ID: 1062592569

View in Genome Browser
Species Human (GRCh38)
Location 9:137280837-137280859
Sequence AGGCGTCCAGGAGGGCTTCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 572
Summary {0: 1, 1: 0, 2: 11, 3: 79, 4: 481}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062592569_1062592583 8 Left 1062592569 9:137280837-137280859 CCCGGAAGCCCTCCTGGACGCCT 0: 1
1: 0
2: 11
3: 79
4: 481
Right 1062592583 9:137280868-137280890 TGGGCCCACCGCGCCCACGGGGG 0: 1
1: 0
2: 0
3: 5
4: 90
1062592569_1062592591 21 Left 1062592569 9:137280837-137280859 CCCGGAAGCCCTCCTGGACGCCT 0: 1
1: 0
2: 11
3: 79
4: 481
Right 1062592591 9:137280881-137280903 CCCACGGGGGCTTTAGGGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 159
1062592569_1062592593 29 Left 1062592569 9:137280837-137280859 CCCGGAAGCCCTCCTGGACGCCT 0: 1
1: 0
2: 11
3: 79
4: 481
Right 1062592593 9:137280889-137280911 GGCTTTAGGGGAAGGTGCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 211
1062592569_1062592594 30 Left 1062592569 9:137280837-137280859 CCCGGAAGCCCTCCTGGACGCCT 0: 1
1: 0
2: 11
3: 79
4: 481
Right 1062592594 9:137280890-137280912 GCTTTAGGGGAAGGTGCTTTGGG 0: 1
1: 0
2: 0
3: 18
4: 213
1062592569_1062592581 6 Left 1062592569 9:137280837-137280859 CCCGGAAGCCCTCCTGGACGCCT 0: 1
1: 0
2: 11
3: 79
4: 481
Right 1062592581 9:137280866-137280888 GATGGGCCCACCGCGCCCACGGG 0: 1
1: 0
2: 0
3: 6
4: 78
1062592569_1062592580 5 Left 1062592569 9:137280837-137280859 CCCGGAAGCCCTCCTGGACGCCT 0: 1
1: 0
2: 11
3: 79
4: 481
Right 1062592580 9:137280865-137280887 GGATGGGCCCACCGCGCCCACGG 0: 1
1: 0
2: 0
3: 9
4: 113
1062592569_1062592586 15 Left 1062592569 9:137280837-137280859 CCCGGAAGCCCTCCTGGACGCCT 0: 1
1: 0
2: 11
3: 79
4: 481
Right 1062592586 9:137280875-137280897 ACCGCGCCCACGGGGGCTTTAGG 0: 1
1: 0
2: 0
3: 2
4: 68
1062592569_1062592582 7 Left 1062592569 9:137280837-137280859 CCCGGAAGCCCTCCTGGACGCCT 0: 1
1: 0
2: 11
3: 79
4: 481
Right 1062592582 9:137280867-137280889 ATGGGCCCACCGCGCCCACGGGG 0: 1
1: 0
2: 0
3: 1
4: 77
1062592569_1062592588 16 Left 1062592569 9:137280837-137280859 CCCGGAAGCCCTCCTGGACGCCT 0: 1
1: 0
2: 11
3: 79
4: 481
Right 1062592588 9:137280876-137280898 CCGCGCCCACGGGGGCTTTAGGG 0: 1
1: 0
2: 0
3: 1
4: 29
1062592569_1062592589 17 Left 1062592569 9:137280837-137280859 CCCGGAAGCCCTCCTGGACGCCT 0: 1
1: 0
2: 11
3: 79
4: 481
Right 1062592589 9:137280877-137280899 CGCGCCCACGGGGGCTTTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062592569 Original CRISPR AGGCGTCCAGGAGGGCTTCC GGG (reversed) Exonic
900089266 1:912585-912607 AGGGATCCAGGAAGGCTTCGTGG + Intergenic
900096225 1:941199-941221 AGGAGGGCAGGTGGGCTTCCAGG - Exonic
900149168 1:1170795-1170817 CGCCAGCCAGGAGGGCTTCCTGG + Intergenic
900245223 1:1633364-1633386 AGGCCTCCAGGAGGCCAGCCTGG - Intronic
900256454 1:1700523-1700545 AGGCCTCCAGGAGGCCAGCCTGG - Intronic
900793330 1:4693355-4693377 GGGAGTCATGGAGGGCTTCCTGG + Intronic
900895448 1:5479968-5479990 AGGTGCCCAGCAGAGCTTCCTGG - Intergenic
900935853 1:5766087-5766109 AGGCGTCCATGTGGACTGCCAGG + Intergenic
900999636 1:6142376-6142398 AGGCGGCCAGGAGGGGTGGCTGG - Intronic
901771734 1:11534013-11534035 GGGCATCAAGGAAGGCTTCCTGG + Intronic
902229737 1:15020402-15020424 AGGTGCACAGGAGGGCTTCTGGG - Intronic
902268874 1:15288943-15288965 GAGAGTCCAGGAAGGCTTCCTGG + Intronic
902293168 1:15448036-15448058 AGGAATCCAGGATGGCTTCCTGG + Intronic
902313923 1:15603421-15603443 AGGCTTGCACGAGGGCGTCCCGG - Intergenic
902642536 1:17775946-17775968 AAGAGTCAGGGAGGGCTTCCTGG + Intronic
902793148 1:18782843-18782865 AGCCGGCAAGCAGGGCTTCCTGG - Intergenic
903174712 1:21574014-21574036 AGCAATCCAGGAAGGCTTCCTGG + Intronic
903188507 1:21642953-21642975 GGGAATCAAGGAGGGCTTCCTGG - Intronic
903339707 1:22645948-22645970 AGCGGTCAAGGAGGGCTTCTTGG + Intronic
903370091 1:22829734-22829756 GGGCATCACGGAGGGCTTCCTGG + Intronic
903828970 1:26163680-26163702 GGGCATTCAGGACGGCTTCCTGG - Intergenic
904317224 1:29673343-29673365 AGGCATCAGGGAGGGCTTGCTGG - Intergenic
904355588 1:29936930-29936952 AGGCATCAAGGAGGGATTCTTGG - Intergenic
904383044 1:30124397-30124419 AGGCCTGCAGGAGGGCTGCAGGG + Intergenic
904441428 1:30534435-30534457 AGGCATCAGGGAGGGCTTGCTGG + Intergenic
904455550 1:30645909-30645931 AGGCATCCTGGAAGGCTTCCTGG + Intergenic
905052078 1:35060523-35060545 TGGCTTCCAGGAGGAATTCCTGG + Intronic
905542131 1:38768200-38768222 AGACGCGCAGGAGGGCTTCATGG + Intergenic
905632170 1:39524936-39524958 AGTCATCCAGGAGGCCTCCCAGG + Intronic
905648565 1:39640981-39641003 GGGCGACCACCAGGGCTTCCTGG - Intergenic
905665575 1:39761251-39761273 AGTCATCCAGGAGGCCTCCCAGG - Intronic
905874497 1:41423528-41423550 AGGCCTCCAGGTGGGGTTCAGGG - Intergenic
905905109 1:41612718-41612740 AGGGGACCAGGAGGGTTTGCTGG + Intronic
905953711 1:41974681-41974703 GGGGGTTCAGGAAGGCTTCCTGG - Intronic
906298659 1:44665047-44665069 GGGCGTCAAGGAAGGCTTCCTGG - Intronic
906436635 1:45802361-45802383 AGGAGTCCAGGATGATTTCCAGG + Intronic
906556676 1:46719279-46719301 CCGCCCCCAGGAGGGCTTCCGGG + Intergenic
906716395 1:47972862-47972884 AGGGATCCAGGAGGGCTCCCTGG - Intronic
907329976 1:53664293-53664315 AAGCATCCGGTAGGGCTTCCTGG - Intronic
908113739 1:60921658-60921680 AGGTTTCTGGGAGGGCTTCCTGG - Intronic
912402286 1:109404915-109404937 AGGAGCCCAGGAAGGCTTCAGGG + Intronic
913569954 1:120110165-120110187 AGGCGCCCAGGAGATCATCCAGG + Intergenic
914244637 1:145876577-145876599 ACACGTCCAGGAAGGCTTCGTGG + Exonic
914290762 1:146271130-146271152 AGGCGCCCAGGAGATCATCCAGG + Intergenic
914456659 1:147842860-147842882 TGGCGTCCATGAGGCCTTCAGGG + Intergenic
914551806 1:148721913-148721935 AGGCGCCCAGGAGATCATCCAGG + Intergenic
915102040 1:153507663-153507685 TTGCTTCCAGGAGGGCTTCTGGG - Intergenic
915255197 1:154623209-154623231 AGGTGTCAAGGAAGGCTTCTGGG + Intronic
915898423 1:159828989-159829011 AGGAGTCGAGGACGGCTCCCAGG - Intronic
916804922 1:168250065-168250087 AGGCGTCAGGGAGGGGTTCTTGG + Exonic
918102956 1:181392347-181392369 AGGAAACCAGGAAGGCTTCCTGG - Intergenic
921217609 1:212950867-212950889 CGGGGTCCGGGAGGGCTTCCTGG + Intronic
922188421 1:223296284-223296306 AGGCGTCCAGGATACCTTCCTGG + Intronic
922753798 1:228083061-228083083 CGGCGTCCAAGCGGACTTCCGGG - Intronic
922920637 1:229299893-229299915 AGGTGTCAGGGAGGGCTTTCAGG + Intronic
923538844 1:234873797-234873819 TGGGGTATAGGAGGGCTTCCTGG - Intergenic
923771791 1:236943820-236943842 AGGCAGCTAGGAGGGTTTCCAGG + Intergenic
924708981 1:246518975-246518997 AGGCTTCCAGGACAGCCTCCTGG + Intergenic
924709949 1:246523465-246523487 AGGAGCCCTGGAGGGCTGCCTGG - Intergenic
1062838734 10:653046-653068 GGCTGGCCAGGAGGGCTTCCAGG - Intronic
1063299737 10:4840791-4840813 AAGGGGTCAGGAGGGCTTCCTGG - Intronic
1063944759 10:11165709-11165731 AGGCGTCCAGGTGGGCGTCGCGG + Intronic
1064966711 10:21021632-21021654 GGGAGGCCAGGAGAGCTTCCTGG - Intronic
1067101752 10:43339249-43339271 AGGGGACCTGCAGGGCTTCCTGG + Intergenic
1068151629 10:53139672-53139694 AGGTGCCCAGCTGGGCTTCCTGG - Intergenic
1068556466 10:58464607-58464629 AGCCATCCAGCAGGGCTACCAGG + Intergenic
1069119004 10:64544879-64544901 AGGGGTACAGGGGTGCTTCCAGG - Intergenic
1069718018 10:70533031-70533053 AGGCGTCCAACTGGGCCTCCAGG - Exonic
1069926713 10:71855632-71855654 AGGGGTCAAGGGAGGCTTCCAGG - Intergenic
1070697454 10:78573530-78573552 AGGCCTTCAGGAGGCCTTACCGG + Intergenic
1070742922 10:78914167-78914189 ACCCATCCAGGAGGGCTTCCTGG + Intergenic
1070778931 10:79126429-79126451 AGGGGTCAGGGAGAGCTTCCTGG + Intronic
1070794916 10:79210854-79210876 AGGGATCATGGAGGGCTTCCTGG + Intronic
1071970950 10:90906220-90906242 AGGACTCAAGGATGGCTTCCTGG + Intronic
1073078172 10:100837566-100837588 AGCAGTCAGGGAGGGCTTCCTGG - Intergenic
1073265100 10:102222849-102222871 AGGCTTTCAGGAGGGCTACTGGG + Intergenic
1073444860 10:103574580-103574602 TGGAGGCCAGGAGGGCTTCTTGG + Intronic
1073514081 10:104061677-104061699 GGGGGTCTAGGAGGACTTCCTGG - Intronic
1073583714 10:104689294-104689316 TGGCTGTCAGGAGGGCTTCCTGG - Intronic
1074487484 10:113899984-113900006 AGTTGTCAAGGAGGGCTTCTTGG + Intronic
1075416093 10:122265537-122265559 AGGCTTCAAGGAGGACTCCCTGG - Intergenic
1075846703 10:125550871-125550893 ATACATCCAGGAAGGCTTCCTGG - Intergenic
1075878498 10:125828202-125828224 AGGAGTCAAGGATGACTTCCAGG + Intronic
1076314003 10:129527999-129528021 GGGAGTCCAGGAAGGCTTCCTGG - Intronic
1076706934 10:132307461-132307483 CGGTGTCCGGGACGGCTTCCCGG - Intronic
1076905475 10:133358636-133358658 GGGAGTCCAGGAGGGCAGCCAGG + Intergenic
1077330716 11:1982760-1982782 AGTCCTCGAGGAGGGCTCCCTGG + Intronic
1077332932 11:1991250-1991272 CGGCCTGCAGGTGGGCTTCCAGG + Intergenic
1077863759 11:6205958-6205980 AGGAGATCAGGAAGGCTTCCTGG + Intronic
1078009940 11:7565244-7565266 TGGGGTCCAGGTGGCCTTCCAGG + Intronic
1078426422 11:11254470-11254492 AGGAGTTCAGAGGGGCTTCCAGG + Intergenic
1079013968 11:16853485-16853507 GGGTGTCCAGAAGGGCTTCCCGG - Intronic
1079124614 11:17709691-17709713 AGCAGTCCAGGAGAGCTTCACGG + Intergenic
1080573615 11:33578769-33578791 AGGCGCCAAGGAAGGCTTCAAGG - Intronic
1081726548 11:45333829-45333851 AAGCCTCCTGCAGGGCTTCCGGG - Intergenic
1083133362 11:60647539-60647561 AGGCGTCTAGGAGGCTTACCTGG + Intergenic
1083254505 11:61487865-61487887 GGGCATCAGGGAGGGCTTCCAGG + Intronic
1083279824 11:61620051-61620073 AGACAGCCAGGAGGGCTTCCTGG - Intergenic
1084183442 11:67457845-67457867 ATCCGTCCAGGGGGACTTCCTGG + Intronic
1084579052 11:70011082-70011104 AAGAGTACAGGAGGGCCTCCTGG + Intergenic
1084598826 11:70132941-70132963 GGGAGTTCAGGAGGGCTTTCTGG + Intronic
1085713164 11:78848573-78848595 ATGGGTCAAGGAGGGCTTTCTGG - Intronic
1085778818 11:79390215-79390237 AGGGGTCCAGGAGACCTTCTTGG + Intronic
1089182852 11:116594960-116594982 AGGGTTCCAGAAGGGCTGCCAGG - Intergenic
1089192394 11:116662362-116662384 TGAAGTCCAGGAGAGCTTCCCGG + Intergenic
1089256061 11:117194739-117194761 AGGAGTCCAGGAAAGCTTCCTGG + Intronic
1089305219 11:117522207-117522229 TGATGTCCAGGAAGGCTTCCTGG - Intronic
1089452578 11:118608221-118608243 GAGCGTCTAGGAGGGCTGCCTGG + Intronic
1089601575 11:119618720-119618742 GGGAGTCCAGGAAGGCTTCCTGG - Intergenic
1089655891 11:119946698-119946720 AGGAGTCCAGGAGGACTTCCAGG + Intergenic
1090865724 11:130698890-130698912 AGAGGTCCAGGAAGGCCTCCTGG + Intronic
1090883125 11:130852066-130852088 AGGCCTTCAGGAGACCTTCCTGG - Intergenic
1202813696 11_KI270721v1_random:37939-37961 AGTCCTCGAGGAGGGCTCCCTGG + Intergenic
1202815915 11_KI270721v1_random:46426-46448 CGGCCTGCAGGTGGGCTTCCAGG + Intergenic
1091390716 12:124705-124727 AGTCGTCCAGGAAGGCCTCATGG + Intronic
1092522577 12:9289719-9289741 AGGATTCCAGGAGGGCTCCAAGG - Intergenic
1094508241 12:31079894-31079916 AGGATTCCAGGAGGGCTCCAAGG - Intronic
1096555743 12:52402591-52402613 GGGAGTCCAGGAAGCCTTCCTGG - Intronic
1096615260 12:52829236-52829258 AAGAATCCAGGAGGGGTTCCAGG - Intronic
1096808369 12:54154374-54154396 AGGCCTTAAGAAGGGCTTCCTGG + Intergenic
1097281777 12:57849256-57849278 GGGCATCTGGGAGGGCTTCCAGG - Intergenic
1101439617 12:104693689-104693711 GGGGGTCAGGGAGGGCTTCCTGG + Intronic
1102226575 12:111232997-111233019 GGATGTCAAGGAGGGCTTCCAGG + Intronic
1102245541 12:111353514-111353536 TGGGGTCCAGGAAGGCTTCCTGG + Intergenic
1102398608 12:112609524-112609546 AGGAATCCAGGACGGCTTCTTGG - Intronic
1102461576 12:113103013-113103035 GGGACTCAAGGAGGGCTTCCTGG - Intronic
1102469603 12:113152370-113152392 GGTGGTCAAGGAGGGCTTCCTGG + Intronic
1102684799 12:114716438-114716460 AGGCATCAAGGAATGCTTCCTGG + Intergenic
1103676051 12:122656691-122656713 AGGTGTCGAGGAAGTCTTCCGGG - Intergenic
1103735433 12:123057983-123058005 AGGTGTACAGGAGGGGTCCCTGG - Intronic
1103994477 12:124820373-124820395 AGGAGTCCGGGAGGTCTTCCTGG + Intronic
1104963648 12:132499547-132499569 AGGAGGCCACGAGGGCTTCTGGG + Intronic
1105246695 13:18659159-18659181 ATGCTTTCAGGAGGGCTTCGAGG - Intergenic
1107911438 13:45108975-45108997 AGGGGTCCGGGAGGGGTCCCTGG - Intergenic
1107965858 13:45597676-45597698 ACTCCTCCAGGAAGGCTTCCAGG + Intronic
1109749043 13:66665551-66665573 ATGCGTCAAGGAAGTCTTCCTGG - Intronic
1110289451 13:73786978-73787000 GGTGGTCCAGGAGGGCTTCATGG - Intronic
1113839368 13:113350069-113350091 TGGCCTCCACGAGGGTTTCCAGG - Intronic
1117255321 14:53971433-53971455 AGGAGTCAAGGAAGGCTTCCTGG + Intergenic
1117309586 14:54508373-54508395 AAGCATCCAGGAAGGCTTGCTGG + Intergenic
1119260275 14:73234149-73234171 AGATGTACAGGAAGGCTTCCTGG + Intergenic
1121927136 14:97937981-97938003 AGGGGTCAAGGGTGGCTTCCAGG + Intronic
1122153410 14:99736790-99736812 AGAGATCCAGGAGGGCTTCCTGG - Intergenic
1122266193 14:100547983-100548005 AGGAATCCAAGAGTGCTTCCTGG - Intronic
1122276225 14:100592147-100592169 AGGGATCGGGGAGGGCTTCCTGG - Intergenic
1122342109 14:101035173-101035195 TGTCCCCCAGGAGGGCTTCCTGG + Intergenic
1122366461 14:101197607-101197629 GTGGCTCCAGGAGGGCTTCCTGG + Intergenic
1122769610 14:104092150-104092172 GGGCATCTGGGAGGGCTTCCTGG + Intronic
1122848817 14:104515612-104515634 GGGCATCCAGGAAGGCTTCCTGG + Intronic
1122931025 14:104933163-104933185 GGGCTTCCTGGAGGGCTCCCTGG - Exonic
1123937577 15:25201484-25201506 AGGTGCCCTGCAGGGCTTCCAGG - Intergenic
1124146744 15:27134701-27134723 AGAAGCCCTGGAGGGCTTCCTGG - Intronic
1124400730 15:29345494-29345516 AGGGGGCCAGGTGGGCTTGCAGG - Intronic
1124439785 15:29677656-29677678 AGCAGTCCTGGAGGGCTTCGTGG + Intergenic
1126773238 15:52078167-52078189 AGAGGTCAGGGAGGGCTTCCTGG - Intergenic
1127314542 15:57782303-57782325 AGACATCAAGGAAGGCTTCCTGG - Intronic
1127916635 15:63460459-63460481 AGTCCTCCAGAAGGGCTCCCAGG + Intergenic
1128106588 15:65049934-65049956 AGGAGGCCAGGAGGGCTGCTGGG + Exonic
1128214654 15:65925837-65925859 AGACATCCAAGAAGGCTTCCTGG - Intronic
1128231777 15:66040267-66040289 AGCAGCTCAGGAGGGCTTCCTGG + Intronic
1128381565 15:67116984-67117006 AGTAGTCCAGAATGGCTTCCTGG - Intronic
1129237600 15:74233104-74233126 AGGGGTCGAGGAAGGCCTCCGGG - Intergenic
1129382588 15:75177511-75177533 AGCAGTCCAGGAGGGCTTCCTGG - Intergenic
1129605026 15:77020720-77020742 AGGTGTCTGGGAGGGCTTCCTGG - Intronic
1129683148 15:77669602-77669624 AGCAGTCCCAGAGGGCTTCCTGG - Intronic
1129695915 15:77740661-77740683 AGGCATCAGGGAGAGCTTCCTGG + Intronic
1129713975 15:77836345-77836367 GGCAGTCCTGGAGGGCTTCCAGG - Intergenic
1130088114 15:80795491-80795513 AGGTGTCCAGGAGAACTCCCAGG + Intronic
1130352771 15:83106800-83106822 TGGCCTCCAGGAATGCTTCCTGG + Intergenic
1130390296 15:83448295-83448317 GGGCGTCAGGGAGAGCTTCCCGG + Intronic
1131116693 15:89800288-89800310 AGAGGTCAGGGAGGGCTTCCCGG - Intronic
1132157352 15:99504925-99504947 AGGCCTCCAGGAGGAGCTCCAGG - Intergenic
1132466920 16:81772-81794 GAGCATTCAGGAGGGCTTCCCGG - Intronic
1132466972 16:81943-81965 GAGCATTCAGGAGGGCTTCCTGG - Intronic
1132466989 16:82000-82022 GAGCATTCAGGAGGGCTTCCCGG - Intronic
1132467027 16:82114-82136 GAGCATTCAGGAGGGCTTCCCGG - Intronic
1132467045 16:82171-82193 GAGCATTCAGGAGGGCTTCCCGG - Intronic
1132467062 16:82228-82250 GAGCATTCAGGAGGGCTTCCCGG - Intronic
1132851359 16:2026464-2026486 GGGGGTCCGGAAGGGCTTCCCGG + Intronic
1133157051 16:3882586-3882608 AGTGGGCTAGGAGGGCTTCCTGG - Intergenic
1133905793 16:10021307-10021329 GGCCATCCAGGAGGGATTCCAGG - Intronic
1134404033 16:13939568-13939590 AGGCGTGCACGAAGGCTCCCAGG + Intronic
1134566377 16:15255439-15255461 AGGCAACCTGGAGGGCTTCCTGG + Intergenic
1134736119 16:16501259-16501281 AGGCAACCTGGAGGGCTTCCTGG - Intergenic
1134931401 16:18210906-18210928 AGGCAACCTGGAGGGCTTCCTGG + Intergenic
1135065791 16:19308738-19308760 AGGGCTCCAGGAGGGCTCCCAGG - Intronic
1135938179 16:26798542-26798564 AGGAGTCAAGGAAGGCTTCCTGG + Intergenic
1136019509 16:27431035-27431057 AGAGATCCTGGAGGGCTTCCTGG + Intronic
1136092072 16:27927697-27927719 AGGCATCAGGGAGGACTTCCTGG - Intronic
1136737737 16:32478138-32478160 TGATGTCCAGGATGGCTTCCAGG + Intergenic
1137724988 16:50651003-50651025 GGGGGTCAGGGAGGGCTTCCTGG - Intergenic
1138090039 16:54166408-54166430 AGGACTCAAGGATGGCTTCCTGG + Intergenic
1138514741 16:57529737-57529759 AGTGCTCCAGGAGGGCTTCCAGG - Intronic
1138533872 16:57649469-57649491 GGGAGTTGAGGAGGGCTTCCTGG + Intronic
1139150923 16:64381223-64381245 AGGAGTCCAGGAGGGAGGCCAGG + Intergenic
1139714320 16:68800483-68800505 AGGCGTCAGGGATGGCTTCAAGG + Intronic
1139972827 16:70786885-70786907 GGCCGTCCAGGAGGGCTACAGGG + Intronic
1140953669 16:79842965-79842987 AGGCTTCCTGTAGGGCTCCCGGG + Intergenic
1141631127 16:85288701-85288723 TGGGGTCCAGGCAGGCTTCCTGG + Intergenic
1141684812 16:85564170-85564192 GGGAATCCAGGAAGGCTTCCTGG + Intergenic
1142128222 16:88420638-88420660 CGCAATCCAGGAGGGCTTCCTGG + Intergenic
1142142848 16:88480210-88480232 TGCCATCCAGGAAGGCTTCCTGG - Intronic
1142383376 16:89746673-89746695 AGGCGTTCAGGAGGCCCTGCAGG + Exonic
1203015336 16_KI270728v1_random:351439-351461 TGATGTCCAGGATGGCTTCCAGG - Intergenic
1203033671 16_KI270728v1_random:624597-624619 TGATGTCCAGGATGGCTTCCAGG - Intergenic
1142607801 17:1091564-1091586 AGGAGTCCGAGAGGGCTGCCCGG + Intronic
1143105172 17:4526172-4526194 TGGGGTCAGGGAGGGCTTCCTGG + Intronic
1143289444 17:5817897-5817919 AAACAGCCAGGAGGGCTTCCTGG + Intronic
1143773852 17:9185281-9185303 AGGAGGCCAGGAGGGCCCCCTGG + Intronic
1143864110 17:9911511-9911533 TGGCTGTCAGGAGGGCTTCCTGG - Intronic
1144240162 17:13302649-13302671 AGGCTTCCAGGTCGGCTTACGGG - Intergenic
1144493715 17:15734487-15734509 AGGAGCCCTGGAGGGCTGCCTGG + Intronic
1144605521 17:16662271-16662293 AGTAGTACAGGAGGACTTCCTGG - Intergenic
1144906550 17:18642192-18642214 AGGAGCCCTGGAGGGCTGCCTGG - Exonic
1144918830 17:18746737-18746759 AGGGGCCCAGGAGGGGATCCTGG - Intronic
1145912362 17:28550045-28550067 TGGCTGCCAGGAGGGCTTCCTGG - Intronic
1146375056 17:32288228-32288250 AGAGGTCAAGGAAGGCTTCCTGG - Intronic
1147384745 17:40074451-40074473 TGGCGTGCTGGAGGGCATCCTGG + Exonic
1148048503 17:44758388-44758410 CGGCCTCCAGGAGGGCTTCAGGG - Intergenic
1148214912 17:45829277-45829299 AGGCCACCAGGAGGGCCACCAGG - Exonic
1148678084 17:49456684-49456706 AGCAATCCTGGAGGGCTTCCAGG - Intronic
1148718171 17:49730617-49730639 TGTAGTCAAGGAGGGCTTCCTGG - Intronic
1149477800 17:56977963-56977985 AGGGGTCCTGGTGGGCTTGCCGG + Intergenic
1149640029 17:58196812-58196834 GTGAGTCAAGGAGGGCTTCCTGG + Intronic
1150417302 17:64997855-64997877 ACGGGTCCAGGAGGGCTCCCGGG + Intergenic
1151183329 17:72345469-72345491 AGCAGTCCAGGAAGGCTTCATGG + Intergenic
1151388295 17:73768885-73768907 AGGGGTCCAGGAAGGCTTCATGG + Intergenic
1151968330 17:77444046-77444068 AGGATGTCAGGAGGGCTTCCTGG + Intronic
1153948652 18:10038649-10038671 AGGGGTCAGGGAAGGCTTCCTGG + Intergenic
1154355745 18:13622193-13622215 AGCTGTCCAGGTGGGTTTCCTGG + Intronic
1154442166 18:14399963-14399985 ATGCTTTCAGGAGGGCTTCGAGG + Intergenic
1155162517 18:23207473-23207495 AGGAGGCAAGGTGGGCTTCCTGG - Intronic
1157555254 18:48609292-48609314 AGTAGTCAAGGAGGGCTTCAGGG + Intronic
1157555458 18:48610380-48610402 GGGCATCCAGGTGGGCATCCAGG - Intronic
1157555462 18:48610392-48610414 GGGCATCCAGGTGGGCATCCAGG - Intronic
1157555466 18:48610404-48610426 GGGCATCCAGGTGGGCATCCAGG - Intronic
1157555470 18:48610416-48610438 GGGCATCCAGGTGGGCATCCAGG - Intronic
1157576742 18:48748747-48748769 TGAGGTCCAGGAGGGCTTCCTGG + Intronic
1160682685 19:419085-419107 ACGGGTCCAGGCGGGCTCCCGGG - Intronic
1160691600 19:462849-462871 AGGCAGCCAGGTAGGCTTCCTGG - Intergenic
1160848978 19:1180630-1180652 CGGCGCCCAGGAGGGCTGGCAGG - Intronic
1160881806 19:1324391-1324413 GGGCAGGCAGGAGGGCTTCCTGG + Intergenic
1160953756 19:1680024-1680046 TGGGGTCAGGGAGGGCTTCCTGG + Intergenic
1160955076 19:1687521-1687543 AGGGGTCAGAGAGGGCTTCCTGG + Intergenic
1161162807 19:2770067-2770089 GGGCATCCAGGAGGGTATCCGGG - Intronic
1161250091 19:3275799-3275821 CGGCCTCCGGGAGGGCCTCCGGG - Intronic
1161258739 19:3323831-3323853 CCTAGTCCAGGAGGGCTTCCTGG - Intergenic
1161352740 19:3803057-3803079 AGGAATCCAGGAGGCCTCCCTGG + Intergenic
1161421314 19:4177224-4177246 AGGAGTCCGGGAAGCCTTCCTGG - Intronic
1161422500 19:4183571-4183593 GGGCATCCGGGAGGGCTTCCTGG + Intronic
1161502403 19:4623653-4623675 GGCGGTCCGGGAGGGCTTCCTGG - Intergenic
1161619789 19:5292047-5292069 GGGCATCCAGGAGGGCTTCTTGG - Intronic
1161653103 19:5497334-5497356 AGGAAATCAGGAGGGCTTCCTGG + Intergenic
1161684223 19:5695154-5695176 GGGCAACCAGGAGGCCTTCCTGG - Intronic
1161800156 19:6412903-6412925 AGGCGCTCAGGAGGGCCTCAGGG - Intergenic
1161874126 19:6894425-6894447 AGGAGTCAGGGAAGGCTTCCTGG + Intronic
1162069352 19:8144491-8144513 GGGAGTCAGGGAGGGCTTCCTGG - Intronic
1162128424 19:8511578-8511600 GGGCCTCCAGGAGGGCTGGCTGG - Intronic
1162350736 19:10147689-10147711 AGGAGGCCAAGAGGGCTCCCCGG - Intronic
1162533357 19:11248571-11248593 AGGGGTCAGGGAGGACTTCCTGG - Intronic
1162925445 19:13928571-13928593 AGTGGTCAGGGAGGGCTTCCTGG - Intronic
1163432983 19:17279195-17279217 AGGATTCCAGGAGGGATCCCAGG + Exonic
1163512119 19:17741573-17741595 AGGCCAGAAGGAGGGCTTCCTGG + Intergenic
1163564949 19:18045523-18045545 GGCAGTCCTGGAGGGCTTCCTGG - Intergenic
1163623091 19:18372468-18372490 AGGTAGCCAGGAGGGCTTCCTGG - Intergenic
1163762522 19:19145458-19145480 GGGTGTCCGGGAGGGCTGCCAGG - Intergenic
1163772963 19:19201881-19201903 GTGCTTCCCGGAGGGCTTCCTGG + Exonic
1164683169 19:30149521-30149543 AGGGGTCAGGGAAGGCTTCCTGG + Intergenic
1165354594 19:35295803-35295825 AGTAGTCCACGAGAGCTTCCAGG + Exonic
1165362345 19:35344745-35344767 AGAAGTCCAGGATGCCTTCCAGG + Intronic
1165459599 19:35936677-35936699 CGGCGTCCCGGCTGGCTTCCTGG - Intronic
1165672753 19:37693341-37693363 ATTCTTCCAGGAGGGTTTCCCGG + Intronic
1165751558 19:38263748-38263770 GGGAGTCAAAGAGGGCTTCCTGG - Intronic
1165758394 19:38307264-38307286 GGGGGGTCAGGAGGGCTTCCTGG - Intronic
1166076383 19:40415975-40415997 AGAAATCAAGGAGGGCTTCCTGG + Intergenic
1166122677 19:40694808-40694830 GGGAGCCAAGGAGGGCTTCCCGG - Intronic
1166147684 19:40848656-40848678 AGGCATCGAGGAGCGCATCCAGG - Exonic
1166151817 19:40880521-40880543 AGGCATCGAGGAGCGCATCCAGG - Exonic
1166217195 19:41343504-41343526 GGGAGTCTAGGAGGGCTTGCTGG - Intronic
1166339776 19:42130781-42130803 GAGTGTCAAGGAGGGCTTCCTGG - Intronic
1166557852 19:43713404-43713426 GGGAGTCAGGGAGGGCTTCCTGG - Intergenic
1166658031 19:44626557-44626579 AGGAGTTAAGGAGGGCTTCCTGG + Intronic
1166659625 19:44637813-44637835 GAGGATCCAGGAGGGCTTCCTGG + Intergenic
1166663089 19:44660008-44660030 GGGGGTCAGGGAGGGCTTCCTGG - Intronic
1166667551 19:44689993-44690015 GGAGGTCAAGGAGGGCTTCCTGG - Intergenic
1166668816 19:44697824-44697846 TGAAGTCCAGGAGGGCTTCCTGG + Intergenic
1166673049 19:44722924-44722946 TGGGGTCAAGGAGGGCTTCCTGG + Intergenic
1166784422 19:45359140-45359162 GGGGGTCAGGGAGGGCTTCCTGG + Intronic
1166795767 19:45424453-45424475 CGGAGTCCGGAAGGGCTTCCTGG + Intronic
1166830451 19:45636462-45636484 TGGAGTCATGGAGGGCTTCCTGG - Intronic
1166876390 19:45900429-45900451 GGTGGTCCAGGAGGGCTTCCTGG - Intronic
1166939047 19:46351886-46351908 GGGAGTAAAGGAGGGCTTCCCGG + Intronic
1166994516 19:46713881-46713903 AGACATCCAGGAGGGCGACCTGG - Exonic
1167095692 19:47373876-47373898 AGAAATCCAGGAGGGCTTCCTGG + Intronic
1167096235 19:47376326-47376348 AGGAGTCAGGGAGGGCTTCCTGG + Intronic
1167101075 19:47404657-47404679 AGGATTCAAGGAGGGCTGCCTGG - Intronic
1167153391 19:47723063-47723085 GGGGGTCAAGGAGGACTTCCAGG - Intronic
1167303772 19:48695660-48695682 AGGCAGCCAGGAAGGCCTCCAGG - Intergenic
1167429977 19:49448579-49448601 AGGGGTCAGGGAAGGCTTCCTGG - Intronic
1167600741 19:50453385-50453407 GGGTATCCAGGAAGGCTTCCTGG + Intronic
1167780921 19:51598351-51598373 CTGCCTCCAGGAAGGCTTCCTGG - Intergenic
1167798897 19:51727642-51727664 AAGAGTCAGGGAGGGCTTCCTGG + Intergenic
1168319074 19:55498220-55498242 TTGACTCCAGGAGGGCTTCCTGG + Intronic
925125585 2:1453532-1453554 GGGCCTCCAGGAGGCCTTTCGGG + Intronic
925329157 2:3044847-3044869 AGGGGTCCAGGAAGGTTTGCAGG + Intergenic
927487721 2:23500231-23500253 GGGAGTCCAGGAGGGCTTCATGG + Intronic
927495294 2:23547878-23547900 GGTGGTCCAGGAAGGCTTCCAGG + Intronic
927700196 2:25263267-25263289 AGGACTCCAGGAAAGCTTCCTGG - Intronic
928453922 2:31402505-31402527 AGAGATCCAGGATGGCTTCCTGG + Intronic
929253180 2:39780940-39780962 AGGAGGCAGGGAGGGCTTCCTGG + Intergenic
930021143 2:47002924-47002946 AGGCAGCCAGGAAGGCTCCCTGG - Intronic
932334525 2:70922536-70922558 AGGGGACCAGGAGGACTTCCAGG - Intronic
932739404 2:74280299-74280321 AGGGGTCAAGGAAGGCTTCTAGG - Intronic
932780553 2:74556086-74556108 GGCTGTCCGGGAGGGCTTCCTGG + Intronic
933773804 2:85759782-85759804 AGGAGTCTTGGTGGGCTTCCAGG + Intronic
933773807 2:85759794-85759816 GGGCTTCCAGGAGGGCGTCTTGG + Intronic
933970806 2:87468575-87468597 AGGGCTCCAGGAGGGCTGGCTGG + Intergenic
934085635 2:88506864-88506886 GGGCATCAAGGAGAGCTTCCTGG + Intergenic
934188859 2:89767251-89767273 CGATGTCCAGGATGGCTTCCAGG + Intergenic
934307734 2:91840702-91840724 CGATGTCCAGGATGGCTTCCAGG - Intergenic
935401226 2:102662561-102662583 AGGGGTCCAGGAGGGCTCCTGGG + Intronic
935700747 2:105809796-105809818 AGCCATCCAGGAGGTCTTCCTGG + Intronic
935820333 2:106887068-106887090 GGGCGGCCAGGAGGGAGTCCCGG + Intronic
935868445 2:107417896-107417918 AGATGTCCAGGAGGCCTTCCAGG + Intergenic
936322924 2:111481621-111481643 AGGGCTCCAGGAGGGCTGGCTGG - Intergenic
937082080 2:119147387-119147409 GGGTGGTCAGGAGGGCTTCCAGG - Intergenic
937094772 2:119228350-119228372 TGGCATCCAGGGGGGCTTTCTGG + Intronic
937148630 2:119670215-119670237 AGGGGGCCAGAAAGGCTTCCAGG - Intergenic
937224481 2:120360345-120360367 TGGTCACCAGGAGGGCTTCCTGG + Intergenic
937280108 2:120711878-120711900 TGTGGTCCAGGAAGGCTTCCTGG + Intergenic
937302920 2:120854178-120854200 GGGAGTCAAGGAGAGCTTCCTGG + Intronic
937332613 2:121041729-121041751 GGGAGTCAAGGAGGGCTTCCTGG - Intergenic
937354937 2:121192379-121192401 AGCCATCCTGGAGGGCTTCCTGG - Intergenic
938073494 2:128320121-128320143 TTGCTTCCAGGAGGGCTTTCTGG - Intergenic
938207869 2:129439254-129439276 CGGAGTCCAGGAAGGCTTCTTGG + Intergenic
942055906 2:172181865-172181887 AGACACTCAGGAGGGCTTCCAGG - Intergenic
943643023 2:190379740-190379762 AGGCGTCCAGGCGAGTTGCCAGG - Intergenic
946017468 2:216615483-216615505 AGGCGTCTAGGCCAGCTTCCTGG + Intergenic
946486159 2:220102848-220102870 AGTATTCCTGGAGGGCTTCCTGG - Intergenic
947520063 2:230838710-230838732 AGGGGTTCAGGAGGGGTTACTGG - Intergenic
947729332 2:232419474-232419496 TGGCGTCCAGGTTGGCTGCCAGG + Intergenic
947872026 2:233444587-233444609 AGGACTCCGCGAGGGCTTCCTGG - Intronic
948482220 2:238257395-238257417 AGGCCTGCAGAAGGGCTGCCTGG - Intronic
948580946 2:238986799-238986821 AGGTGTCCAGGAGGGGCTCTTGG - Intergenic
948768844 2:240236999-240237021 AGGTGTCCATGAGGGCTTCCAGG - Intergenic
948940827 2:241195517-241195539 AGGACTCCAGGAGCACTTCCAGG - Intronic
1169142852 20:3235920-3235942 AGGGATCTAGGAGGACTTCCTGG - Intronic
1170763633 20:19272944-19272966 GAGGGTCCAGGAAGGCTTCCTGG + Intronic
1171986145 20:31662498-31662520 AGGAGTCAGGGAGGGCTCCCTGG - Intergenic
1172195979 20:33091889-33091911 GGAAGTCAAGGAGGGCTTCCTGG + Intronic
1172511547 20:35504369-35504391 AGGCATCCAGGGAGGCTTGCAGG - Exonic
1172573608 20:35989501-35989523 AGGCTTTAAGAAGGGCTTCCTGG + Intronic
1172778831 20:37423719-37423741 TGGCGCACAGGAGGGCTCCCTGG + Intergenic
1172803220 20:37592800-37592822 GGAGGTGCAGGAGGGCTTCCTGG + Intergenic
1172847339 20:37937833-37937855 GGGGGGCCAGGAGGGCTTCCTGG + Intronic
1173724673 20:45289052-45289074 TGGAGCCCAGGAAGGCTTCCTGG - Intergenic
1173801875 20:45899217-45899239 GGGTGTCAAGGAGGGCTTCTTGG + Intronic
1173812701 20:45965900-45965922 AGGAGATCAGGAGGGCTTTCTGG - Intronic
1174050775 20:47765919-47765941 AGCAGTCAGGGAGGGCTTCCTGG + Intronic
1174379259 20:50146267-50146289 AGGCATCATGGATGGCTTCCTGG - Intronic
1174421891 20:50404681-50404703 TGGGGGCAAGGAGGGCTTCCTGG - Intergenic
1174453558 20:50634397-50634419 AGGTGTCCAGGAAGGCTTCCTGG - Intronic
1174462289 20:50691441-50691463 GGGGCCCCAGGAGGGCTTCCTGG - Exonic
1174505432 20:51014809-51014831 AGGGGTGAAGGAGGGCTTCTTGG + Intronic
1175191723 20:57216234-57216256 GGGCAGCCGGGAGGGCTTCCTGG - Intronic
1175320858 20:58087235-58087257 AGTAGTCCAGGAAGGCTCCCTGG - Intergenic
1175726833 20:61324245-61324267 ATTCCTCCAGGAGGGCTTCCTGG - Intronic
1175918431 20:62438442-62438464 AGTGGTGCAGGAGGGCTGCCGGG + Intergenic
1176190100 20:63804455-63804477 TGACGCCCGGGAGGGCTTCCTGG - Intronic
1176376116 21:6087628-6087650 AGGCTCCCAGGCGGGCTCCCGGG - Intergenic
1176453909 21:6891209-6891231 ATGCTTTCAGGAGGGCTTCGAGG - Intergenic
1176832084 21:13756257-13756279 ATGCTTTCAGGAGGGCTTCGAGG - Intergenic
1178507013 21:33170535-33170557 AGGTATCAAGGAGGCCTTCCTGG - Intergenic
1179403648 21:41107895-41107917 CGGCTTCCAGGAGGGACTCCTGG + Intergenic
1179427596 21:41294264-41294286 GGAGGACCAGGAGGGCTTCCAGG - Intergenic
1179597398 21:42452085-42452107 TGGCGGCCAGGAGGGCTTCCTGG - Intergenic
1179747359 21:43450616-43450638 AGGCTCCCAGGCGGGCTCCCGGG + Intergenic
1179950985 21:44708736-44708758 AGGTGTCCAGGAGGGCCTCAGGG - Intronic
1180534813 22:16387784-16387806 CGATGTCCAGGATGGCTTCCAGG - Intergenic
1180749066 22:18111702-18111724 AGGGGTCCAGGAGGGATTCCTGG - Intronic
1181024465 22:20120205-20120227 AGGGGGCCAGGAGGGATACCTGG + Intronic
1181580006 22:23822808-23822830 AGGAGGCCAGGAAGGCTTCTAGG - Intronic
1181728025 22:24825076-24825098 GGGAGTCCAGGAAGGCTTCTAGG + Intronic
1181926633 22:26364805-26364827 AGGCATCAAGGAAGGCTTCCTGG + Intronic
1182051509 22:27316031-27316053 AGGAGTCCAGGATGACTGCCAGG - Intergenic
1182067263 22:27439359-27439381 GGTGGTCAAGGAGGGCTTCCTGG - Intergenic
1182318151 22:29461454-29461476 GGGCATCAAGGAAGGCTTCCTGG + Intergenic
1183331056 22:37221785-37221807 AGGTGTCAAGGAGGACTCCCAGG + Intergenic
1183505905 22:38208748-38208770 AGGGATCAGGGAGGGCTTCCTGG + Intronic
1183631700 22:39037077-39037099 AGGAGTGCTGGGGGGCTTCCAGG + Intergenic
1184059974 22:42075458-42075480 AGGGGTCAGGGAAGGCTTCCCGG + Intronic
1184379902 22:44138696-44138718 TGGCAGACAGGAGGGCTTCCTGG - Intronic
1184410923 22:44325928-44325950 AGGGGTCAGGGAGGGCTTCCTGG - Intergenic
1184431763 22:44445231-44445253 AGAGGGCAAGGAGGGCTTCCTGG - Intergenic
1184508679 22:44919133-44919155 GGGCATCAAGGAAGGCTTCCTGG - Intronic
1184654366 22:45933671-45933693 TGGAGTCAAGGAAGGCTTCCTGG + Intronic
1184673080 22:46025864-46025886 AGGAGTCCAGGAAGCCTTCCTGG - Intergenic
1184797167 22:46738908-46738930 TGGGGTCAAGGAGGCCTTCCTGG - Intergenic
1185046171 22:48529682-48529704 GGGTGTCCAGGTGGGATTCCAGG + Intronic
1185146547 22:49140098-49140120 GGGCATCCAGGGGGACTTCCTGG - Intergenic
1185292954 22:50036233-50036255 GGGCGTCCAGGGGAGATTCCCGG - Intronic
1185316286 22:50180617-50180639 CGGGATCCAGGAAGGCTTCCTGG + Intergenic
949495711 3:4629796-4629818 AGTGGTCAGGGAGGGCTTCCTGG + Intronic
949882612 3:8673808-8673830 ATGCTTCCAAGAGAGCTTCCCGG - Intronic
950136522 3:10584914-10584936 AGGGGTCTAAGAGAGCTTCCTGG - Intronic
950433769 3:12966900-12966922 AGGCCTGCAAGAGGCCTTCCTGG + Intronic
950638583 3:14333352-14333374 AGGAGACCAGGAGGGCTTCCTGG - Intergenic
950674756 3:14548046-14548068 AGGAGTCCAGGAAAGCTGCCGGG + Intergenic
950686213 3:14620330-14620352 AGGAGTCAAGGAGGACTCCCAGG + Intergenic
952324332 3:32307401-32307423 AGGAGTCTAGGATGACTTCCTGG + Intronic
952506860 3:34015385-34015407 AGGTGTGCAGCAGGGCTTCGTGG + Intergenic
953235562 3:41103384-41103406 AGTTGTACTGGAGGGCTTCCAGG - Intergenic
954308745 3:49747956-49747978 AGGGCTCCAGGAGGACTCCCCGG + Exonic
955068168 3:55550223-55550245 AGGCTTCAGGGAGGGCTTCCTGG - Intronic
956001799 3:64737770-64737792 GGGGGTCCAGGAAGGCTTTCTGG + Intergenic
956425350 3:69128693-69128715 TCAGGTCCAGGAGGGCTTCCTGG - Intergenic
956645683 3:71453469-71453491 ATGCGGCCAGTAGGGCTGCCGGG - Intronic
961087709 3:124083362-124083384 AGTTGGCCAGGAAGGCTTCCTGG + Intronic
961087710 3:124083368-124083390 AGGTCTCCAGGAAGCCTTCCTGG - Intronic
961446050 3:126982370-126982392 AGGCATCCGGGAGGGCCTCCCGG - Intergenic
961825764 3:129598270-129598292 AGGAGTGCGGGAGGGCTTCCTGG - Intronic
962309342 3:134314173-134314195 GGAGATCCAGGAGGGCTTCCTGG + Intergenic
962375844 3:134858039-134858061 AGACCTCCTGGAGGGCTTCTGGG - Intronic
962626312 3:137229112-137229134 AGGGGTCAGGGAGGGCTTCCTGG + Intergenic
962850819 3:139307131-139307153 AGGGTTCTTGGAGGGCTTCCTGG - Intronic
962902266 3:139771822-139771844 AGAAGTCCAGGAAGGCTTCCTGG + Intergenic
962941691 3:140130418-140130440 AAACTTCCAGGAGGGTTTCCCGG - Intronic
965624305 3:170671870-170671892 AGGAGTCCAGGAAATCTTCCAGG - Intronic
967792290 3:193562129-193562151 TGGGGTCCAGGAGAGCTTCCAGG - Intronic
967894843 3:194387467-194387489 AGGGGTGCAGGAGGCCTTCCAGG - Intergenic
967959902 3:194912169-194912191 AGGGGAGCAGGTGGGCTTCCCGG - Intergenic
968025681 3:195441305-195441327 AGGCGTGCAGGTTGGTTTCCAGG - Intronic
968926572 4:3551552-3551574 AGGTGTGCAGGGGGGATTCCGGG - Intergenic
968962686 4:3753349-3753371 AGGGGTGCAGGAGGGCTTCCTGG + Intergenic
968982549 4:3858213-3858235 CAGCAGCCAGGAGGGCTTCCTGG - Intergenic
969176495 4:5402849-5402871 AGTAGTGCAGGAGGGCTTCCTGG + Intronic
969196487 4:5567452-5567474 AGGAGGCCAGGAGGGCATCTGGG - Intronic
969235842 4:5864684-5864706 TGGGGTCAAGGAAGGCTTCCTGG + Intronic
969249256 4:5956334-5956356 AGCAGTCAGGGAGGGCTTCCTGG - Intronic
969251474 4:5971181-5971203 AGGAGCCCAGGAGGACTGCCAGG - Intronic
969300458 4:6294207-6294229 TGGTGACCAGGAGGGCCTCCAGG - Intronic
969327227 4:6451041-6451063 GCACGTCCAGGAGGGCTTCCTGG - Intronic
969504946 4:7579863-7579885 AGGGATCCAGGAAGGCTTCCTGG + Intronic
969521107 4:7678195-7678217 AGGAGTCAGGGAGTGCTTCCTGG + Intronic
969525686 4:7702844-7702866 TGGCATCAGGGAGGGCTTCCTGG + Intronic
969585219 4:8087616-8087638 AGGAGACCTGGAAGGCTTCCTGG + Intronic
969723697 4:8907129-8907151 AAGGGTGCAGGAAGGCTTCCTGG - Intergenic
969838238 4:9860788-9860810 AGGCTTCAGGGAGGACTTCCCGG - Intronic
969913004 4:10462116-10462138 AGGCGTCCGCGAGGGTCTCCTGG + Intergenic
973951922 4:56024711-56024733 AGGCGTTCAGGAGAACTTCCTGG + Intronic
974026609 4:56738506-56738528 AGGGGACCAGGAGGGCCACCAGG + Intergenic
975445223 4:74456186-74456208 ATGAGTCAGGGAGGGCTTCCTGG + Intergenic
975628041 4:76369461-76369483 AGGCCTTGAGCAGGGCTTCCAGG + Exonic
975912054 4:79278582-79278604 AGTGGTCTAGAAGGGCTTCCTGG - Intronic
976435797 4:85016517-85016539 AGGCGTCAAGAAGAACTTCCAGG - Intergenic
981573309 4:146176235-146176257 TGTCTTCCAGGAGGGCTTCAGGG + Exonic
985835385 5:2268139-2268161 AGGCTGCCAGGGGGACTTCCGGG + Intergenic
985870249 5:2548742-2548764 AGGGGTCCAGAAGGGAGTCCTGG - Intergenic
986668437 5:10123416-10123438 ATCAGTCCAGGAGGGCTTCCTGG - Intergenic
986721680 5:10564686-10564708 GAGCGTCCCGGAGGGCGTCCCGG + Exonic
988609646 5:32712430-32712452 GGGGGTCCACGAGGTCTTCCAGG + Exonic
992063959 5:73086498-73086520 AGGAGTCTAGGAGGGTTCCCAGG - Intronic
992955274 5:81901740-81901762 CGGGGTCCTGGAGGGCTCCCAGG + Intergenic
995055701 5:107756635-107756657 AGGAGTCCAGGATGGCTTCCAGG + Intergenic
997202443 5:132019511-132019533 AGGAGTGCAGCTGGGCTTCCAGG - Intergenic
997234987 5:132267554-132267576 AGGAGTCAAGGAGTGCTTCCTGG + Intronic
997436633 5:133880397-133880419 GTAAGTCCAGGAGGGCTTCCTGG - Intergenic
998129193 5:139642867-139642889 AGGCCTCTGGGTGGGCTTCCTGG - Intergenic
998353025 5:141513426-141513448 AAGCGCCCCGGAGGGCTTCACGG + Intergenic
998628829 5:143875990-143876012 AGGTGTCCAGGATGACTCCCAGG + Intergenic
998878648 5:146625622-146625644 GGGGGTCCAGGAAGTCTTCCTGG + Intronic
1001288215 5:170438782-170438804 GGGCATCAGGGAGGGCTTCCTGG - Intronic
1001421390 5:171589901-171589923 AGTCCTACAGCAGGGCTTCCTGG - Intergenic
1001647718 5:173294770-173294792 AGGGGGCCAGGAGGGCTTCCTGG + Intergenic
1002098634 5:176846532-176846554 GGGCATCCAGGAGGGCTTCCTGG - Intronic
1002662132 5:180798390-180798412 AGGCGTCAAGGAAGGCATCTTGG - Intronic
1002925635 6:1604552-1604574 GGGCGCCCAGGACGGCTGCCTGG + Intergenic
1004020457 6:11771483-11771505 AGGCTTCCAGGAGGGCAGCAGGG + Intronic
1006401303 6:33819229-33819251 TGGGCTCCAGGAGGGCTCCCAGG + Intergenic
1006466794 6:34200368-34200390 TGCCGTCAAGGAAGGCTTCCTGG + Intergenic
1006501789 6:34464048-34464070 GGCCATCCAGGAAGGCTTCCTGG - Intergenic
1007101850 6:39253975-39253997 AGAAGTCCAGGAGGGAATCCAGG + Intergenic
1007102572 6:39259885-39259907 CAGAGTCCAGGAAGGCTTCCTGG - Intergenic
1007249940 6:40488669-40488691 AGGGATCATGGAGGGCTTCCTGG - Intronic
1010001929 6:70956866-70956888 AGGCGTCCCAGAGAGCGTCCTGG - Exonic
1012908275 6:105092063-105092085 AGGGGTCCAGGAGGAAGTCCCGG + Intergenic
1013434990 6:110094816-110094838 AGGAGTCAAGGATGACTTCCAGG - Intergenic
1014432627 6:121388684-121388706 TGTGGTCCAGGAGGGCTTCCTGG - Intergenic
1016074594 6:139780574-139780596 AGGCTTCCAGGAGCCATTCCAGG + Intergenic
1017408356 6:154143355-154143377 AGTGGTCAAGGAGGGCTTCATGG - Intronic
1017630390 6:156391246-156391268 AGGCCTCCAGGTGGGCAGCCAGG - Intergenic
1019331481 7:462821-462843 AGGAGCCCAGCCGGGCTTCCGGG + Intergenic
1019603100 7:1895075-1895097 GGGAACCCAGGAGGGCTTCCTGG + Intronic
1019719460 7:2559441-2559463 CGGCGTCCCGGAGAGCTTCCTGG - Intronic
1021554761 7:21908104-21908126 AGGCTTCACGGAGGGCGTCCTGG - Intronic
1022843698 7:34189784-34189806 AGACATCCAGGGGGACTTCCAGG + Intergenic
1022887395 7:34660831-34660853 ATGAGTCAAGGAGGGCTTCATGG - Intronic
1023310378 7:38880443-38880465 AGGCATCCAGGAGAGGTTCTTGG - Intronic
1025910640 7:65825764-65825786 GGGAGTCAAGGAAGGCTTCCAGG + Intergenic
1026897605 7:74019337-74019359 GTCAGTCCAGGAGGGCTTCCTGG - Intergenic
1026898009 7:74021749-74021771 AGGCAATCAGGAAGGCTTCCTGG - Intergenic
1028751687 7:94390382-94390404 TGGAATCAAGGAGGGCTTCCTGG - Intergenic
1029461234 7:100694651-100694673 TGTCATCCAGGCGGGCTTCCTGG - Intergenic
1029593373 7:101522218-101522240 AGTGGTCAAGGAAGGCTTCCTGG - Intronic
1029623182 7:101702703-101702725 AGATGTCCAGGAAGGCTTCCTGG + Intergenic
1032464652 7:132136400-132136422 AGGGGTCCTGAAGGACTTCCTGG - Intronic
1032545876 7:132742055-132742077 AAGCGTCAAGGATGGCTTCTGGG - Intergenic
1032800446 7:135313387-135313409 TGGAGTCAGGGAGGGCTTCCTGG - Intergenic
1032863720 7:135905355-135905377 AGAGGCCAAGGAGGGCTTCCAGG - Intergenic
1034069693 7:148172249-148172271 TGGGGGCCAGCAGGGCTTCCTGG + Exonic
1036635331 8:10546606-10546628 GTGCGACCAGGAGGGCTTCCTGG - Intronic
1036845827 8:12169877-12169899 AGGCGTCCAGGAGACTTTTCAGG - Intergenic
1036867193 8:12412196-12412218 AGGCGTCCAGGAGACTTTTCAGG - Intergenic
1039888137 8:41667093-41667115 AGGCGCCCAGGAGGGCCTGATGG + Intronic
1041609353 8:59826573-59826595 GGGGGTACAGGTGGGCTTCCAGG - Intergenic
1042693787 8:71533146-71533168 AAGGGTCCAAGAGGGCTTTCTGG + Intronic
1043539352 8:81242182-81242204 AGGGGTCAGGGAGGGCTCCCTGG + Intergenic
1045992574 8:108326582-108326604 AGGCATCAGGGAAGGCTTCCTGG + Intronic
1047757159 8:127927479-127927501 AGGCATCCAAAAGGGCTTCATGG - Intergenic
1048340884 8:133537604-133537626 AAGCATCCAGGAGGGGTGCCAGG + Intronic
1048371626 8:133783666-133783688 AGCCACCCAGCAGGGCTTCCAGG + Intergenic
1048385899 8:133912343-133912365 GGAAGTCCAGGAAGGCTTCCTGG + Intergenic
1049025149 8:139983389-139983411 AGGTGGCTAGGAGGGCTTCCTGG - Intronic
1049220493 8:141426685-141426707 GGTGGTCCAGGAAGGCTTCCTGG + Intronic
1049230738 8:141479936-141479958 ATGTTTCCAGGAGGGCTTGCAGG + Intergenic
1049231995 8:141489280-141489302 GGCCATCAAGGAGGGCTTCCTGG - Intergenic
1049272436 8:141703030-141703052 AGGCCTCCTGGAGGGCTCACAGG + Intergenic
1049339246 8:142103130-142103152 TGGAGTCAAGGAGGGCTTCCTGG + Intergenic
1049352192 8:142170333-142170355 GCGTGGCCAGGAGGGCTTCCTGG + Intergenic
1049408491 8:142462083-142462105 AGGACTGGAGGAGGGCTTCCAGG + Intronic
1049414376 8:142488635-142488657 AGAGGGCAAGGAGGGCTTCCTGG - Intronic
1049425998 8:142538146-142538168 AAGAGTCAAGGAGGGCTCCCTGG - Intronic
1049426494 8:142540241-142540263 TGGGCCCCAGGAGGGCTTCCTGG + Intronic
1049443833 8:142621099-142621121 AGGAGGTCAGGAAGGCTTCCTGG - Intergenic
1049769474 8:144373177-144373199 TGGGGTCTAGGAGGGCTTGCAGG + Intronic
1049782064 8:144433681-144433703 AGGCGTGCAGGAGGGAGGCCAGG + Exonic
1052181401 9:25533346-25533368 AGGAGGCCAGGTGGGCTTCCAGG - Intergenic
1053009518 9:34625216-34625238 AAGGGTCCAGGAGGGCATCAGGG - Intronic
1053298857 9:36934670-36934692 GGGAATCCATGAGGGCTTCCTGG - Intronic
1054143706 9:61547892-61547914 AGGTGTGCAGGGGGGATTCCGGG + Intergenic
1054463483 9:65479227-65479249 AGGTGTGCAGGGGGGATTCCGGG + Intergenic
1055368606 9:75572959-75572981 CGGTGTCCAGGTGGGTTTCCTGG + Intergenic
1056165489 9:83937015-83937037 AGGCATCCAGGATTGATTCCAGG + Intergenic
1056495885 9:87154823-87154845 GGGATTCCAGGAGAGCTTCCTGG + Intronic
1056814305 9:89790450-89790472 AGGCAGCCAGGAGAGCTCCCTGG + Intergenic
1057291911 9:93812296-93812318 GGTGGCCCAGGAGGGCTTCCTGG + Intergenic
1058603682 9:106698026-106698048 AGGCTTCAAGGAGAGCTTCTGGG + Intergenic
1059401862 9:114075776-114075798 GGGTGTCTGGGAGGGCTTCCTGG + Intronic
1059407845 9:114112977-114112999 GAGAGTCCAGGAGAGCTTCCTGG + Intergenic
1059447838 9:114349923-114349945 AGGCTTCAGGGAGGGCTTCCTGG - Intronic
1060554450 9:124501068-124501090 ATGAATCCAGGAGTGCTTCCTGG - Intronic
1060781853 9:126418823-126418845 AGGCTCCCTGGAAGGCTTCCTGG - Intronic
1061301863 9:129710084-129710106 GTGGGTCCAGGAGGGCTTCTTGG + Intronic
1061777252 9:132973602-132973624 GGGCGTCTGGGAGGGCTTCCTGG + Intronic
1061802081 9:133118167-133118189 GGTCTTCCAGGAGAGCTTCCTGG - Intronic
1061903831 9:133686423-133686445 GGGAGTCAGGGAGGGCTTCCTGG - Intronic
1062174216 9:135151968-135151990 AGGAGTCAAGGAAGGCTTCCTGG - Intergenic
1062400850 9:136372024-136372046 GAGCGTCCTGGAGGGCTTCCGGG - Exonic
1062433784 9:136537163-136537185 GGGCGTCCGGGGTGGCTTCCTGG - Intronic
1062551528 9:137089710-137089732 AGGAGGCCAGGAGAGCTGCCTGG + Intronic
1062558356 9:137127469-137127491 AGGAGGCCAGGAGAGCTGCCTGG - Intergenic
1062586116 9:137250839-137250861 AGGGGCCCAGGAAGGCTCCCTGG - Intergenic
1062592569 9:137280837-137280859 AGGCGTCCAGGAGGGCTTCCGGG - Exonic
1189281888 X:39824867-39824889 GGGTGTCCGGTAGGGCTTCCTGG - Intergenic
1190737417 X:53264715-53264737 TGGTGTCCAGGAGGGCTTGCTGG - Intronic
1192195533 X:69025330-69025352 AGCCGTCCTGGAGGGACTCCCGG + Intergenic
1192218268 X:69178969-69178991 AGGGGCCCAGGAAGACTTCCTGG - Intergenic
1192585893 X:72317916-72317938 AGGCTTCCTGGAGGGCTCCCAGG + Intergenic
1198279264 X:135125965-135125987 AGGAGTGCACGAGGGCTTCTTGG - Intergenic
1198291693 X:135246555-135246577 AGGAGTGCACGAGGGCTTCTTGG + Intergenic
1200110946 X:153740664-153740686 CGACGTCCAGGATGGCTTCCAGG - Exonic
1200373985 X:155759924-155759946 AGAAGTCAAGGAAGGCTTCCTGG - Intergenic