ID: 1062608916

View in Genome Browser
Species Human (GRCh38)
Location 9:137364098-137364120
Sequence CAGTGATGCCTAAGGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062608916_1062608921 5 Left 1062608916 9:137364098-137364120 CCTACTTCCCTTAGGCATCACTG 0: 1
1: 0
2: 1
3: 13
4: 192
Right 1062608921 9:137364126-137364148 TCGTGGACTTTTAAAAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062608916 Original CRISPR CAGTGATGCCTAAGGGAAGT AGG (reversed) Intronic
900569633 1:3351917-3351939 CACTGATGCCTGAGGGTAGCTGG + Intronic
904510950 1:31007281-31007303 CAGAGAGGCCTAAGGCAAGGTGG + Intronic
906339926 1:44970628-44970650 CAGTGTTTGCTAAGGGATGTCGG - Intronic
909068782 1:70967244-70967266 GAATGATGCCTAAGACAAGTAGG - Intronic
909233422 1:73120446-73120468 CATTTATGCCTGAGTGAAGTTGG + Intergenic
913088514 1:115460204-115460226 CAGAGATGCCAGAAGGAAGTGGG - Intergenic
913360859 1:117978661-117978683 GATTGAAGCCTAAGTGAAGTGGG - Intronic
916051660 1:161040744-161040766 CAGTGATGTCTGAGGGGAGGAGG - Intronic
916508110 1:165446177-165446199 CAGAGATGCCTAGGGAAAGGGGG - Intergenic
917151107 1:171945849-171945871 CAGTGATACATATGGAAAGTGGG + Intronic
918439711 1:184555066-184555088 CAGTGAAGGCAAAGGGAAATGGG - Intronic
920708856 1:208275874-208275896 CAGTTGTGCCCAAGGGAAGAGGG - Intergenic
921978054 1:221224768-221224790 CACTGATTCCTAAGGGAAAAAGG - Intergenic
924355184 1:243165784-243165806 CAGAGCTGCCTAAGTGAAGTAGG + Exonic
1065567709 10:27031557-27031579 TGGTGATGGCTAAGGGATGTGGG + Intronic
1067238639 10:44472217-44472239 GAGAGAGGCCTAAGGGAATTGGG + Intergenic
1067769967 10:49115807-49115829 CACTTATTCCTAAGGGAAGGCGG + Intergenic
1071160628 10:82741491-82741513 TAGTGAGGAATAAGGGAAGTGGG - Intronic
1074267754 10:111921602-111921624 CACTAATGTGTAAGGGAAGTGGG - Intergenic
1075031029 10:119024977-119024999 CAGTGGTGACTAGGGGAAATGGG + Intergenic
1077249646 11:1555339-1555361 CAGTGCTCCCTAAGTGAAGCAGG + Exonic
1078454310 11:11463142-11463164 CAGTGATAACTGAGGGAAGCAGG - Intronic
1081828649 11:46085399-46085421 CAGTGATGACTGAGGGAGATAGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084593113 11:70101909-70101931 CAGAGCTGCCTAAAGGCAGTGGG - Intronic
1085774203 11:79350959-79350981 CAGTGAGGTCTGAGGGAGGTAGG - Intronic
1086029716 11:82339489-82339511 CAGTGCTGTCTCAGGTAAGTAGG + Intergenic
1087150065 11:94851221-94851243 CTGTTATGCCTAAGGGAGGCTGG + Intronic
1087405405 11:97723219-97723241 CAGTTGTGGCTAAGGGAGGTGGG - Intergenic
1087547148 11:99598691-99598713 CAGTGATAGCTGAGGGAAGCAGG + Intronic
1087765575 11:102149501-102149523 CAGTTATGTTTAAGGGAAGCTGG + Intronic
1090996116 11:131867243-131867265 CAGGGATGCCTAAACGCAGTGGG + Intronic
1092998536 12:13973882-13973904 CATTGGTGCCTAAGGGAAGATGG - Intronic
1093422975 12:18996167-18996189 CACTGATGCCTCTGGAAAGTGGG + Intergenic
1094720035 12:33053217-33053239 CAGGGAGGCCAAAGGGGAGTGGG - Intergenic
1095886415 12:47193301-47193323 CAGTGATGCTCATAGGAAGTGGG - Intronic
1096552206 12:52380505-52380527 CAGTGATGCCAAATGCAAGCTGG - Exonic
1102255162 12:111410752-111410774 CAGAGATGCCCACGGGAAGCAGG - Intronic
1105267327 13:18832923-18832945 CAGTCATGCCTAGGAGATGTGGG + Intergenic
1105318338 13:19289655-19289677 CAGTGATGGCTAAGTGAAATGGG + Intergenic
1108124526 13:47226744-47226766 AAGTGAAGCCTAAGCAAAGTTGG - Intergenic
1109133395 13:58616730-58616752 CAATTATGCCTATGGGCAGTGGG - Intergenic
1109252510 13:60036294-60036316 CAGTGCTGCCTAAGGGGCCTTGG - Intronic
1112494942 13:99896762-99896784 CAGGGATTCCCAAGGGAAATCGG - Exonic
1114846334 14:26327148-26327170 GAGTGATGAGTAAGGGAAGCTGG - Intergenic
1115663464 14:35520968-35520990 CAGGAATACCAAAGGGAAGTAGG + Intergenic
1115840977 14:37470081-37470103 TGGTGATGCCTAAGGAAAGGAGG + Intronic
1115933004 14:38519070-38519092 CACTGAGGCCTATTGGAAGTTGG + Intergenic
1117628220 14:57662539-57662561 CAAAGAAGCCAAAGGGAAGTTGG - Intronic
1118039754 14:61903980-61904002 CAGTAATTCCTGAGAGAAGTTGG + Intergenic
1120520957 14:85528066-85528088 CACTGATCCATAAGAGAAGTGGG - Intergenic
1121075303 14:91063092-91063114 CAGGGATGCCTAATTTAAGTTGG + Intronic
1121278929 14:92686412-92686434 CAGTGATGCCAAGTTGAAGTTGG - Intronic
1121392128 14:93584531-93584553 CATTCATGCCTATGGGAAGCTGG + Intronic
1121551089 14:94801224-94801246 CAGTTGTTCCTAAGGGAACTGGG + Intergenic
1124372448 15:29111341-29111363 CACTGAGGCCTCAAGGAAGTGGG - Intronic
1124406944 15:29401504-29401526 CAGTGATGGCAAAGGGCAGAGGG + Intronic
1125318137 15:38454296-38454318 CACAGAGGCCCAAGGGAAGTAGG - Intronic
1125715676 15:41818658-41818680 CAGTGATGTCTCTGGGAAGTGGG + Intronic
1126003681 15:44235968-44235990 CAGTTCTGCCTCAGGGAAATAGG - Intergenic
1127295323 15:57604156-57604178 CAGTGTTCCCCAATGGAAGTAGG + Intronic
1127851126 15:62912852-62912874 CAGGGATGCCTTGGAGAAGTAGG - Intergenic
1127883247 15:63176401-63176423 CAGGGATGCCTTCGGGAAGCTGG - Intergenic
1128078787 15:64844001-64844023 TAGGGATGCCAAAGGGGAGTAGG - Intronic
1128313317 15:66645057-66645079 CATTGCTGCCTAAGGGGAGAGGG + Intronic
1128638095 15:69315968-69315990 CAGTGAAGCCTCGGGGAAGGCGG + Intronic
1129493400 15:75952209-75952231 GAGTGACGGCTAAGGGATGTGGG - Intronic
1129953809 15:79615090-79615112 CAGTGCTGCCTCTGAGAAGTAGG - Intergenic
1130204274 15:81861573-81861595 CAGTGATGCCAAAGAGATGCTGG + Intergenic
1130341084 15:82999663-82999685 CAGAGATGCCTAGGGGGATTGGG - Intronic
1130970362 15:88727475-88727497 GAGTGATGATTAAGGGAAGCTGG + Intergenic
1132551197 16:554452-554474 CAGGGAGGCCAAAGGGGAGTGGG - Exonic
1134297940 16:12963119-12963141 CAGAGGTGCCTGAGGGAAGCAGG + Intronic
1135087757 16:19488494-19488516 CAGTGGAGCCAAAGGGAAGTGGG - Intronic
1137410948 16:48227720-48227742 CAGAGATGCCTAAGGGTGGTAGG - Intronic
1139409762 16:66750306-66750328 CAGTGATTCCCATGGGAATTGGG + Intronic
1139670603 16:68490515-68490537 CAGAGATGACTCAGGCAAGTTGG + Intergenic
1140055796 16:71524583-71524605 CAGTGCTGCCTTAGAGACGTGGG + Intronic
1141579619 16:84988268-84988290 AAGTGATGGCTAAGGGGTGTGGG + Intronic
1142043890 16:87912941-87912963 CGGTGGTGGCTAAAGGAAGTGGG + Intronic
1143384926 17:6523521-6523543 CAGTGAGAGCTAAGGGCAGTCGG - Intronic
1143539097 17:7558940-7558962 CAGTGGTGCAGAAGGGAAGAAGG - Exonic
1146077395 17:29744092-29744114 CAGGGACGCCAAAGGGCAGTGGG + Intronic
1146787664 17:35732898-35732920 CAGGGATGCCTAAGGGGCTTCGG + Intronic
1147005742 17:37402296-37402318 AAGTGATGTCTAAGTGAGGTAGG + Intronic
1148405694 17:47412598-47412620 AAGTGCTGCTTGAGGGAAGTGGG + Intronic
1150446354 17:65229781-65229803 CAGAGTTGCCTAAAGGCAGTAGG + Intergenic
1153492553 18:5664356-5664378 CAGTGATGCTTAACAGAATTTGG - Intergenic
1154421086 18:14228507-14228529 CAGTCATGCCTAGGAGATGTGGG - Intergenic
1156010306 18:32489665-32489687 CAGTGATCCCTAAGATAAGTAGG - Intergenic
1156536753 18:37871827-37871849 CAGTGATGCTCAATGGAAGGAGG - Intergenic
1160059234 18:75514597-75514619 GAGTGGGGCCTGAGGGAAGTTGG + Intergenic
1160098690 18:75900838-75900860 AAGTGAGGCCTGAGGGCAGTGGG - Intergenic
1161048480 19:2149991-2150013 CAAGGAGGCCGAAGGGAAGTGGG + Intronic
1161571538 19:5033303-5033325 CAGTGAAGCCCAGGGGCAGTGGG + Intronic
1161800983 19:6416682-6416704 CAGTGATGGCCCAGGGAAGAGGG + Intronic
1163585308 19:18160712-18160734 GAGTGACTCCTAAGGGAAGATGG + Intronic
1166979015 19:46621859-46621881 CAGAGATGCCTAAGGGGAGAGGG + Intronic
1202641252 1_KI270706v1_random:89189-89211 CAGTCATGCCTAGGAGATGTGGG + Intergenic
925278269 2:2665710-2665732 CAGTGAGGCCTTGGGGAAGGAGG - Intergenic
926697771 2:15782627-15782649 CACTGCTGCCAAGGGGAAGTGGG + Intergenic
934497064 2:94812619-94812641 CAGTCATGCCTAGGAGATGTGGG + Intergenic
935061079 2:99608313-99608335 CATTGATGCCTAGGGGAGCTGGG - Intronic
935523642 2:104140355-104140377 CCCTGATGCCTCAGGGAAGGGGG + Intergenic
939789612 2:146555537-146555559 CTGTGGTGCCTATGGGAAGTGGG - Intergenic
939883334 2:147654757-147654779 CAATGATCCCAAAGGGGAGTGGG + Intergenic
939995912 2:148919458-148919480 CAGTGATGACTAGAGCAAGTTGG + Intronic
944188894 2:196980193-196980215 CACTGATGCCAAAAGGAAATGGG + Intronic
946817596 2:223594810-223594832 GATTGATGCCTAATGGAGGTCGG + Intergenic
947117762 2:226790667-226790689 CAGTGATGCAAGAGGGATGTTGG + Intronic
948976527 2:241466761-241466783 CAGGGAGGCCAAAGGGGAGTGGG - Intronic
949034327 2:241809690-241809712 CAGAGATGCCCAGGGGAAGTGGG + Intronic
1169104287 20:2980929-2980951 CAGTGATGGCTCAGGAAAATCGG + Intronic
1171888359 20:30679400-30679422 CAGTCATGCCTAGGAGATGTGGG + Intergenic
1173761980 20:45570019-45570041 CACTGAAGCCTATGGGAGGTTGG + Intronic
1174194913 20:48766305-48766327 CAGGGATGCCTAAGTGATCTAGG - Intronic
1179453237 21:41479890-41479912 CAGTGATTCCTAACGGGGGTGGG - Intronic
1179955803 21:44737534-44737556 CAGTGGTGTGTAAGGGAAGAGGG - Intergenic
1180360709 22:11892686-11892708 CAGTCATGCCTAGGAGATGTGGG - Intergenic
1180712089 22:17846279-17846301 CAGTGTTTCCAAAGGGAAGGTGG + Intronic
1181320067 22:21997710-21997732 CAGGGATTCCTAAGGGCAGTGGG - Intergenic
1182041060 22:27239366-27239388 CAGTGATGCTTCAGGGTAGGCGG + Intergenic
1182341337 22:29623652-29623674 CAGTCAGGCAGAAGGGAAGTTGG + Intronic
1183252038 22:36737125-36737147 CGGTGCTGTCTAGGGGAAGTTGG - Intergenic
949750908 3:7351736-7351758 GACTGATGTCTAAGGGAAGAAGG - Intronic
949818825 3:8092809-8092831 CAGAGATGCCTAAGAGGAGGAGG - Intergenic
950179414 3:10900812-10900834 CAGTGCTGCCCATGGGATGTGGG + Intronic
950997599 3:17519503-17519525 GAGTTATGCATAAGGTAAGTGGG - Intronic
954844011 3:53538953-53538975 GAGTGGTGACTGAGGGAAGTGGG - Intronic
954971521 3:54655229-54655251 CAGTGCTGCCTAATGGAAAAAGG + Intronic
958439856 3:94143061-94143083 CAAGGATGGCTAAAGGAAGTAGG + Intergenic
961843830 3:129743048-129743070 CAGTGATGCCTAAGAGGTATGGG + Intronic
962079713 3:132124820-132124842 CAGTGATGCCCCTGGGAACTTGG - Intronic
967580045 3:191141963-191141985 CAGTCATCCTTAGGGGAAGTCGG - Intergenic
1202737316 3_GL000221v1_random:18168-18190 CAGTCATGCCTAGGAGATGTGGG - Intergenic
969147394 4:5136153-5136175 CAGTGATCCCTAAGGAGAGCTGG + Intronic
973384763 4:49499716-49499738 CAGTCATGCCTAGGAGATGTGGG + Intergenic
976055985 4:81067615-81067637 GAGTTAAGCCTAGGGGAAGTGGG - Intergenic
979246613 4:118513847-118513869 CAGAGCTGCCTAAGTGAAGTAGG - Intergenic
982372275 4:154647160-154647182 CATTGATGCCTAAGAAAATTGGG + Intronic
984869295 4:184312453-184312475 CAGTAATTCCTAAAGGAAGGAGG - Intergenic
984869301 4:184312496-184312518 CAGTCATTCCTAAAGGAAGGAGG - Intergenic
1202768618 4_GL000008v2_random:175048-175070 CAGTCATGCCTAGGAGATGTGGG + Intergenic
985938814 5:3117455-3117477 CAATGCTGTCTAAGGGAAGGAGG + Intergenic
989525839 5:42453386-42453408 CAGTTGTGGCTAAGGCAAGTGGG + Intronic
991299087 5:65111310-65111332 CAGTGAAGCTAAAGGGTAGTGGG - Intergenic
991440963 5:66648774-66648796 CAGTGCTGCCAAAATGAAGTCGG + Intronic
994691629 5:103026827-103026849 CAGTGGGGCCTAGGGGAAGGTGG + Intronic
996971928 5:129380384-129380406 AAATGATGCCTAAAGAAAGTAGG + Intergenic
998562067 5:143180993-143181015 CAGTGATGAGTAAAGGAAGCTGG - Intronic
1003166050 6:3679514-3679536 CAGTGGTGCCTAAGAGAAAATGG + Intergenic
1003635261 6:7826107-7826129 CAGTGGTGCCTGAGGGTGGTTGG + Intronic
1005991186 6:30903434-30903456 CAGTAAAGCCTGTGGGAAGTGGG + Intergenic
1006996969 6:38270340-38270362 CAGTGATGCAGAGGGGTAGTGGG - Intronic
1008628220 6:53338304-53338326 CAGTGTGACCCAAGGGAAGTTGG - Intronic
1013035719 6:106380397-106380419 CTGTGATGCCTCAGAGAAGCTGG - Intergenic
1017557996 6:155593581-155593603 CAAAGATGCCTTAGGAAAGTAGG + Intergenic
1017825082 6:158075844-158075866 CAGTGATGCCCAAGAGAATGAGG + Intronic
1020033050 7:4946435-4946457 CAGTGATGCTGAAGGGAAGTGGG + Intronic
1021534521 7:21688401-21688423 CTGTGATGCCTAACGTGAGTTGG - Intronic
1022502901 7:30893721-30893743 CAGTGCTGCCAAAGGGACCTTGG - Intergenic
1026580416 7:71611510-71611532 GAGAGATTCCTAAAGGAAGTGGG - Intronic
1028893830 7:96018614-96018636 GAGTGATGCTGAAGAGAAGTTGG + Intronic
1030128360 7:106176608-106176630 GAGTGCTGGCTCAGGGAAGTTGG + Intergenic
1032613594 7:133442536-133442558 AAGTGATGCCTCAGGCTAGTGGG + Intronic
1033014234 7:137655620-137655642 CAGAGATGAGTAAGTGAAGTTGG + Intronic
1037323486 8:17665768-17665790 CATGGATGCCTCAGGGTAGTAGG + Intronic
1039957897 8:42221380-42221402 CAGAGCTGAATAAGGGAAGTAGG + Intergenic
1042056928 8:64773954-64773976 AAGTCATACGTAAGGGAAGTGGG + Intronic
1048261395 8:132948465-132948487 CAGTGATGCCCCCAGGAAGTTGG + Intronic
1048791970 8:138112538-138112560 CAATGATGCTTAGGGGAGGTGGG - Intergenic
1049298089 8:141854571-141854593 CAGGGAGGCCTAGAGGAAGTTGG + Intergenic
1051550036 9:18317557-18317579 CAATTATGCCTCAGGAAAGTTGG + Intergenic
1052444458 9:28542378-28542400 CAGAGAGGCCTAAGGAAAGATGG + Intronic
1052874913 9:33551373-33551395 CAGTCATGGCTAAGAGATGTAGG - Intronic
1053501107 9:38592950-38592972 CAGTCATGGCTAAGAGATGTAGG + Intergenic
1053660085 9:40267851-40267873 CAGTCATGCCTAGGAGATGTGGG - Intronic
1053910460 9:42897206-42897228 CAGTCATGCCTAAGAGATGTGGG - Intergenic
1054361082 9:64120557-64120579 CAGTCATGCCTAGGAGATGTGGG - Intergenic
1054372218 9:64414155-64414177 CAGTCATGCCTAGGAGATGTGGG - Intergenic
1054524513 9:66108366-66108388 CAGTCATGCCTAGGAGATGTGGG + Intronic
1054679836 9:67903852-67903874 CAGTCATGCCTAGGAGATGTGGG - Intergenic
1055146127 9:72936986-72937008 CAGTGAAACCTAGGGGAAGGTGG + Intronic
1056212902 9:84381645-84381667 CAGTGATGACAAAGTCAAGTTGG - Intergenic
1056480135 9:86994930-86994952 CAGTTATGCCAAGGGGAGGTGGG - Intergenic
1056812852 9:89777691-89777713 CAGTGATGCCTATGCTAAGACGG - Intergenic
1057231351 9:93323533-93323555 CAGTGATGCCTGTGGCATGTGGG - Intronic
1057241772 9:93417536-93417558 AAGAGATGCTAAAGGGAAGTGGG - Intergenic
1057680505 9:97177450-97177472 CAGTCATGGCTAAGAGATGTGGG + Intergenic
1058409008 9:104709749-104709771 CAGTGAACTCTTAGGGAAGTAGG - Intergenic
1060329541 9:122654256-122654278 CAGTCATGCATCAGGAAAGTAGG - Intergenic
1060366652 9:123022808-123022830 CAGTGATAGCTAACGTAAGTTGG + Intronic
1062608916 9:137364098-137364120 CAGTGATGCCTAAGGGAAGTAGG - Intronic
1203693513 Un_GL000214v1:68907-68929 CAGTCATGCCTAGGAGATGTGGG + Intergenic
1203706039 Un_KI270742v1:48618-48640 CAGTCATGCCTAGGAGATGTGGG - Intergenic
1203557965 Un_KI270744v1:17274-17296 CAGTCATGCCTAGGAGATGTGGG + Intergenic
1203642760 Un_KI270751v1:35156-35178 CAGTCATGCCTAGGAGATGTGGG - Intergenic
1185859396 X:3563544-3563566 CAGAGATGCTTTGGGGAAGTAGG - Intergenic
1189136382 X:38555026-38555048 CAGTGGTGCCTCTGGGAAGGAGG - Intronic
1192756219 X:74049312-74049334 CTGTTATGCCTGAGGGCAGTAGG - Intergenic
1193556683 X:82961882-82961904 CAGTTGTGCCTAAGGAAGGTGGG - Intergenic
1194072044 X:89337950-89337972 CTCTGATGTCTAAGGGAAGAAGG + Intergenic
1194291821 X:92082573-92082595 CAGAGATGCTTAAGGCAAATGGG + Intronic
1195427427 X:104750287-104750309 CAATGAAGCCAAAGGGCAGTTGG + Intronic
1198208315 X:134491147-134491169 GAGTGATGGCTAAGGGGATTGGG - Intronic
1200609337 Y:5307145-5307167 CAGAGATGCTTAAGGCAAATGGG + Intronic
1200806699 Y:7441124-7441146 CAGAGATGCTTTGGGGAAGTAGG + Intergenic