ID: 1062598008

View in Genome Browser
Species Human (GRCh38)
Location 9:137307730-137307752
Sequence GGCTGAGCACAGTCACCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 193}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062598004_1062598008 4 Left 1062598004 9:137307703-137307725 CCAGCGGGGTCCATGACGCAGCC 0: 1
1: 0
2: 0
3: 8
4: 63
Right 1062598008 9:137307730-137307752 GGCTGAGCACAGTCACCTCATGG 0: 1
1: 0
2: 0
3: 15
4: 193
1062598000_1062598008 25 Left 1062598000 9:137307682-137307704 CCTAGGGATGGGGCTTGGCAGCC 0: 1
1: 0
2: 4
3: 31
4: 308
Right 1062598008 9:137307730-137307752 GGCTGAGCACAGTCACCTCATGG 0: 1
1: 0
2: 0
3: 15
4: 193
1062598006_1062598008 -6 Left 1062598006 9:137307713-137307735 CCATGACGCAGCCATGCGGCTGA 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1062598008 9:137307730-137307752 GGCTGAGCACAGTCACCTCATGG 0: 1
1: 0
2: 0
3: 15
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062598008 Original CRISPR GGCTGAGCACAGTCACCTCA TGG Intronic
900415784 1:2534021-2534043 CACTGAGCACAGTGTCCTCAAGG - Intergenic
900828775 1:4949098-4949120 GGCTGAGGACAGGCATCTGAGGG + Intergenic
901627075 1:10630463-10630485 GGCTGGGGACAGGCACCTGACGG - Exonic
901630543 1:10646041-10646063 GGCACAGGACAGTCACCTCCTGG - Intronic
902718664 1:18290041-18290063 AGCTGGACACAGTCAACTCAGGG + Intronic
904486585 1:30828793-30828815 GGCTGAGCAAAGTGCCCACAAGG - Intergenic
907240643 1:53079150-53079172 GGCTGAGCTCATTCACCTTCAGG + Intronic
910742834 1:90539752-90539774 CGCTTAGCATAGTGACCTCAAGG + Intergenic
913655976 1:120960057-120960079 GGCTGAGTACAGGCAACTGATGG - Intergenic
914520532 1:148411289-148411311 GGCTGAGTACAGGCAACTGATGG - Intergenic
919796740 1:201325496-201325518 GGAAGAGCACTGCCACCTCATGG + Intronic
922597163 1:226822974-226822996 GGATGAGCCCCCTCACCTCAAGG + Intergenic
922727358 1:227928622-227928644 GGCAGACCACAGGCACCACAGGG + Intronic
923338281 1:232987962-232987984 GGCTGAGCACACTCATCCCAGGG - Intronic
1063202470 10:3797184-3797206 ATCTGAGCACAGACATCTCAGGG + Intergenic
1066638920 10:37536035-37536057 GGATGAGCACAGTCAGCATATGG + Intergenic
1066808333 10:39288295-39288317 TGCTGTGCACATTCTCCTCAGGG - Intergenic
1067698545 10:48552579-48552601 GGCTGAGCACAGTTACCTGGGGG - Intronic
1067735178 10:48845114-48845136 GGCTGGGCACAGACACCCCTTGG + Intronic
1067830512 10:49609154-49609176 AGCTGAGCACGGGCGCCTCAAGG + Intronic
1069592805 10:69652425-69652447 GGCCGGGCAGAGTCACCTGATGG + Intergenic
1070361741 10:75697107-75697129 TGTTCAGCAGAGTCACCTCAAGG + Intronic
1073346815 10:102789343-102789365 AGCTGAGTACAGTGATCTCAGGG - Intronic
1074430016 10:113386475-113386497 GGCTGAACCCAGTCACCCCAGGG - Intergenic
1074432950 10:113409022-113409044 GGCTGAGGACAGGCAACTCCAGG - Intergenic
1075557741 10:123445532-123445554 GTCTGAGGTCAGTCAGCTCACGG - Intergenic
1076189156 10:128470576-128470598 TGCTGAGCGCAGGCACCCCAGGG + Intergenic
1076536527 10:131181331-131181353 TGCTGAGCACAGACACCCCCGGG - Intronic
1077550220 11:3196892-3196914 GGCTGAGCTCAGGCAGCTCAGGG + Intergenic
1081335694 11:41863538-41863560 GGCTGAGCACAGGCAGTCCATGG + Intergenic
1081800101 11:45852582-45852604 GGCTCAGGACAGCCACCACACGG - Intronic
1082304756 11:50558197-50558219 TGATGTGCACATTCACCTCATGG - Intergenic
1082587531 11:54960552-54960574 GGATGTGCACATTCATCTCACGG + Intergenic
1083068943 11:59956294-59956316 GGCTGAGGACATTTGCCTCAGGG + Intergenic
1083627217 11:64077941-64077963 GGCTGAGCACGGGCCCATCAGGG - Intronic
1085468402 11:76739702-76739724 GTGTGAGCAGAGTCGCCTCAGGG - Intergenic
1088683289 11:112263684-112263706 CACTGAGCACAGTCATTTCAAGG - Intronic
1089686188 11:120148191-120148213 GGCTCAGGACAGACACCCCAAGG - Intronic
1090593244 11:128294055-128294077 GGCTGAGCCCTCTCACCGCAAGG + Intergenic
1095742596 12:45623356-45623378 GGCTGAGATCAATCAACTCACGG - Intergenic
1096718832 12:53506553-53506575 GGCTGGGCACAGTGGCCTCGTGG + Intergenic
1098461475 12:70737161-70737183 GGCTCAGCCCCCTCACCTCAAGG + Intronic
1101334022 12:103780241-103780263 GGCTGAGCACAGCCAGAACAGGG + Intronic
1103640344 12:122346420-122346442 GGCTAAGCACAATGAGCTCAGGG + Intronic
1106555484 13:30804770-30804792 GGCTGGGCACCGTCTCCTCTGGG + Intergenic
1107168949 13:37317097-37317119 GGCAGGGCACACTCACATCAGGG + Intergenic
1112166975 13:96930533-96930555 GGGTGAGCACAGTGACCTAATGG - Intergenic
1113998984 14:16127523-16127545 TGATGTGCACATTCACCTCATGG - Intergenic
1115467294 14:33729532-33729554 GCCGGAGCACAGTCATCTGAAGG + Intronic
1116134263 14:40900626-40900648 AGCTGAGAACAGTCACTTCCAGG + Intergenic
1118221227 14:63856135-63856157 GGCTGAGCACTGTCAAGTTAAGG + Intronic
1118500263 14:66355796-66355818 GGCTCTGCACAGTCTCGTCAAGG - Intergenic
1119465310 14:74853175-74853197 GACTGAGCCAAGTCACCTCCAGG - Exonic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1121237313 14:92401753-92401775 GGCTGGGCAGACACACCTCAGGG - Intronic
1121274067 14:92656114-92656136 GGCTGACCACAGTTTCCTCTGGG - Intronic
1122928976 14:104924727-104924749 GGCTGAGAACCTTCACCTCCAGG - Intergenic
1123059510 14:105588092-105588114 GGCAGGGCACAGTCACATCCTGG + Intergenic
1123083845 14:105708362-105708384 GGCAGGGCACAGTCACATCCTGG + Intergenic
1123152451 14:106196289-106196311 GACTCAGGACAGTAACCTCAAGG - Intergenic
1123172615 14:106388987-106389009 GACTCAGGACAGTAACCTCAAGG - Intergenic
1124411492 15:29441172-29441194 TGCTCAGCACAGTGTCCTCAGGG - Intronic
1126385230 15:48087434-48087456 TACTGAGCACAGTCACTGCATGG + Intergenic
1128897553 15:71389408-71389430 CACTTAGCACAATCACCTCAAGG + Intronic
1129659622 15:77545794-77545816 GACTTAGAACAGCCACCTCAGGG - Intergenic
1130379657 15:83360479-83360501 GTCTGAGAACAGTCAACACATGG + Intergenic
1131357473 15:91758228-91758250 GGTTGAGCACAGTGACCCAAGGG + Intergenic
1131432335 15:92396704-92396726 GGCTGGTCTCAATCACCTCAGGG + Intronic
1131780819 15:95856857-95856879 GGCTGGGTCCAGTCACCTTAAGG - Intergenic
1133040892 16:3059283-3059305 CGCTGGGCTCAGTCTCCTCAGGG + Exonic
1133216351 16:4294582-4294604 GCCTTTGCACAGGCACCTCAGGG + Intergenic
1134051793 16:11142399-11142421 GGCCAAGCACAGGCACCTCCAGG - Intronic
1137249981 16:46734277-46734299 CACTGAGCACAGTGTCCTCAGGG - Intronic
1140551383 16:75869906-75869928 GACTGAGCACAGGTTCCTCATGG - Intergenic
1142059314 16:88019441-88019463 GGCTCTGGAGAGTCACCTCAGGG + Intronic
1203147183 16_KI270728v1_random:1809679-1809701 GGCAGACCACTGTCAGCTCAGGG + Intergenic
1142803999 17:2362135-2362157 GGCTGAGCCCTGTCTCCGCAGGG - Exonic
1143130294 17:4673234-4673256 GGCCCATCACAGTTACCTCAAGG + Exonic
1145254567 17:21315587-21315609 GGCTGGACACGGTGACCTCATGG + Intergenic
1145322029 17:21772377-21772399 GGCTGGACACGGTGACCTCATGG - Intergenic
1145978301 17:28996879-28996901 GGCTTAGCCCTGTCAACTCAAGG - Intronic
1146548471 17:33759669-33759691 TGCTGCTCAGAGTCACCTCAGGG + Intronic
1150878005 17:68991415-68991437 TACTGAGCACAGTCACTTCTTGG + Intronic
1151350488 17:73528943-73528965 GGCAGAGCTCAGGGACCTCAAGG - Intronic
1152251850 17:79216541-79216563 GGCTGAGCCCAGTCTCCTGCAGG + Intronic
1152610683 17:81313829-81313851 GGCTCAGCACAGTCCCCCCAAGG + Exonic
1152938368 17:83153262-83153284 GCCTGAGCTCCGCCACCTCATGG + Intergenic
1154140973 18:11823987-11824009 AGTTGAGCACAGTGACCTCATGG + Intronic
1155558444 18:27048628-27048650 AGCTGAGCCCAGTCATCTCTAGG - Intronic
1157195780 18:45619227-45619249 AGCTGAGCCCAGTCTCCCCAGGG + Intronic
1157333519 18:46720767-46720789 GGCTGAGCACACTCATTGCAGGG - Intronic
1157454646 18:47815089-47815111 GGGTGAGAACAGTCATCTCCAGG - Exonic
1160578193 18:79868986-79869008 GGCTGAGTCCAGCCACCACACGG + Intronic
1160595792 18:79973233-79973255 GCCTGAGCAGATTCCCCTCACGG + Exonic
1160682282 19:417307-417329 GGCTGAGAACGGTCACCTGCGGG + Exonic
1161591800 19:5132301-5132323 GGCTGAGCACAGGCCTCTCCAGG + Intronic
1162044279 19:7988346-7988368 CGGTGGGCAGAGTCACCTCATGG - Intronic
1163574778 19:18104312-18104334 GTCTGAGGACAGACAACTCACGG - Intronic
1163663305 19:18591204-18591226 GGCTGAGGACAGGCATCTGAAGG - Intronic
1165490251 19:36119324-36119346 GGCTTAGGCCAGACACCTCAGGG + Intronic
1167054004 19:47097441-47097463 TTCTGTCCACAGTCACCTCAAGG + Intronic
1168160603 19:54508147-54508169 GTCTGAGCACAGTGACTTCCTGG + Exonic
1168250519 19:55138928-55138950 GGCTGAGCCCCGTCTCCTTATGG + Intronic
925773249 2:7305141-7305163 GGCAGAGCTCAGTCAACCCATGG - Intergenic
929469649 2:42178820-42178842 GGCTGAGCACTTACACCTAAGGG + Intronic
929899665 2:45989572-45989594 GGCTCTGCACAGCCACCCCAAGG - Intronic
930060216 2:47282385-47282407 AGCTGAGAACAGTCTCCCCATGG - Intergenic
931811769 2:65861167-65861189 AGGTGAGCACAGTCACCCCGTGG - Intergenic
939671796 2:145022048-145022070 GGGTGTGCACAGTGACCTAATGG + Intergenic
942055917 2:172181946-172181968 GGCTGAGCACAGAGATCTCAGGG + Intergenic
945026124 2:205621445-205621467 GGCTGAGCCCAGGCATGTCACGG - Intergenic
948494551 2:238338901-238338923 GGCTGGGCACACCCACCACACGG - Intronic
1170072390 20:12382631-12382653 TGCTGGGCTCAGTTACCTCAGGG + Intergenic
1170581376 20:17702013-17702035 GGCTGATGACACCCACCTCATGG - Intronic
1172122952 20:32609360-32609382 GGCTCAGCCCAGTGACCTCCAGG + Intergenic
1173326254 20:42036397-42036419 GGCTGAAAATAGTAACCTCATGG - Intergenic
1175503617 20:59467148-59467170 GGCTGAGCCCAGCCTCCTTAAGG + Intergenic
1176151826 20:63595455-63595477 GGCTGATCCCAGACAACTCAGGG + Intronic
1177265769 21:18781393-18781415 GAATGAGCACAATCACCACAAGG - Intergenic
1179526503 21:41980359-41980381 GGCAGAGCTCAGTGACCTGATGG - Intergenic
1180767812 22:18356606-18356628 GGGTGAGCACAGTCATGTCCAGG - Intergenic
1180778496 22:18505784-18505806 GGGTGAGCACAGTCATGTCCAGG + Intergenic
1180811220 22:18763092-18763114 GGGTGAGCACAGTCATGTCCAGG + Intergenic
1180823903 22:18850266-18850288 GCATGAGCACAGTCACGTCCAGG + Intronic
1181197371 22:21197347-21197369 GGGTGAGCACAGTCATGTCCAGG + Intergenic
1181458959 22:23075091-23075113 GGCTGGTCACAGGGACCTCAAGG + Intronic
1181576794 22:23800459-23800481 TGCTGAGTAAAGTCATCTCACGG + Intronic
1184789415 22:46690113-46690135 GGATGAGGACAGCGACCTCAAGG - Exonic
1185149768 22:49157607-49157629 GGCTGTGGACAGCCACCCCAGGG + Intergenic
1203229428 22_KI270731v1_random:97488-97510 GGGTGAGCACAGTCATGTCCAGG - Intergenic
949343041 3:3050084-3050106 GGGTGAGCCTAATCACCTCATGG + Intronic
949502438 3:4693735-4693757 GGCTGGGCTCGCTCACCTCAGGG - Exonic
953574875 3:44104926-44104948 GGCTGTGAGCAGTCGCCTCATGG - Intergenic
956681383 3:71785032-71785054 GGCGCAGCACAGGCTCCTCATGG + Exonic
962821716 3:139054911-139054933 GCCTGGGCACAGAAACCTCATGG + Intronic
963830965 3:150008731-150008753 GGCTGAGAACAGGGAGCTCAGGG + Intronic
968292448 3:197549160-197549182 CCCTGTGCTCAGTCACCTCAGGG - Intronic
973711177 4:53631780-53631802 GGCTGCAAACAGTCACCCCAGGG + Intronic
976808267 4:89072556-89072578 GGCTGGGCAGAGGCACCGCAGGG + Intronic
979414984 4:120426031-120426053 TGCTGAGCACTGTCACCACATGG + Intergenic
979533499 4:121793902-121793924 GGCTGTCCATGGTCACCTCATGG + Intergenic
980861191 4:138501269-138501291 GGATGTTCAGAGTCACCTCAAGG - Intergenic
980982470 4:139666219-139666241 CTCAGAGCACAGTCGCCTCAGGG + Intronic
985342564 4:188970903-188970925 TGCTGGGCAAAGTCACCTAACGG + Intergenic
986792527 5:11176763-11176785 GGGTGAGCACAGTCAGGTTATGG - Intronic
992092423 5:73329150-73329172 GGCTGAACACAGTCAACAAAGGG + Intergenic
992392150 5:76339060-76339082 GTTTGAGCAGGGTCACCTCAAGG + Intronic
996689645 5:126326238-126326260 AACTGAGTACACTCACCTCAGGG - Intergenic
997474201 5:134133391-134133413 GGCTGGGCACAGTCACCATCAGG + Intronic
1000387528 5:160688830-160688852 AGCACAGCCCAGTCACCTCATGG - Exonic
1000604101 5:163309963-163309985 GGCTTTCCACTGTCACCTCAAGG + Intergenic
1001435844 5:171698708-171698730 GGCTGAGCTCTGCCACCTCCAGG - Intergenic
1001904997 5:175464639-175464661 GGCTGAGCTCAGTCACATTAGGG + Intergenic
1002049527 5:176562276-176562298 GGCTGAGGACAGTGTCCCCAGGG + Intronic
1002299454 5:178249049-178249071 GGGGGCACACAGTCACCTCAGGG + Intronic
1002523295 5:179803056-179803078 GGCAAAGTTCAGTCACCTCAGGG + Intronic
1004041118 6:11976655-11976677 GGCTGATCACAGTGCACTCAGGG - Intergenic
1004424752 6:15499718-15499740 GGCTGGGGACAGTTCCCTCATGG + Intronic
1005997179 6:30938593-30938615 AGCTGAGGACAGTCTGCTCACGG + Intergenic
1007352737 6:41285804-41285826 GTCTGAGCACAGGCTCTTCAAGG + Intronic
1008075152 6:47138236-47138258 GGCTGGGCTCAGTCACTTCCTGG - Intergenic
1013514501 6:110874031-110874053 GGCTGAGCACAGCAGCCTCCGGG - Intronic
1014268820 6:119313160-119313182 GGCTCTGCACTGTCACCTCTTGG - Intronic
1016306058 6:142684877-142684899 TGCTCAGCACAGTCCCCGCATGG + Intergenic
1016936429 6:149451718-149451740 CGCTGAGCACACTCATCCCAGGG + Intronic
1017634223 6:156427682-156427704 AGCTGAGCTCAGTCAACCCAGGG + Intergenic
1017669051 6:156752716-156752738 GGGTGAGCAGAGTGACCTCCAGG - Intergenic
1018720560 6:166568744-166568766 GGACAAGCACAGTCACCTCCAGG - Intronic
1021784371 7:24137478-24137500 GCCTGGGAACAGGCACCTCATGG + Intergenic
1022453082 7:30533962-30533984 GGCTGGGCACAGGCACCCCAGGG + Intronic
1023726429 7:43146812-43146834 GTCTGTGCACAGACAGCTCATGG + Intronic
1023979101 7:45055962-45055984 CGCTTAGCACAGTGCCCTCAAGG + Intronic
1023980655 7:45068142-45068164 CCCTGAGAACAGTCACCTCCAGG - Intronic
1024574925 7:50755610-50755632 GGCTGCGCACACTCTCCTCGCGG - Intronic
1027055483 7:75046611-75046633 GGCTGAGGGCAGTCTCCTCTTGG - Intronic
1028250911 7:88539457-88539479 GGCTGAGCTCAGACACCACCAGG - Intergenic
1029694109 7:102201889-102201911 GGCCGAGCGCAGTCAGCTCCAGG + Exonic
1033313744 7:140281223-140281245 GGCTAAGCACAGTCTCCCCAAGG + Intergenic
1035457124 7:159015895-159015917 GGCTGTCCCCAGACACCTCAAGG + Intergenic
1035785306 8:2255154-2255176 AGCTGAGCACAGGAAGCTCAGGG + Intergenic
1035807502 8:2466562-2466584 AGCTGAGCACAGGAAGCTCAGGG - Intergenic
1036620661 8:10422931-10422953 GGATGAGCACAGTCCCCTGAGGG + Intronic
1038690015 8:29752827-29752849 TGCTAAGGACAGTCAGCTCAGGG - Intergenic
1040478426 8:47801849-47801871 GGCAGAGAACTGTCACATCATGG - Intronic
1044269032 8:90218419-90218441 CACTTAGCACAGTCTCCTCAAGG + Intergenic
1045328328 8:101134001-101134023 GGCAGAGCTCAGAAACCTCAGGG + Intergenic
1045583266 8:103500964-103500986 GCCTGACCTCAGCCACCTCACGG + Intronic
1045815143 8:106270235-106270257 GGCTGAGCCCATTCACCTCGCGG + Intronic
1046023606 8:108695926-108695948 GGCAGAGCACAGGCACCAGAAGG - Intronic
1046292367 8:112179884-112179906 GGCTTAGCACCGTCTCCTGAGGG - Intergenic
1049753695 8:144298106-144298128 TGCTGACCACAGGCACCTCTTGG - Intronic
1050938522 9:11428285-11428307 AGCTGAGCACATTCAACTCTTGG + Intergenic
1051536380 9:18163254-18163276 GGCTGATAACAGACACCTCTTGG + Intergenic
1052847696 9:33351710-33351732 GGGTGACCACAGTCAGCTCTGGG - Exonic
1056961375 9:91126901-91126923 TGGTGAGGACAGGCACCTCAGGG - Intergenic
1056971480 9:91208554-91208576 GCCTGACCACAGCCACCGCAGGG + Intergenic
1057310585 9:93940603-93940625 GGCTGGGGACAGTCCCCCCATGG - Intergenic
1059442395 9:114315977-114315999 GGCTGAGCAAATTGTCCTCATGG - Intergenic
1059460057 9:114423967-114423989 GGCACAGCACAGTCACCTGGAGG + Intronic
1059767100 9:117393900-117393922 GGCTGAGAACAGGCCCATCAAGG + Intronic
1060749878 9:126162254-126162276 GGCTGAGAACTGCTACCTCAGGG + Intergenic
1061079719 9:128362564-128362586 GGTTGAACACAGTCACCCGAAGG + Intergenic
1062191814 9:135251732-135251754 GGCTGAGCACAGGGACCCCATGG - Intergenic
1062598008 9:137307730-137307752 GGCTGAGCACAGTCACCTCATGG + Intronic
1188640570 X:32497392-32497414 GTCTAAGGACAGTCACATCAAGG - Intronic
1189144227 X:38639248-38639270 GGATGACAACAGACACCTCAGGG - Intronic
1189243137 X:39541103-39541125 GGCATACCGCAGTCACCTCAGGG - Intergenic
1192524196 X:71827894-71827916 GGCTGACCCCTGTGACCTCAAGG - Intergenic
1196242426 X:113358024-113358046 GGCTGATTACACTCAACTCAGGG - Intergenic