-140301711 CCTGCGGAGGCCGGGAGGCGGGG - Intronic
1049094152 8:140538592-140538614 GCTGAGGAGGGGAGGAGAGGTGG - Intronic
1049310443 8:141931266-141931288 CCTGGGGAGGAGGGGAGGTGGGG + Intergenic
1049404731 8:142447327-142447349 CCTGGGGAGGGGCTGAGGGCTGG + Intergenic
1049542827 8:143216088-143216110 CATGCGGAGGGGCGGGGCGGGGG + Intergenic
1049544068 8:143221437-143221459 CCTGGGGAGGGCCGGGGGTGCGG + Intergenic
1049735585 8:144202973-144202995 TCTGTGGAGGGGCGGGGGGGGGG + Intronic
1049735628 8:144203073-144203095 TCTGTGGAGGGGGGGCGGGGGGG + Intronic
1049735644 8:144203110-144203132 TCTGTGGAGGGGCGGGGGAGGGG + Intronic
1049735659 8:144203144-144203166 TCTGTGGAGGGGCGGGGGGGGGG + Intronic
1049735703 8:144203245-144203267 TCTGTGGAGGGGCGGGGGGGGGG + Intronic
1049801274 8:144518408-144518430 CCTGCGGCCGGCGGGAGGGGAGG + Intronic
1050221513 9:3396188-3396210 CCTGTTGTGGGGTGGAGGGGAGG - Intronic
1051099943 9:13509468-13509490 GCTGGGGAGGGGCGCAGAGGAGG + Intergenic
1051617813 9:19023147-19023169 ACTCCGGTGGGGCGGGGGGGTGG - Intronic
1051629293 9:19127524-19127546 CTTGGGGAGGGGCGGCGAGGCGG - Exonic
1051774864 9:20622300-20622322 GCTGAGGGGGGGCGGAGGAGGGG - Exonic
1052341499 9:27368650-27368672 GCTGGGGAGGGGCAGAGGGAGGG - Intronic
1053070271 9:35097007-35097029 CCTTCGGAGTGGAGGAGGGGAGG + Intergenic
1053530160 9:38873143-38873165 CCTGGTGGGGGGCGGAGGGGGGG + Intergenic
1053787428 9:41662809-41662831 CCTGTGGAGGGGCTGGGAGGTGG - Intergenic
1054157698 9:61651958-61651980 CCTGTGGAGGGGCTGGGAGGTGG + Intergenic
1054175704 9:61874148-61874170 CCTGTGGAGGGGCTGGGAGGTGG - Intergenic
1054274209 9:63052597-63052619 CCTGCCCGGGGGCGGGGGGGGGG - Intergenic
1054400632 9:64712372-64712394 CCTGCCCGGGGGCGGGGGGGGGG + Intergenic
1054434238 9:65196687-65196709 CCTGCCCGGGGGCGGGGGGGGGG + Intergenic
1054477472 9:65582963-65582985 CCTGTGGAGGGGCTGGGAGGTGG + Intergenic
1054496269 9:65825482-65825504 TCGGCGGCGGGGCGGCGGGGCGG + Intergenic
1054635973 9:67490790-67490812 CCTGGTGGGGGGCGGAGGGGGGG - Intergenic
1054661835 9:67706662-67706684 CCTGTGGAGGGGCTGGGAGGTGG + Intergenic
1055029089 9:71754056-71754078 CCTGTTGAGGGGTGGAGGGCTGG + Intronic
1055397904 9:75892670-75892692 CAGGCGGCGGGGAGGAGGGGCGG - Intronic
1056849331 9:90068972-90068994 CCTGGGGTGGGGAGGAGGGTTGG - Intergenic
1056917792 9:90760243-90760265 CCTGCGATGGGGGGGGGGGGGGG - Intergenic
1057356059 9:94332430-94332452 CCTGCGCAGGCGCGCAGGGCAGG - Intergenic
1057596371 9:96418658-96418680 CACGCGGAGGGACGGCGGGGCGG - Intergenic
1057605459 9:96495398-96495420 CCTGGGCAGGGGCGGGGGGCGGG - Intronic
1057773097 9:97984227-97984249 CGCGCGGAGCGGGGGAGGGGCGG + Intronic
1057797434 9:98169004-98169026 CCTGGGACGGGGTGGAGGGGTGG + Intronic
1058431772 9:104926871-104926893 CCTGCGGAGACCCGGAGGTGGGG - Intronic
1058661382 9:107271791-107271813 CCTCCGGAAGGGAGGTGGGGGGG + Intergenic
1058964709 9:110026007-110026029 CCTGCAGAGGGACGTAGTGGTGG - Intronic
1059399180 9:114058173-114058195 CTTCCGGTGGGGGGGAGGGGGGG + Intergenic
1059791130 9:117642852-117642874 CCCACGGAGGGGCGGGGGGGAGG + Intergenic
1060744793 9:126124206-126124228 CCTGGGGCGGGGGGGGGGGGGGG - Intergenic
1060757343 9:126223210-126223232 GGAGCGGAGGGGCGCAGGGGAGG + Intergenic
1061042106 9:128146239-128146261 CCATAGGAGGGGCCGAGGGGAGG + Intergenic
1061232621 9:129323587-129323609 CCTGAGAATGGGCGGAGGGGGGG - Intergenic
1061276710 9:129572902-129572924 ACTGTGGAGGGGCGGAGGTGGGG - Intergenic
1061282574 9:129605957-129605979 GCTGCGGCTGGGCGGAGGGCTGG - Intergenic
1061330042 9:129886449-129886471 CTTGCGGAGGGCAGGAGGTGAGG - Intergenic
1061490991 9:130944370-130944392 CAGGTGGAGGGGTGGAGGGGTGG + Intergenic
1061540641 9:131276596-131276618 CGTGCGGAAGGCCGGAGGGCAGG - Intergenic
1061541223 9:131278640-131278662 CCTGCGGGGGGACGGGGGGAAGG - Intergenic
1061617082 9:131787398-131787420 ACTGAGGAGGGGCAGAGAGGTGG - Intergenic
1061715650 9:132517226-132517248 GCTGAGAAGGGACGGAGGGGCGG - Intronic
1061737527 9:132671226-132671248 CCGACGGAGGGGCGAAGGAGGGG - Intronic
1061777914 9:132978095-132978117 CTTGGGGAGGGAGGGAGGGGAGG + Intronic
1062043947 9:134416642-134416664 CCTGCGGCGGGGGGCGGGGGAGG - Intronic
1062174575 9:135153821-135153843 CCTGCTGGGGTGCAGAGGGGTGG - Intergenic
1062221432 9:135418157-135418179 CCTGCTTCGGGGCTGAGGGGAGG + Intergenic
1062264272 9:135679693-135679715 CCTGTGGGGAGGGGGAGGGGAGG - Intergenic
1062264316 9:135679816-135679838 CCTGTGGGGAGGGGGAGGGGAGG - Intergenic
1062264330 9:135679851-135679873 CCTGTGGGGAGGGGGAGGGGAGG - Intergenic
1062460422 9:136660455-136660477 CCTGGGGAGGGGCTGGGGGCAGG + Intronic
1062482613 9:136759450-136759472 CCTGGGGAGGGGCAGGGGGCAGG - Intergenic
1062587167 9:137254658-137254680 CCTGCGGGAGGGCGGCGGGCTGG + Intergenic
1062591997 9:137278444-137278466 CCTGCGGAGGGGCGGAGGGGCGG + Intronic
1062592001 9:137278452-137278474 GGGGCGGAGGGGCGGAGGGGCGG + Intronic
1062609926 9:137369124-137369146 CGTGGGGAGGGGCGCAGGGCCGG + Intronic
1062688523 9:137828571-137828593 CCTGCGGGGGTGCGGGGTGGGGG + Intronic
1203469249 Un_GL000220v1:108944-108966 GCCGCGGACGGGCGGACGGGAGG - Intergenic
1203470216 Un_GL000220v1:112792-112814 TCGGAGGAGGGGCGGCGGGGAGG - Intergenic
1203477070 Un_GL000220v1:152916-152938 GCCGCGGACGGGCGGACGGGAGG - Intergenic
1203478037 Un_GL000220v1:156764-156786 TCGGAGGAGGGGCGGCGGGGAGG - Intergenic
1185889483 X:3811522-3811544 CCTCGGGAGGGGAGGAGGGGAGG + Intergenic
1186500611 X:10047508-10047530 CCTGGGGAGGGGAGGAATGGGGG - Intronic
1186802804 X:13110600-13110622 CGGGCGGAGGGGCGGGGGTGGGG - Intergenic
1187174311 X:16882644-16882666 GCTGGGGAGGGGCGGGGCGGGGG - Intergenic
1187332438 X:18353940-18353962 CCTCCTGAGGGGCGGAGAGGCGG - Intronic
1187553815 X:20332192-20332214 CTTGCAGAGGAGAGGAGGGGAGG - Intergenic
1187687564 X:21830836-21830858 TCTGTGGAGGTGGGGAGGGGTGG - Intergenic
1189001253 X:36949618-36949640 ACTGCGGGGGGGCGGGGGGGGGG - Intergenic
1189242661 X:39537541-39537563 CCTGGGGTGGGGTGCAGGGGTGG + Intergenic
1189308875 X:40006426-40006448 TCCGCGGAGGAGGGGAGGGGAGG - Intergenic
1189323705 X:40100776-40100798 AATGCGAAGGGGCCGAGGGGAGG + Intronic
1189331203 X:40145979-40146001 GCGGCGGAGAGGCGGAGGGCGGG + Intronic
1189331256 X:40146234-40146256 CCCGCGGAGGCGCGGAGCCGGGG + Intronic
1189332944 X:40154249-40154271 CCTGGGGAGGGGAGGGGGCGAGG - Intronic
1190247196 X:48698488-48698510 CCCGAGGTGGGGCGGATGGGAGG - Intronic
1193031373 X:76901668-76901690 TGTGGGGAGGGGTGGAGGGGAGG + Intergenic
1193705760 X:84819138-84819160 TCTGGGGTGGGGGGGAGGGGAGG + Intergenic
1193905293 X:87236758-87236780 CTTGCAGAGGGGCTGATGGGTGG - Intergenic
1194385418 X:93246495-93246517 TCTGGGGTGGGGGGGAGGGGAGG - Intergenic
1195060709 X:101191474-101191496 CCTCCAGAGCTGCGGAGGGGCGG + Intergenic
1195425906 X:104730365-104730387 TCTGGGGTGGGGGGGAGGGGAGG - Intronic
1195702639 X:107716548-107716570 CCTGGGAAGGGGCGGGGGGGAGG - Intronic
1197655146 X:129108657-129108679 CGCGCGGCGGGGCGGTGGGGTGG + Intergenic
1197695030 X:129540698-129540720 CCTTCGGAAGCGCGGTGGGGAGG - Intronic
1197753421 X:129980435-129980457 CCTGCGGCGGGGGCGGGGGGAGG + Intergenic
1197754431 X:129984095-129984117 CCGGCGGCGGGGCGGGCGGGCGG + Intronic
1197848881 X:130835189-130835211 CCTGGGGAGGGGAGGCGGTGGGG + Intronic
1197953016 X:131918336-131918358 TCTGGGGAGTGGGGGAGGGGTGG - Intergenic
1198030736 X:132751243-132751265 CCTGAGGTGGGGCGGGGCGGGGG + Intronic
1198934985 X:141895717-141895739 CTGGGGGAGGGGTGGAGGGGAGG + Intronic
1199680695 X:150222329-150222351 ACTATGGAGGGGGGGAGGGGTGG + Intergenic
1199901146 X:152173597-152173619 CCTGGGGAGGGGGGCAGCGGTGG - Intronic
1200092766 X:153643558-153643580 CCCGGGGAGGGGCGGGGAGGCGG + Intronic
1201013763 Y:9576609-9576631 CCTGTTGTGGGGCGGAGGGAGGG + Intergenic