ID: 1062592886

View in Genome Browser
Species Human (GRCh38)
Location 9:137281888-137281910
Sequence GTCCCAGGAGCCCACACAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 277}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062592881_1062592886 -3 Left 1062592881 9:137281868-137281890 CCTCTCCCAGGCGAGTATCTGTC 0: 1
1: 0
2: 1
3: 12
4: 103
Right 1062592886 9:137281888-137281910 GTCCCAGGAGCCCACACAGAGGG 0: 1
1: 0
2: 3
3: 20
4: 277
1062592884_1062592886 -9 Left 1062592884 9:137281874-137281896 CCAGGCGAGTATCTGTCCCAGGA 0: 1
1: 0
2: 0
3: 10
4: 89
Right 1062592886 9:137281888-137281910 GTCCCAGGAGCCCACACAGAGGG 0: 1
1: 0
2: 3
3: 20
4: 277
1062592880_1062592886 0 Left 1062592880 9:137281865-137281887 CCACCTCTCCCAGGCGAGTATCT 0: 1
1: 0
2: 3
3: 31
4: 355
Right 1062592886 9:137281888-137281910 GTCCCAGGAGCCCACACAGAGGG 0: 1
1: 0
2: 3
3: 20
4: 277
1062592879_1062592886 1 Left 1062592879 9:137281864-137281886 CCCACCTCTCCCAGGCGAGTATC 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1062592886 9:137281888-137281910 GTCCCAGGAGCCCACACAGAGGG 0: 1
1: 0
2: 3
3: 20
4: 277
1062592882_1062592886 -8 Left 1062592882 9:137281873-137281895 CCCAGGCGAGTATCTGTCCCAGG 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1062592886 9:137281888-137281910 GTCCCAGGAGCCCACACAGAGGG 0: 1
1: 0
2: 3
3: 20
4: 277
1062592878_1062592886 2 Left 1062592878 9:137281863-137281885 CCCCACCTCTCCCAGGCGAGTAT 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1062592886 9:137281888-137281910 GTCCCAGGAGCCCACACAGAGGG 0: 1
1: 0
2: 3
3: 20
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062592886 Original CRISPR GTCCCAGGAGCCCACACAGA GGG Exonic
900082563 1:869720-869742 GTCGCAGGAGGGCACCCAGAAGG + Intergenic
900124831 1:1064732-1064754 GTGCCAGGAGGACACACGGAGGG - Intergenic
900301568 1:1980584-1980606 GTCCCAGGAACCCCCAAAGAAGG - Intronic
900922499 1:5682252-5682274 ATCCCAGGAGCAAACAGAGACGG + Intergenic
900972074 1:5997243-5997265 GTCCCAGGAAACCACGCAGAAGG - Intronic
901225520 1:7610935-7610957 GTCCCAGGCCCCCAGGCAGAGGG + Intronic
901510335 1:9715325-9715347 CTCCCAGGTGCCCCCACAGAAGG + Intronic
902528920 1:17077794-17077816 CTGCCAGGAGCCTGCACAGATGG - Intronic
902626903 1:17682076-17682098 GACCCAGGAGCCAACACGAAGGG - Intronic
904946939 1:34206244-34206266 CTCACAGGAGCCCATACAGTAGG - Intronic
905304872 1:37010663-37010685 CTCGCTGGAGCGCACACAGACGG - Intronic
905336385 1:37247587-37247609 GCCCCAGGAGCCAGCAGAGATGG + Intergenic
906283115 1:44567350-44567372 GTCCCAGGATCATACACAGCTGG - Intronic
906520039 1:46461429-46461451 TCCCCAGGAACCCACAGAGAAGG - Intergenic
907395133 1:54184440-54184462 GGCCCAGAAGCTTACACAGAAGG + Intronic
909478344 1:76107729-76107751 TTCCTATGAGCCCACACACATGG - Intronic
910902359 1:92134794-92134816 GTCCCCTTAGCCCACACACAGGG + Intronic
911726501 1:101246656-101246678 GTCCCTGGACCCCAAAGAGAGGG - Intergenic
915532422 1:156510370-156510392 TACCAAGGAGCCTACACAGAAGG + Intergenic
915865512 1:159494686-159494708 GGCACAGGAGCCCACGGAGAGGG + Intergenic
916431247 1:164731164-164731186 GTCCCTAGAGCCTACAGAGAGGG - Intronic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
919228153 1:194735915-194735937 GTCACATGATCCCACACAGGTGG + Intergenic
921903794 1:220475747-220475769 GGCACAGGAGCCCACGGAGAGGG + Intergenic
924800338 1:247325194-247325216 GGGCCAGGAGCCCACACAGATGG + Intronic
1062760027 10:11257-11279 GTCGCAGGAGGACACCCAGAAGG + Intergenic
1063210050 10:3872112-3872134 GTCGCAGGAGCCCACGCTCAGGG - Intergenic
1063818290 10:9803234-9803256 GTTCCAGGAGCCCAGAGATAAGG + Intergenic
1063954741 10:11255629-11255651 GTCCCAGGAGCTGTCACAGTGGG + Intronic
1064156342 10:12906311-12906333 GTGCCAGGAGCCCAAACAAAGGG + Intronic
1065634522 10:27717050-27717072 GTGCCAGGAGGCCACAAGGAAGG + Intronic
1067055727 10:43048782-43048804 GCCCCAGGGCCCCACTCAGAAGG - Intergenic
1067465803 10:46497897-46497919 TGTCCAGGGGCCCACACAGAAGG - Intergenic
1067621384 10:47886709-47886731 TGTCCAGGGGCCCACACAGAAGG + Intergenic
1069561676 10:69435272-69435294 TTCCCAGGTGCCCACACTGGAGG - Intergenic
1069636136 10:69926036-69926058 TTCCCAGGAGGCTACACAGCGGG - Intronic
1071291638 10:84193528-84193550 CTCCCAGGAGCACACAGAGGAGG + Intergenic
1074184379 10:111088107-111088129 CTCCCAGGAGCCCCCAGAGAGGG + Intergenic
1075380834 10:122017280-122017302 ATCACAGCAGCGCACACAGATGG + Intronic
1076240916 10:128906671-128906693 CTCCCAGGATCCCAATCAGAGGG + Intergenic
1076713031 10:132349436-132349458 GTCCTAGCAGCACACACAGCAGG + Intronic
1077173534 11:1178786-1178808 GTCCCAGCAGCCCACACCCTTGG - Intronic
1077239582 11:1503518-1503540 GCCACAGGAGCCCACAGAGCCGG + Intergenic
1079112398 11:17612257-17612279 GGCCCAGGATCCCACAGCGAGGG - Exonic
1083041063 11:59687957-59687979 TTCCCTGCACCCCACACAGAAGG - Intergenic
1083289835 11:61683634-61683656 GTCCCAGCATCCCAAGCAGAAGG - Intronic
1083896444 11:65622238-65622260 ATCCCAGGAGCAGACACTGATGG + Exonic
1085321739 11:75578608-75578630 GACCAAGGAGACCAAACAGATGG + Intergenic
1087019350 11:93586935-93586957 GTACCAGGGGCTCACAGAGAGGG + Intergenic
1089286146 11:117409365-117409387 GGCCCAGGACCCCAGAGAGAAGG - Intronic
1089660570 11:119982688-119982710 GTGCCAGGAGCCCACAGAGGGGG + Intergenic
1090441510 11:126728784-126728806 GGCCATGGAGCCAACACAGAAGG - Intronic
1090475107 11:127013172-127013194 GTCCCAGGAGCACACAAACAAGG + Intergenic
1090630676 11:128644479-128644501 GTCCCAGCAGTCCATGCAGAAGG + Intergenic
1091312478 11:134584494-134584516 GTCTCCCGAGCCCTCACAGAAGG - Intergenic
1091542044 12:1470854-1470876 GTCCAAGCATTCCACACAGAAGG + Intronic
1091776230 12:3186731-3186753 GCCCCAGGAGACCAGACAGGGGG + Intronic
1096738755 12:53676697-53676719 GTCCCAGGAGCCAGGAAAGAGGG - Intronic
1097273725 12:57796399-57796421 GTCCAGGGAGCCAACAGAGAGGG - Exonic
1104552943 12:129774169-129774191 GTCCCAGGCCCCCCCAAAGAAGG + Intronic
1104765839 12:131329709-131329731 GGGCCGGGAGCCCACCCAGAAGG + Intergenic
1104813427 12:131632153-131632175 GGGCCGGGAGCCCACCCAGAAGG - Intergenic
1104901487 12:132191772-132191794 GTCCCTGCAGCCCTCTCAGAGGG + Intergenic
1104915095 12:132260407-132260429 GCCCCAGGACCCCATACACAAGG + Intronic
1107266388 13:38561005-38561027 GTGCTAGGAGCCCACAATGATGG + Intergenic
1108722186 13:53143470-53143492 TTCCCAGCAGCACAAACAGAGGG + Intergenic
1109741562 13:66561306-66561328 GGCACAGGAGCCCACAGAGTGGG - Intronic
1111099639 13:83567048-83567070 GACCCAGTTGCCCACACAGGTGG - Intergenic
1113897814 13:113776901-113776923 GTCCCAGGAGCCAACGCCTATGG + Intronic
1114417129 14:22552415-22552437 ATAACAGGAGCCCACACACATGG + Intergenic
1117018837 14:51548819-51548841 GTCCCAGGACCACACTTAGAAGG - Intronic
1117339119 14:54778862-54778884 GACCCAGGATCCCTCACTGAAGG + Intronic
1117863184 14:60114767-60114789 GTCCCAAGTGCCCACAGAAAGGG - Exonic
1118726379 14:68631949-68631971 ATCCCAGGAGCCCTCAGTGAGGG + Intronic
1118974858 14:70667780-70667802 GTCCCAGGAGCCACCAGAGCAGG - Intronic
1119351451 14:73969124-73969146 GCCCCAGGGGCACACACACATGG - Intronic
1119400160 14:74357689-74357711 GTCCCAGGAGCACCGGCAGAAGG + Exonic
1119406354 14:74401993-74402015 GTCCCTGAACCCCACTCAGAAGG - Intergenic
1121016543 14:90552610-90552632 GGTCCAGGAACCCACACAGAAGG + Intronic
1121484712 14:94305804-94305826 ATCCCACCAGACCACACAGAGGG - Intronic
1122706270 14:103624111-103624133 GTCCCAGGGGACCGCCCAGACGG + Intronic
1122886680 14:104713388-104713410 GACCCTGGAGCCCACCTAGAGGG - Intronic
1123460339 15:20464709-20464731 ATCCCAAAAGCCCACACACAAGG + Intergenic
1123657723 15:22535708-22535730 ATCCCAAAAGCCCACACACAAGG - Intergenic
1123976349 15:25558038-25558060 GTCCCAGTAGCATGCACAGAGGG + Intergenic
1124269755 15:28269760-28269782 ATCCCAAAAGCCCACACACAAGG + Intronic
1124311632 15:28630906-28630928 ATCCCAAAAGCCCACACACAAGG - Intergenic
1124438530 15:29670692-29670714 CTCCAAGGAGCCTACACAAAGGG + Intergenic
1124569405 15:30848377-30848399 GTCCCCAGAGCTCACACAGCAGG + Intergenic
1125408998 15:39385032-39385054 GACACAGGCGCACACACAGAGGG + Intergenic
1126775067 15:52093540-52093562 GTTCCAGCAGCCCAAAGAGAGGG - Intergenic
1128528846 15:68430991-68431013 GGGCCTGGAGCCCACGCAGAAGG + Intronic
1128791663 15:70438899-70438921 CTCCCTGGAGCCCACCCAGCTGG + Intergenic
1129790260 15:78336445-78336467 TTCCCAGGTGGCCACATAGAAGG - Intergenic
1129881489 15:79009575-79009597 GTGGCAGGAGCCCACAGAGAAGG - Intronic
1132176601 15:99720858-99720880 GACCCAGGATGCAACACAGAAGG - Intronic
1132626367 16:893575-893597 GCCCCAGGAGTCCTCACAGCAGG - Intronic
1132665269 16:1078612-1078634 GCCCCGGGAGCCCAGACGGACGG - Intergenic
1133269173 16:4602261-4602283 GTCCCACCTCCCCACACAGAAGG - Intergenic
1135401702 16:22170589-22170611 CTCCCAGGGGCCCACAGAGCAGG + Intronic
1136023254 16:27453490-27453512 GACCCAGGTGCCCAGGCAGATGG - Intergenic
1136573970 16:31112373-31112395 GTCTCAGGGACCCAGACAGATGG + Exonic
1136686669 16:31999009-31999031 GTCCAAGGAAGCCCCACAGAAGG + Intergenic
1136704753 16:32177885-32177907 ATCCCAAAAGCCCACACACAAGG + Intergenic
1136735223 16:32461278-32461300 GTCACAGGAGGACACCCAGAAGG - Intergenic
1136763160 16:32751522-32751544 ATCCCAAAAGCCCACACACAAGG - Intergenic
1136787282 16:32942546-32942568 GTCCAAGGAAGCCCCACAGAAGG + Intergenic
1136804940 16:33118864-33118886 ATCCCAAAAGCCCACACACAAGG + Intergenic
1139517997 16:67463147-67463169 ATCCCACGAGCCCAAACACAGGG - Intronic
1203017857 16_KI270728v1_random:368315-368337 GTCACAGGAGGACACCCAGAAGG + Intergenic
1203036192 16_KI270728v1_random:641473-641495 GTCACAGGAGGACACCCAGAAGG + Intergenic
1203065312 16_KI270728v1_random:1011844-1011866 ATCCCAAAAGCCCACACACAAGG - Intergenic
1203089515 16_KI270728v1_random:1204218-1204240 GTCCAAGGAAGCCCCACAGAAGG + Intergenic
1143587693 17:7858803-7858825 GTCGCAGGAGCACACACTGGAGG + Exonic
1145207331 17:20991545-20991567 GTCCCAGGAGCCCGCCTGGATGG + Intergenic
1145257872 17:21337483-21337505 GGCCCAGGAGACCCCAGAGAGGG - Intergenic
1145294609 17:21578342-21578364 GTTCCAGGTGCCCACAGAGGTGG - Intergenic
1145369226 17:22294832-22294854 GTTCCAGGTGCCCACAGAGGTGG + Intergenic
1145416429 17:22717179-22717201 GCTGCAGGAGCCCACTCAGATGG - Intergenic
1145788816 17:27611457-27611479 GGCCCAGGAGCTCACAGACATGG + Intronic
1147961412 17:44169966-44169988 GAGCCAGGACCCCACATAGATGG - Intergenic
1148240620 17:45997417-45997439 CTACCAGGAGCACACACAGAGGG - Intronic
1148443569 17:47724563-47724585 GACCCAGGTGCCCACTCAGCTGG + Intergenic
1152888041 17:82864133-82864155 GTCCCAGGCCACAACACAGATGG - Intronic
1152952935 18:11610-11632 GTCGCAGGAGGACACCCAGAAGG + Intergenic
1155111081 18:22715277-22715299 GTCCCAGGAGCCCGAGAAGATGG - Intergenic
1157688824 18:49664387-49664409 CTCCCGGGAGCCGGCACAGAGGG + Intergenic
1157762530 18:50275128-50275150 GTCCCCAGAGCCCACAGAGCCGG - Exonic
1159452817 18:68624085-68624107 GTCCCGGGAGCCCAGTCAGTGGG - Intergenic
1160081000 18:75727037-75727059 GTCCCAGGAGCACAGGGAGAGGG - Intergenic
1160115894 18:76079104-76079126 GTCCCAGAAGCCCAGGCTGAAGG + Intergenic
1160860680 19:1236205-1236227 GGAGCAGGAGCCCACACAGGGGG + Intronic
1160892844 19:1388251-1388273 GTCCCAGGATCATCCACAGAAGG - Intronic
1161511567 19:4675113-4675135 ACCCCAGGAGTCCCCACAGATGG + Intergenic
1161823094 19:6543392-6543414 GTTCCAGGAGCCCCCAGAGGGGG + Intergenic
1162227456 19:9235557-9235579 GAACCAGGAGGCCACAGAGATGG - Intergenic
1162411723 19:10510279-10510301 GCCCCTGGAGGCCACACACACGG - Intergenic
1162520866 19:11178604-11178626 CACCCAGGAGCCCACCCACAGGG - Exonic
1163152268 19:15422518-15422540 GCCCCAGCAGGCCCCACAGAGGG + Exonic
1165329664 19:35134546-35134568 GTCCGGGGAGCCCTCACACAGGG + Exonic
1165445575 19:35855335-35855357 GTCCCAGGAGCATGCAGAGAAGG - Intronic
1167315106 19:48758144-48758166 GTCCGAGGAGCCCACATCGGGGG - Exonic
1167499366 19:49836615-49836637 ATCCCAGGAGCACACACAGGAGG - Intronic
1167707968 19:51093102-51093124 GCCCCAGGAGAGCACACAGGTGG + Intergenic
1168656322 19:58131323-58131345 ATCACTTGAGCCCACACAGAAGG + Intronic
1168725847 19:58581570-58581592 TTCCCAGGAGGCCACACTGCAGG + Intergenic
925128946 2:1481010-1481032 ATCCCAGGAACCAGCACAGAGGG - Intronic
927357107 2:22186581-22186603 CGCACAGGAGCCCACAGAGAGGG - Intergenic
929758062 2:44784661-44784683 GGGCGAGGAGCCCAGACAGAGGG + Intergenic
930029922 2:47052116-47052138 GTCCTGAGAGGCCACACAGATGG + Intronic
931691505 2:64838156-64838178 TTAGCAGGAGCCCACACTGACGG + Intergenic
931700499 2:64905133-64905155 GTCCTAGGAGACAACACAGCAGG + Intergenic
932233689 2:70103710-70103732 GGCCAAGAAGCCCACCCAGATGG - Intergenic
932842078 2:75092731-75092753 CTCCCAGGAGCTTTCACAGATGG - Intronic
932934448 2:76085851-76085873 GTCCCAGGAGACAACATGGAAGG + Intergenic
934310548 2:91858445-91858467 GTCACAGGAGGACACCCAGAAGG + Intergenic
934559484 2:95305362-95305384 GTTGCAGGAGCTCACAAAGAGGG + Intronic
934945090 2:98534999-98535021 GCCCCAGCAGCCCACCCAGGTGG + Intronic
935796695 2:106648638-106648660 ATCCCAGGCACCCACACAGCAGG - Intergenic
937605250 2:123792781-123792803 GACACAGAAGCCCACAAAGACGG - Intergenic
938496837 2:131802134-131802156 GTCGCAGGAGGACACCCAGAAGG - Intergenic
938577986 2:132621409-132621431 GTCTCAGCAGACCACACAGAGGG + Intronic
939147325 2:138431654-138431676 TGCCCAGGGTCCCACACAGATGG + Intergenic
941226919 2:162861951-162861973 GTCCCAGGAACATACACAAATGG + Intergenic
942427941 2:175879106-175879128 GTCACAGGAGCTCAAAAAGATGG - Intergenic
943667785 2:190628323-190628345 GTTCTAGGTGCCCACAGAGAGGG + Intergenic
945502412 2:210592465-210592487 GTCCCAGAGACCCACCCAGATGG - Intronic
948284451 2:236772987-236773009 ATGCCAGGAGCCCCCACAGCTGG - Intergenic
948284858 2:236776162-236776184 CTTCCAGGAGCCCACTCAGATGG - Intergenic
948632735 2:239312408-239312430 GGCCCAGGAGCCCACACGCAGGG + Intronic
1169760556 20:9087887-9087909 GTCCAGGCAGCCCACTCAGATGG + Intronic
1169786842 20:9368592-9368614 GGCCCAGCAGCCCACGAAGAAGG + Intronic
1170648697 20:18219674-18219696 GTCAGAGGAGCGCACAGAGAGGG - Intergenic
1171897478 20:30822121-30822143 ATGCCAAAAGCCCACACAGATGG - Intergenic
1172299834 20:33841588-33841610 GTCCCAGGCACCCTCACACAGGG + Intronic
1173393324 20:42654691-42654713 CTCACAGGAGCCCACTGAGATGG + Intronic
1173422988 20:42919120-42919142 GTCCCTGGTGCCTACAGAGAAGG - Intronic
1173544233 20:43880965-43880987 GACCCAGAAGCCCACATCGATGG + Intergenic
1173822451 20:46028436-46028458 GTCCCTGGAGCCCACAGCCAGGG - Intronic
1174096382 20:48092765-48092787 CGCCAAGCAGCCCACACAGATGG - Intergenic
1175983493 20:62752984-62753006 CTCTCAGGAGCCCACACAGGTGG + Intronic
1176044227 20:63084085-63084107 GTTCCCGGAGCCCCAACAGAGGG + Intergenic
1176058977 20:63163820-63163842 GTCACAGCAGCTCAGACAGAGGG + Intergenic
1176172186 20:63701024-63701046 GTCCCAGGGGCCCACACAGCCGG + Intronic
1179790527 21:43753643-43753665 GTCCCCAGTGCCCACAAAGACGG - Exonic
1180049339 21:45324198-45324220 GCCCCAGGACCCCACACAGGTGG + Intergenic
1180253949 21:46609666-46609688 ATCCCAGGAGCCCATAGACATGG - Intergenic
1181003421 22:19998499-19998521 GCCCCAGCTGCCCACCCAGAAGG + Intronic
1181468969 22:23126503-23126525 GACCCTGGAGCCCTGACAGATGG - Intronic
1182270406 22:29149741-29149763 GTCCCCAGAGTCCACTCAGATGG - Intronic
1182991507 22:34772100-34772122 CTCCTAGGAGCTCACAGAGAAGG - Intergenic
1183138352 22:35912338-35912360 TTCTCAGGAGCTCAAACAGATGG + Intronic
1183421452 22:37713940-37713962 GTCCCAGGAGACCCCCCAAAAGG + Intronic
1184456094 22:44610115-44610137 GACCAAGGAGCCCACCCAGCTGG + Intergenic
1184762084 22:46550495-46550517 CCTCCAGGAGCCCACCCAGACGG - Intergenic
1184992584 22:48180733-48180755 GCCCCAGAAGCCCACATGGATGG - Intergenic
949452042 3:4196672-4196694 GACCCAGGAGGCCAGAGAGAGGG - Intronic
949906441 3:8862590-8862612 CTCCCAGGAGCCCTCGCAGCTGG + Intronic
950421165 3:12900822-12900844 GCCCCAGGAGCCCACAGGGCTGG - Intronic
950470199 3:13179999-13180021 CTCACAGGAGCCCACGGAGAGGG - Intergenic
950829324 3:15859294-15859316 GTCCCAGCGGCCCACACCGCCGG + Intronic
953373928 3:42412925-42412947 GTGCTAGGGGCCCAGACAGATGG - Intergenic
953498737 3:43412414-43412436 ATCCCAGGTGCCCACTCTGAGGG + Intronic
954325316 3:49860322-49860344 GTCCCTGGATGCCACATAGAAGG - Intronic
957039728 3:75327861-75327883 ACCCCAAAAGCCCACACAGATGG + Intergenic
958419910 3:93917868-93917890 GGCACAGGAGCCCACAGAGGCGG - Intronic
961641499 3:128367532-128367554 GGCACAGGAGTCCACACAGCAGG - Intronic
961843190 3:129735924-129735946 GTTCCAGGAGTCCCCCCAGAAGG - Intronic
963274578 3:143317357-143317379 CTCCCAGGAGCCCACACCAAAGG + Intronic
965081674 3:164040869-164040891 GGCCAAGCAGCCCACACAAAAGG + Intergenic
965316598 3:167199153-167199175 GTCCCAGTTGCCCACAAAGGTGG - Intergenic
966650925 3:182300166-182300188 GTTTCAGGAGTTCACACAGAGGG - Intergenic
968441946 4:628706-628728 GTCCCAGGAGCCACCATGGAGGG + Intronic
968725891 4:2247666-2247688 GTCCCAGGTTCCCTGACAGAGGG + Exonic
968784248 4:2607751-2607773 GTCCGAGGACCCCATTCAGATGG - Intronic
969061735 4:4440995-4441017 TTCCAAGGAGGCCACACACATGG + Intronic
969210528 4:5683769-5683791 GGCCCAGGAACACACACAGCTGG + Intronic
969579747 4:8057862-8057884 ATCCCTGGAGGCCACACAGAGGG + Intronic
970614589 4:17756298-17756320 GACTCAGGAGCCAACACTGAAGG + Intronic
971349463 4:25843327-25843349 GTGCCAGGAGTCCAGACAGGAGG + Intronic
974443851 4:61953746-61953768 GACCCAGGAGTCCTCAGAGAGGG + Intronic
976443120 4:85099381-85099403 CACCAAGGAGCACACACAGATGG - Intergenic
982864265 4:160490263-160490285 GTTCCTGGATCCCAAACAGAAGG - Intergenic
985313026 4:188624530-188624552 GTCCCAGAAGCCTAAACACAGGG + Intergenic
986346490 5:6840236-6840258 GTCCCAGGGGCCCTCACACAAGG - Intergenic
986534190 5:8769328-8769350 GGCCGAGAAGCCCAAACAGAAGG - Intergenic
992524153 5:77590421-77590443 GCCCCAAGGGACCACACAGATGG + Intronic
992659635 5:78945662-78945684 GACCCAGGGGTCCACTCAGAAGG - Intronic
995005998 5:107196083-107196105 GCCCCAGGCTCTCACACAGAGGG + Intergenic
996465871 5:123802033-123802055 GTCCAACAAGCCCACACCGATGG - Intergenic
999326634 5:150648238-150648260 GTCCCCAGAGCCCCGACAGAGGG + Exonic
1001446246 5:171786084-171786106 GTCCCTGGATCCCACTCTGATGG + Intronic
1001906357 5:175476852-175476874 GTGCCATGAGAACACACAGAAGG - Intergenic
1003396676 6:5759303-5759325 GTGCCATGAGGCCACACAAAAGG - Intronic
1003411345 6:5865581-5865603 GACCCTTGAGCCCACACACACGG + Intergenic
1004076515 6:12348691-12348713 GCCCAAGGAGACCACACAGGTGG - Intergenic
1004235507 6:13871998-13872020 GGCACAGGAGCCCACGGAGAGGG + Intergenic
1004693285 6:18011309-18011331 GGCACAGGAGCCCACAGAGTTGG + Intergenic
1004945077 6:20603489-20603511 ATCCCAGGAGACCATACACATGG - Intronic
1006148129 6:31971339-31971361 GTTCCAGGAGCCAGCACAGCAGG + Exonic
1007599531 6:43073173-43073195 CTACAAGGATCCCACACAGATGG - Intronic
1008953918 6:57192963-57192985 GTGGCAGGAGGCTACACAGAAGG + Intronic
1009958626 6:70489880-70489902 GTCGCAGGAGCCCAACCACAAGG + Intronic
1010453238 6:76026539-76026561 GTCCAAGGGTCCCACACAGCTGG + Intronic
1011546141 6:88483494-88483516 GGCCCTGGGGCCCACAGAGAGGG + Intergenic
1015490642 6:133821566-133821588 GTTCCAGGAAACCAGACAGAGGG + Intergenic
1015788347 6:136941305-136941327 CTCCCACCAGCCCACACATAGGG - Intergenic
1016393821 6:143601695-143601717 GACCCAGGAGTCCACACAGATGG - Intronic
1017176214 6:151507115-151507137 GGATCTGGAGCCCACACAGAGGG + Intronic
1017826918 6:158088548-158088570 GTCCCAGCAGACCACAGACACGG - Intronic
1019083893 6:169456460-169456482 GTCCCAGGAGTCCTCACATGGGG + Intergenic
1019267660 7:127424-127446 GACCCAGTCGCCCACCCAGACGG - Intergenic
1019489469 7:1305167-1305189 GTCCCAGGACCCCACGCCGCAGG - Intergenic
1019944227 7:4314014-4314036 GGCACAGGAGCCCACGGAGAGGG + Intergenic
1023027242 7:36061901-36061923 GTCCCAGAAACCCAGAAAGAGGG + Intergenic
1023970719 7:44988759-44988781 GTCCCAGTTTCCCACACAGCTGG - Intergenic
1027266973 7:76499825-76499847 GTGGCAGGAGCCCACCCTGACGG - Intronic
1027318788 7:76999693-76999715 GTGGCAGGAGCCCACCCTGACGG - Intergenic
1027698245 7:81437166-81437188 GGCACAGGAGCCCACGGAGAGGG + Intergenic
1029381907 7:100220408-100220430 CTCCCAGGAGCCCTCAGGGAAGG - Exonic
1029402071 7:100352858-100352880 CTCCCAGGAGCCCTCAGGGAAGG - Exonic
1031400798 7:121324328-121324350 GTCTCTGGAGTCCACATAGAGGG - Intergenic
1032169887 7:129575934-129575956 GCCTCAGGAGCCCAAAAAGAAGG + Intergenic
1034501240 7:151452258-151452280 CTCCCAGGAGCCCAGCCTGAGGG - Intergenic
1035569536 8:662957-662979 TTCCCAGGAGGCCACACATGAGG - Intronic
1035597081 8:866647-866669 CTCCCAGGAGCCGTCACAGGTGG - Intergenic
1039901765 8:41757844-41757866 GGCCCAGGGCCCCACAGAGAAGG - Intronic
1040351307 8:46571808-46571830 GGCACAGGAGCCCACAGAGTGGG - Intergenic
1043346496 8:79303778-79303800 GGCACAGGAGCCCACGGAGAGGG - Intergenic
1044884177 8:96759122-96759144 GTCCCAGGAGACAAGACAGGTGG - Intronic
1045107336 8:98905622-98905644 GCCCCAGGAGGCCACAGAGCAGG - Intronic
1047198496 8:122743341-122743363 GTGCCAGGAGAGCACAGAGAAGG + Intergenic
1048340441 8:133534615-133534637 GGACCAGGAGCCCACAGACATGG + Intronic
1048944134 8:139428815-139428837 GTCCCTGGAGCTGGCACAGAGGG - Intergenic
1049044146 8:140136311-140136333 GCAGCAGGAGCCCACACAGGAGG + Intronic
1049342189 8:142119039-142119061 AGCCAAGGAGCCCACATAGAAGG - Intergenic
1049385127 8:142339351-142339373 GGCCCAGGCGACCACAGAGATGG + Intronic
1049443107 8:142618115-142618137 CTCCACGCAGCCCACACAGAAGG - Intergenic
1049684400 8:143933585-143933607 GGCCCAGGACCCCACAGACATGG - Intronic
1049757829 8:144318642-144318664 CTCCCAGGAGCGCACACAGCAGG + Intronic
1054255539 9:62808280-62808302 GTGCCAAAAGCGCACACAGATGG - Intergenic
1055144289 9:72914000-72914022 GTCCCAGGTGTCCAGAAAGAAGG - Intronic
1055334513 9:75219604-75219626 GACACACGAGCCCACACATATGG - Intergenic
1058875395 9:109239778-109239800 TTTCCAGGAGCCCACAGATAAGG + Intronic
1060732977 9:126049705-126049727 GTCCCAGGATCCCCCAGCGAGGG + Intergenic
1060814542 9:126627656-126627678 GTCACTGGAGGCCACGCAGAAGG - Intronic
1061080342 9:128365946-128365968 GTTCAAGGAGACCACATAGAGGG - Intergenic
1061430430 9:130527258-130527280 GTCCAAGGAGCCAAAACACAGGG + Intergenic
1061444909 9:130632250-130632272 GTGGCAGCAGCCCACACAGCAGG + Exonic
1061923835 9:133796509-133796531 CTCCCAGGAGTGCACACTGAAGG - Exonic
1062208580 9:135350752-135350774 GTCTCAGGAGCCCAAATGGAGGG + Intergenic
1062592886 9:137281888-137281910 GTCCCAGGAGCCCACACAGAGGG + Exonic
1062626835 9:137447094-137447116 GGCCCAGGAGCAGACATAGAAGG - Intergenic
1062696165 9:137877522-137877544 GTCCCCGGAGCCCACTCTGCCGG - Intergenic
1203784776 EBV:121540-121562 TTCACAGGAGACCACACAGGCGG + Intergenic
1186309131 X:8298384-8298406 CTCCCAGTTGCCCACACAAAAGG - Intergenic
1187171308 X:16854792-16854814 GTCACAGCAGCCCACAAATAAGG + Intronic
1189234950 X:39479569-39479591 GGCCCAGGAAGCCACACATAGGG - Intergenic
1190630371 X:52380361-52380383 GTCCCAGGATCCCTTGCAGAGGG - Intergenic
1199886256 X:152024675-152024697 GTCTCAGGAGGTCAGACAGAAGG - Intergenic
1200048910 X:153418119-153418141 GCCCCAGGAAGCCATACAGAAGG + Intergenic