ID: 1062609397

View in Genome Browser
Species Human (GRCh38)
Location 9:137367208-137367230
Sequence CCTGCCCAGCAGTGCCTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062609389_1062609397 2 Left 1062609389 9:137367183-137367205 CCTGGCGCCGACTGCATGGGGCC 0: 1
1: 0
2: 0
3: 1
4: 88
Right 1062609397 9:137367208-137367230 CCTGCCCAGCAGTGCCTTGGGGG No data
1062609384_1062609397 18 Left 1062609384 9:137367167-137367189 CCCACAGGTGAGGCTGCCTGGCG 0: 1
1: 0
2: 2
3: 19
4: 147
Right 1062609397 9:137367208-137367230 CCTGCCCAGCAGTGCCTTGGGGG No data
1062609385_1062609397 17 Left 1062609385 9:137367168-137367190 CCACAGGTGAGGCTGCCTGGCGC 0: 1
1: 0
2: 3
3: 21
4: 245
Right 1062609397 9:137367208-137367230 CCTGCCCAGCAGTGCCTTGGGGG No data
1062609383_1062609397 19 Left 1062609383 9:137367166-137367188 CCCCACAGGTGAGGCTGCCTGGC 0: 1
1: 0
2: 1
3: 33
4: 262
Right 1062609397 9:137367208-137367230 CCTGCCCAGCAGTGCCTTGGGGG No data
1062609379_1062609397 28 Left 1062609379 9:137367157-137367179 CCTCCTCTGCCCCACAGGTGAGG 0: 1
1: 0
2: 2
3: 57
4: 425
Right 1062609397 9:137367208-137367230 CCTGCCCAGCAGTGCCTTGGGGG No data
1062609381_1062609397 25 Left 1062609381 9:137367160-137367182 CCTCTGCCCCACAGGTGAGGCTG 0: 1
1: 1
2: 3
3: 51
4: 356
Right 1062609397 9:137367208-137367230 CCTGCCCAGCAGTGCCTTGGGGG No data
1062609390_1062609397 -5 Left 1062609390 9:137367190-137367212 CCGACTGCATGGGGCCCACCTGC 0: 1
1: 0
2: 0
3: 36
4: 227
Right 1062609397 9:137367208-137367230 CCTGCCCAGCAGTGCCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062609397 Original CRISPR CCTGCCCAGCAGTGCCTTGG GGG Intronic
No off target data available for this crispr