ID: 1062606193

View in Genome Browser
Species Human (GRCh38)
Location 9:137349923-137349945
Sequence TGAGCACTAGAGCCCCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 69}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062606193_1062606200 6 Left 1062606193 9:137349923-137349945 CCCCCGGGGGGCTCTAGTGCTCA 0: 1
1: 1
2: 0
3: 10
4: 69
Right 1062606200 9:137349952-137349974 GGGCGCTCCACGTGTGTGTCTGG No data
1062606193_1062606201 7 Left 1062606193 9:137349923-137349945 CCCCCGGGGGGCTCTAGTGCTCA 0: 1
1: 1
2: 0
3: 10
4: 69
Right 1062606201 9:137349953-137349975 GGCGCTCCACGTGTGTGTCTGGG No data
1062606193_1062606202 8 Left 1062606193 9:137349923-137349945 CCCCCGGGGGGCTCTAGTGCTCA 0: 1
1: 1
2: 0
3: 10
4: 69
Right 1062606202 9:137349954-137349976 GCGCTCCACGTGTGTGTCTGGGG No data
1062606193_1062606205 29 Left 1062606193 9:137349923-137349945 CCCCCGGGGGGCTCTAGTGCTCA 0: 1
1: 1
2: 0
3: 10
4: 69
Right 1062606205 9:137349975-137349997 GGTGGCGTGTGTGCCCAGAGAGG No data
1062606193_1062606206 30 Left 1062606193 9:137349923-137349945 CCCCCGGGGGGCTCTAGTGCTCA 0: 1
1: 1
2: 0
3: 10
4: 69
Right 1062606206 9:137349976-137349998 GTGGCGTGTGTGCCCAGAGAGGG No data
1062606193_1062606203 11 Left 1062606193 9:137349923-137349945 CCCCCGGGGGGCTCTAGTGCTCA 0: 1
1: 1
2: 0
3: 10
4: 69
Right 1062606203 9:137349957-137349979 CTCCACGTGTGTGTCTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062606193 Original CRISPR TGAGCACTAGAGCCCCCCGG GGG (reversed) Intronic
900706860 1:4086329-4086351 TGAGCACCGGAGCCCCCCGCCGG - Intergenic
904498020 1:30898423-30898445 CGAGCACTAGGGACCCCCAGGGG - Intronic
907221974 1:52913769-52913791 TGTACACTAGGGCCCCCGGGTGG - Intronic
908551793 1:65215745-65215767 TGAGCTCTAGAGCCCTCTGGAGG - Intronic
924770974 1:247078961-247078983 TGAGACCTGGCGCCCCCCGGGGG + Intergenic
924881140 1:248164376-248164398 TGAGGACTGGAGCCGCCCTGAGG - Intergenic
924881285 1:248164889-248164911 TGAGGACTGGAGCCGCCCTGAGG - Intergenic
924881302 1:248164941-248164963 TGAGGACTGGAGCCACCCTGAGG - Intergenic
924881353 1:248165112-248165134 TGAAGACTGGAGCCCCCCTGAGG - Intergenic
924881363 1:248165147-248165169 TGAAGACTGGAGCCCCCCTGAGG - Intergenic
924881388 1:248165233-248165255 TGAGGACTGGAGCCCCCCTGAGG - Intergenic
924893131 1:248306490-248306512 TGAGGACTGGAGCCGCCCTGAGG + Intergenic
924893140 1:248306525-248306547 TGAGGACTGGAGCCGCCCTGAGG + Intergenic
924893145 1:248306543-248306565 TGAGGACTGGAGCCGCCCTGAGG + Intergenic
924893180 1:248306663-248306685 TGAGGACTGGAGCCGCCCTGAGG + Intergenic
1075026994 10:118992701-118992723 TGAGCATCAGAACCCCCTGGGGG - Intergenic
1090533509 11:127615674-127615696 TGAGCCCTGGAGCCCCCCTGTGG - Intergenic
1091027543 11:132155530-132155552 GGAGCAATAGAGCTCCGCGGAGG - Intronic
1092526129 12:9311342-9311364 TGAGCACAAGAGCTCCCAGGAGG - Intergenic
1092541150 12:9420441-9420463 TGAGCACAAGAGCTCCCAGGAGG + Intergenic
1094511893 12:31102034-31102056 TGAGCACGAGAGCTCCCAGGAGG - Intronic
1098951644 12:76645680-76645702 TGAGCAATAGAGCAGCTCGGAGG - Intergenic
1099584370 12:84497997-84498019 TGCCCACTAGAGCCCCCTGTTGG + Intergenic
1105396806 13:20043898-20043920 TGACCACTGGAGACCCCCAGTGG - Intronic
1110284658 13:73735447-73735469 TGACCACCAGAGCCCCTAGGGGG - Intronic
1113708270 13:112447795-112447817 GGAGCAGGAGAGCCCCTCGGGGG - Intergenic
1116844553 14:49853124-49853146 TGAGCCCTACGGCCCCCCTGTGG - Exonic
1120978024 14:90266606-90266628 TTAGTACTAGAGCCCCACAGGGG - Intronic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1134457551 16:14405865-14405887 TGAGGACTCGAGCCCCTTGGAGG - Intergenic
1141564631 16:84893090-84893112 TGAGCACTGGAGCCCCCAACAGG + Intronic
1142889125 17:2931600-2931622 TGAGCATTAAAGCCCCCATGCGG + Intronic
1143632713 17:8148048-8148070 GGAGCACTGGGGCCCCCAGGAGG + Exonic
1148462665 17:47847345-47847367 GGCGCAGTGGAGCCCCCCGGGGG - Exonic
1155092381 18:22524448-22524470 TGAGAACTAGAGGCCCTGGGAGG - Intergenic
1157182120 18:45507174-45507196 TGAGCACTACAGACCCTAGGAGG + Intronic
1160162796 18:76487900-76487922 TGAGGATGAGAGCCCCCAGGAGG + Intronic
1160701016 19:507441-507463 TGTGCGCTAGAGCCCCCCCAAGG - Exonic
1160731714 19:644256-644278 TCCGCACTGGAGCCCCCGGGAGG + Intergenic
933481322 2:82860638-82860660 TGAGAACTAGTGACCCCAGGAGG + Intergenic
936075340 2:109398149-109398171 TGAGCACTGCAGGTCCCCGGAGG - Intronic
938083336 2:128381748-128381770 TGAGCACATGAGCCCCTCTGGGG + Intergenic
940078848 2:149776975-149776997 TGAGCACCAGAACCCCCAGTGGG - Intergenic
941629877 2:167872223-167872245 TGACCCCTGGAGCCCCCCGTAGG + Exonic
942278030 2:174336672-174336694 CGAGCTCTGGAGCCCCCCAGCGG - Exonic
948595879 2:239078977-239078999 TGAACACTGGTGCCACCCGGGGG - Intronic
1169064670 20:2688158-2688180 TGGGCCATAGCGCCCCCCGGAGG - Intergenic
1169216896 20:3799382-3799404 TGGGCACAGCAGCCCCCCGGGGG + Intronic
1172468864 20:35176206-35176228 TGGGCTCTAGAGCCCTCGGGAGG - Exonic
1172623577 20:36334916-36334938 TGAGCCCGATTGCCCCCCGGGGG + Intronic
1179439111 21:41380781-41380803 TAACCACTAGGGCCCCTCGGGGG - Intronic
1183035112 22:35135219-35135241 AGAGTCCTAGAGCCCCCCTGTGG - Intergenic
1183417925 22:37693077-37693099 TGAGCACCAGAGCCACCTGGAGG - Exonic
1185218061 22:49614910-49614932 TGAGCACACGAGGCCCCTGGTGG - Intronic
958023567 3:88025162-88025184 TGTGCACTAGAGCTCCCCATTGG - Intergenic
970843325 4:20502950-20502972 TGAGCACTAGAGCCACCTCTTGG - Intronic
976245649 4:83003611-83003633 GGATCACTTGAGCCCCCAGGTGG - Intronic
978530278 4:109705297-109705319 TGAGCACTAGAGCTCAACAGTGG - Intergenic
982583164 4:157204724-157204746 TGAGCACCAGCGCCTCCTGGTGG + Intronic
985313754 4:188632248-188632270 TGAGAATTAGAACCCCCAGGAGG + Intergenic
993995215 5:94714654-94714676 TGAGCAATAGAGCACCCAGAAGG + Intronic
1008428207 6:51383611-51383633 TGGGCATTAGAACCCCCTGGAGG - Intergenic
1019257899 7:63373-63395 TGAGCACTGGAGCTACCCTGGGG + Intergenic
1025301130 7:57820453-57820475 TGAGGACAAGAGCCCCACAGGGG + Intergenic
1029123324 7:98282097-98282119 CGAGGACTAGAGCCCCGGGGGGG - Intronic
1029413198 7:100428274-100428296 TGAGCACTAGCTCCACCCGAGGG + Intronic
1033098087 7:138448259-138448281 TCAGCACCTGAGACCCCCGGTGG - Intergenic
1035640075 8:1178130-1178152 AGAGAACTAGGGACCCCCGGAGG + Intergenic
1037196409 8:16196364-16196386 TGAGCACTGGAGCCTCCTGGGGG + Intronic
1041317731 8:56581903-56581925 GGTGCACTAGAGCCCCCAGGAGG + Intergenic
1047530132 8:125667001-125667023 TGAGCAACAGAGCCCTCCGAGGG + Intergenic
1049597426 8:143491217-143491239 GGAGCTCAAGGGCCCCCCGGGGG - Intronic
1057368922 9:94451964-94451986 GGAGCACCAGAGGCCCCCAGGGG - Intronic
1060968437 9:127724432-127724454 TGGGCACTTGAGGCCCCTGGGGG + Intronic
1061245927 9:129401340-129401362 TCAGGACTCGAGCACCCCGGAGG - Intergenic
1061632999 9:131885342-131885364 TGAGCATCAGAAGCCCCCGGGGG + Intronic
1062605787 9:137348416-137348438 TGAGCACTAGAGCCCCCCAGGGG - Intronic
1062606193 9:137349923-137349945 TGAGCACTAGAGCCCCCCGGGGG - Intronic
1185939122 X:4294811-4294833 TTAGCACTAGGGCTCCCAGGAGG - Intergenic
1186810961 X:13188048-13188070 TGAGCATCAGAGTCACCCGGAGG + Intergenic
1199950241 X:152700645-152700667 GGAGGACCAGAGGCCCCCGGAGG + Exonic