ID: 1062600317

View in Genome Browser
Species Human (GRCh38)
Location 9:137316301-137316323
Sequence CGCCCGCGGCCTTCGCGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062600310_1062600317 8 Left 1062600310 9:137316270-137316292 CCCGGCGGAGATTCAAAAGCTAA 0: 1
1: 0
2: 0
3: 1
4: 78
Right 1062600317 9:137316301-137316323 CGCCCGCGGCCTTCGCGCGCCGG No data
1062600309_1062600317 20 Left 1062600309 9:137316258-137316280 CCACTCAGGGCGCCCGGCGGAGA 0: 1
1: 0
2: 0
3: 3
4: 81
Right 1062600317 9:137316301-137316323 CGCCCGCGGCCTTCGCGCGCCGG No data
1062600311_1062600317 7 Left 1062600311 9:137316271-137316293 CCGGCGGAGATTCAAAAGCTAAC 0: 1
1: 0
2: 0
3: 11
4: 65
Right 1062600317 9:137316301-137316323 CGCCCGCGGCCTTCGCGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062600317 Original CRISPR CGCCCGCGGCCTTCGCGCGC CGG Intronic
No off target data available for this crispr