ID: 1062605980

View in Genome Browser
Species Human (GRCh38)
Location 9:137349066-137349088
Sequence TCCCCAAGAATGCTGACAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062605972_1062605980 21 Left 1062605972 9:137349022-137349044 CCTTGTCTCCATGCAGGTCCTTG 0: 1
1: 0
2: 2
3: 14
4: 255
Right 1062605980 9:137349066-137349088 TCCCCAAGAATGCTGACAAACGG 0: 1
1: 0
2: 1
3: 17
4: 147
1062605969_1062605980 29 Left 1062605969 9:137349014-137349036 CCCAGTGGCCTTGTCTCCATGCA 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1062605980 9:137349066-137349088 TCCCCAAGAATGCTGACAAACGG 0: 1
1: 0
2: 1
3: 17
4: 147
1062605978_1062605980 3 Left 1062605978 9:137349040-137349062 CCTTGGTTTATGGACAGGGATCT 0: 1
1: 0
2: 1
3: 11
4: 130
Right 1062605980 9:137349066-137349088 TCCCCAAGAATGCTGACAAACGG 0: 1
1: 0
2: 1
3: 17
4: 147
1062605974_1062605980 13 Left 1062605974 9:137349030-137349052 CCATGCAGGTCCTTGGTTTATGG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1062605980 9:137349066-137349088 TCCCCAAGAATGCTGACAAACGG 0: 1
1: 0
2: 1
3: 17
4: 147
1062605970_1062605980 28 Left 1062605970 9:137349015-137349037 CCAGTGGCCTTGTCTCCATGCAG 0: 1
1: 0
2: 0
3: 17
4: 219
Right 1062605980 9:137349066-137349088 TCCCCAAGAATGCTGACAAACGG 0: 1
1: 0
2: 1
3: 17
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062605980 Original CRISPR TCCCCAAGAATGCTGACAAA CGG Intronic
901524973 1:9815211-9815233 TCCTCAGGAAAGCTGACCAAAGG + Intronic
902530994 1:17090640-17090662 TTCCCAATAATGCTGACACTGGG - Intronic
902989748 1:20178485-20178507 TCCACCAGAATGTTGCCAAAGGG - Intergenic
903845514 1:26277743-26277765 TTCCCAAGAAGGCTGGCACATGG - Exonic
905320675 1:37114608-37114630 TCCCCAAGTCTGCTGACCATGGG + Intergenic
907808919 1:57849175-57849197 TCCCCAGGAATGTTCACAAAAGG + Intronic
907955836 1:59227519-59227541 TCCCCAGGAAAGCTTACAAGAGG + Intergenic
909722826 1:78796328-78796350 TCCCCAGTAATAATGACAAATGG - Intergenic
912578598 1:110699591-110699613 TTGGCAAGAATGCTGAGAAAAGG + Intergenic
912768452 1:112438628-112438650 TCCCCTTGAAAGCTGGCAAAAGG - Intronic
916232826 1:162557126-162557148 TCCCCAAGGCTGCTTATAAAAGG + Intergenic
916469902 1:165113053-165113075 TCCCCAACAATGCTAAAAAATGG + Intergenic
916975278 1:170070947-170070969 TCCCAAAGAATAAAGACAAATGG + Intronic
917016172 1:170533173-170533195 TCCCCACAAACGCTAACAAAAGG - Intronic
918365143 1:183799587-183799609 TTCCAAAGAAGACTGACAAATGG - Intronic
920420011 1:205826702-205826724 CCCTTAAGAATGCTGTCAAATGG + Intergenic
920880503 1:209876010-209876032 TACCGAGGAAAGCTGACAAATGG + Intergenic
923484523 1:234416132-234416154 GCCCCAGGAATTCTCACAAAGGG - Intronic
923617191 1:235547760-235547782 GCTCCAAGAATGTTCACAAACGG + Exonic
924327520 1:242910663-242910685 CCACCAGGAATGCTGAAAAAGGG - Intergenic
924429138 1:243981720-243981742 CCCCCAAGAATTCTTTCAAAGGG + Intergenic
1063181857 10:3608796-3608818 TCTTTAAGAATGCTGACAATAGG - Intergenic
1063598559 10:7459849-7459871 TCCCCAATTATCTTGACAAATGG - Intergenic
1067365708 10:45626521-45626543 TACTCACTAATGCTGACAAAGGG - Exonic
1068474900 10:57512448-57512470 TCCCCAGGAATAGTGACAGATGG - Intergenic
1069446703 10:68479440-68479462 TCCTCCATAATGCTGACACAAGG + Exonic
1071238955 10:83682361-83682383 TCCCCAAAGATGCGGAGAAAAGG - Intergenic
1075495050 10:122912691-122912713 CCCCCAACAATTCTAACAAATGG + Intronic
1078331291 11:10424393-10424415 TCTTCAAGAATGCTGACTATTGG + Intronic
1079580166 11:22054448-22054470 TCTTCAAGAATGCTGACTATTGG + Intergenic
1082750902 11:57015861-57015883 TTGCCAAAAATGCTGACACAAGG + Intergenic
1085196114 11:74672837-74672859 TCCACAGAAATGATGACAAAGGG + Intergenic
1086781883 11:90917091-90917113 TCCCCAAGAATCCTGATTATGGG - Intergenic
1088883632 11:113990547-113990569 TTCCCAAAGCTGCTGACAAATGG - Intergenic
1089832801 11:121343605-121343627 TCCCCAAGAATGTTGACTCCAGG + Intergenic
1090166750 11:124557234-124557256 TCCTCAAAAATGCCCACAAATGG + Intergenic
1092166533 12:6346153-6346175 TCCCCAAAGATGGTGAGAAAGGG + Intergenic
1095623710 12:44288713-44288735 ACCCCAATAAAGCTGAAAAAGGG - Intronic
1095919026 12:47510628-47510650 TCACCAAGAAAGTTGACAACAGG + Intergenic
1096006967 12:48181310-48181332 TCCTCAAGAATAGTGGCAAAAGG + Intergenic
1097485091 12:60186846-60186868 TCCCATAGAATGCTCACAAACGG + Intergenic
1100911060 12:99364069-99364091 TCTCCAAGAATGCCCCCAAAAGG + Intronic
1100917585 12:99443316-99443338 TCCAGAAGAATGAAGACAAAAGG + Intronic
1105063070 12:133172000-133172022 TCCCCAAGATGGCTGACTAGAGG + Intronic
1106538999 13:30673698-30673720 TTCCCAACAATGCTCACAAACGG - Intergenic
1107535797 13:41329859-41329881 TAACCAAGAATCCTGACATATGG - Intronic
1107802545 13:44122706-44122728 TTCCCAAGAATGTTGACATCAGG + Intergenic
1107849415 13:44555877-44555899 TCTCCATGAATGCTGACACTGGG + Intronic
1108775649 13:53761899-53761921 TCCACATGAATGCACACAAAGGG + Intergenic
1113660205 13:112102406-112102428 TCTCCAAGAATGCTGTAATAGGG + Intergenic
1113913258 13:113854728-113854750 CCCGCAAGGATGCTGCCAAATGG - Intronic
1115824493 14:37251965-37251987 TCCCTAAGAAAGGTTACAAAAGG + Intronic
1116195597 14:41721669-41721691 TCTTTAAGAATGCTGAAAAAAGG + Intronic
1116503883 14:45653994-45654016 TCCCCCAGATTGCTGACCCACGG - Intergenic
1117004741 14:51409141-51409163 CCCCCATGAATGCTTACAAGAGG - Intergenic
1117047650 14:51828967-51828989 TTCCCAAGAATGGTGACAAGAGG - Intronic
1117321538 14:54628550-54628572 TCCCCAAGAATGCTTCCTAGGGG + Intronic
1124485062 15:30106441-30106463 TCCCCAAAAAAACAGACAAATGG - Intergenic
1124518515 15:30390828-30390850 TCCCCAAAAAAACAGACAAATGG + Intronic
1124631801 15:31342189-31342211 TGCCCAAGACTACTGACACAGGG - Intronic
1127049018 15:55060664-55060686 TCCTGAAGAATGCTGAATAAAGG + Intergenic
1127237654 15:57072448-57072470 TACCCATCAATGCTGACAAATGG - Intronic
1128736646 15:70057427-70057449 TCCCCAAGAAAGGAGCCAAAAGG + Intronic
1128790529 15:70430195-70430217 TCCCAAGGAATCCTGAGAAATGG + Intergenic
1134781137 16:16896433-16896455 TACCCAAGGATGCTGAGCAAGGG + Intergenic
1135656750 16:24256617-24256639 TCCCTGTGGATGCTGACAAAAGG + Exonic
1139560846 16:67741006-67741028 TCCCCAAGAAGCCTGGAAAAAGG + Intronic
1140401251 16:74673670-74673692 ATCCCAAGGATGCTGAAAAAAGG + Intronic
1141243720 16:82287261-82287283 TCCAGAAGAATTCTGAGAAAGGG + Intergenic
1141503214 16:84458971-84458993 TCCCCAAGAATGCCAGCAAGGGG + Intronic
1142052251 16:87966394-87966416 TCCCCAGGACTTCTGAGAAATGG + Intronic
1143045427 17:4075025-4075047 GCCCCCTGAAGGCTGACAAAAGG + Intronic
1143734845 17:8904416-8904438 GCCCCCAGGATGCTGACAAGAGG - Intronic
1146425787 17:32736995-32737017 GGCCAAAGAATCCTGACAAAAGG + Intronic
1149363270 17:55915563-55915585 ACCCCAATAAAGCTGAAAAAAGG - Intergenic
1151706981 17:75774361-75774383 TCCCCAGACCTGCTGACAAAGGG + Intergenic
1155553148 18:26988116-26988138 TCCAAAAGATGGCTGACAAAGGG + Intronic
1156062385 18:33096047-33096069 TCAGCAAAAATGCTGAAAAATGG + Intronic
1156426388 18:37018266-37018288 TCCTTAAGAATGCTGAAAATAGG + Intronic
1157963706 18:52184432-52184454 TACCCTAGGATACTGACAAAAGG + Intergenic
1159905863 18:74091689-74091711 TCTTCAAGAATGCTGACTAAAGG + Intronic
1161052271 19:2170795-2170817 TGCCCATGAATACTGAGAAATGG + Intronic
1163287280 19:16356623-16356645 TCTCCCAGAACACTGACAAAAGG + Intronic
1163803872 19:19384846-19384868 CCCCCAAGAGTGCTTAGAAAAGG + Intergenic
1164856746 19:31530907-31530929 TCCCCAACAATGCGGACAGCTGG - Intergenic
928168393 2:28987668-28987690 TTCCACAGAATGCAGACAAAGGG - Intronic
928907950 2:36388021-36388043 TCCCCATCAATGTTGACATATGG + Intronic
929204088 2:39270458-39270480 TGCCCAATAATGATGACAAAAGG + Intronic
931906579 2:66849495-66849517 ACTCCAAGACTGCTGAGAAATGG + Intergenic
936442514 2:112567271-112567293 TCCCCATGAGTTCTGACACATGG + Intronic
937134001 2:119536635-119536657 TTCAAAAGGATGCTGACAAATGG - Intergenic
937145206 2:119638639-119638661 TCCAGAGGAATGTTGACAAAGGG - Intronic
937322927 2:120971691-120971713 TCCCCAAGACTTCTGGGAAATGG - Intronic
941198210 2:162476172-162476194 TCACCAAGAAAGCTGAGAACTGG - Intronic
944866912 2:203871297-203871319 TCCCCAACATTGGTGAAAAAAGG - Intronic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1175328583 20:58147246-58147268 ACCCCAACAGTGCTGCCAAAAGG + Intergenic
1182281820 22:29221793-29221815 TCCCCCAAAATTCTGAGAAATGG - Intronic
1182361348 22:29748222-29748244 TCCCCAACAACGCTGACTGAAGG - Intronic
1183492621 22:38124745-38124767 TGCCCAAGAGGGCTGATAAATGG + Intronic
949244464 3:1909579-1909601 TTCCAAAGAGTGCTGACAGAGGG + Intergenic
949616896 3:5763695-5763717 ACCCAAAGAATTCTGACATACGG + Intergenic
953642828 3:44725632-44725654 TCCCTAGCAAAGCTGACAAAGGG - Intergenic
953866315 3:46586266-46586288 TACCAGAGAATGTTGACAAATGG - Intronic
955703577 3:61705773-61705795 TCCCCAAGAATGATGAATACGGG - Intronic
958510825 3:95046190-95046212 TACCCAAGAATGCTCATACAAGG - Intergenic
959034426 3:101344377-101344399 TCCCACAGAATGCTTATAAATGG + Intronic
960253675 3:115487073-115487095 TCTCCAGGACTGCTGACGAAGGG - Intergenic
962515687 3:136148775-136148797 TACTTAGGAATGCTGACAAATGG - Intergenic
962714205 3:138113402-138113424 TCCTCAAGAATGCAGTCAAGAGG + Intronic
964903524 3:161690459-161690481 TTCCCTAGAATGCTGACAGAAGG + Intergenic
966427726 3:179798328-179798350 TCCCCATGACTCCTGAAAAATGG - Exonic
967341948 3:188408110-188408132 GCCCCTAGTAAGCTGACAAAGGG - Intronic
970847191 4:20554605-20554627 TCTCCAGGTATGCTGACTAATGG - Intronic
971536466 4:27758146-27758168 TACCCAGGAATGCTCAGAAAAGG + Intergenic
973105136 4:46326255-46326277 TCCCCAAGAAAGCTAATGAATGG + Intronic
977721309 4:100243305-100243327 CCCCCAGGAATTCTGACAAAGGG - Intergenic
978035511 4:103987865-103987887 TCTCCAACAAAACTGACAAATGG + Intergenic
982361665 4:154525131-154525153 TCCCCAAAAAAGTTGACAAAAGG + Intergenic
982778624 4:159467111-159467133 TCCCCAGGAGTGCTGGAAAAGGG - Intergenic
991443338 5:66674669-66674691 TCCCCAGGAATTCTGAAAGATGG - Intronic
993755350 5:91722338-91722360 TCCCCAGGAATGATAACAAAGGG + Intergenic
995518959 5:112982282-112982304 TCCCCAAGAGTGCAGTCTAAAGG - Intronic
995701113 5:114937063-114937085 TCACAAAGAAGGCTGAGAAAAGG + Intergenic
996135273 5:119833903-119833925 TCCCTAAGAATTCGGAGAAAAGG + Intergenic
998903052 5:146876744-146876766 TCTCCAAAAATGATGACAAATGG + Intronic
1000141993 5:158414372-158414394 TTCCCAACAATGCTGTCCAACGG - Intergenic
1002111592 5:176918214-176918236 TCACCAAGAATGGTGGCAAATGG - Intronic
1010330203 6:74614785-74614807 CCCCCTACAATGCTGACAGAAGG + Intergenic
1010738444 6:79469548-79469570 TCCACAAGGATGGTGACAACAGG - Intergenic
1011134938 6:84089982-84090004 CACCCAAGAATGCTGACAATAGG - Exonic
1012642932 6:101644417-101644439 TGCCCAAGAATAAAGACAAATGG + Intronic
1013233059 6:108174591-108174613 ACCCCAAGAAAGCGGACAAGGGG - Intronic
1013539546 6:111094411-111094433 TTCAGAAGAATGCCGACAAATGG - Intronic
1013611669 6:111801800-111801822 TCTCAAAGAATGCTCACATATGG - Intronic
1015671211 6:135692289-135692311 TCCCCAAGAATACATACACACGG + Intergenic
1015953479 6:138576861-138576883 TACCCATCACTGCTGACAAAGGG + Intronic
1020496700 7:8862027-8862049 TTCCCAAGTTTGCTGTCAAATGG - Intergenic
1021924489 7:25521410-25521432 TCCCCTAGAATCCTGCCAAGGGG - Intergenic
1030864927 7:114689514-114689536 TCAGAAAGAATGCTGAGAAACGG + Intronic
1031198555 7:118647848-118647870 TCCAAAGCAATGCTGACAAATGG + Intergenic
1031224149 7:119012862-119012884 TCCCCAAGAATTCTCACTACTGG - Intergenic
1032698053 7:134354924-134354946 CCCCCTAGAATGCTGTCAAGGGG + Intergenic
1034075009 7:148222885-148222907 TGCCCAAGACAACTGACAAAAGG - Intronic
1036045112 8:5131185-5131207 TCCCAAAATATGCTGTCAAATGG + Intergenic
1038187331 8:25286980-25287002 TCCCAAAGAATGCAGACCACAGG - Intronic
1038442414 8:27580917-27580939 CCCCCAAGGAGACTGACAAATGG - Intergenic
1041665020 8:60435318-60435340 ACACCAACAATGCTAACAAAAGG + Intergenic
1041887805 8:62832057-62832079 TCTCTAAGAATGCTGAAAATAGG - Intronic
1043294437 8:78646062-78646084 GGCCAAAGAATGCCGACAAAAGG + Intergenic
1044890145 8:96826536-96826558 TACCCCAGAATGCAGACAGAAGG + Intronic
1047113981 8:121820040-121820062 TCTCCAAGAAGGCTGATGAAAGG + Intergenic
1048178935 8:132177807-132177829 TCACCAAGAGTACTGGCAAATGG - Intronic
1048534763 8:135283036-135283058 TCCCAAAGAATGTTCAGAAAAGG + Intergenic
1051428677 9:16960319-16960341 TGCCCAAGTCAGCTGACAAATGG - Intergenic
1053154164 9:35763277-35763299 TCCTAAAGAATGCTAACACAAGG - Intergenic
1055328968 9:75162253-75162275 TTCACAATAATGCTGTCAAAAGG - Intergenic
1056985446 9:91360592-91360614 TGCCCAAGAACCCTCACAAATGG + Intronic
1058057346 9:100462541-100462563 TCCATATGAATGCTGACAAATGG - Intronic
1058667962 9:107337646-107337668 GCCACAAGAAAGATGACAAAAGG - Intergenic
1060434722 9:123583614-123583636 TCCCCAGGAATGCTGATATACGG + Intronic
1062605980 9:137349066-137349088 TCCCCAAGAATGCTGACAAACGG + Intronic
1185633651 X:1535874-1535896 TCCCCTAAAAAGCTGAGAAAAGG - Intronic
1188990486 X:36813155-36813177 TTCCTAAGACTGCTAACAAAGGG - Intergenic
1193596117 X:83447562-83447584 TCCCCAAAAATACTGACAAATGG - Intergenic
1201224936 Y:11809587-11809609 CCACCAGGAATGCTGAAAAAGGG - Intergenic