ID: 1062609407

View in Genome Browser
Species Human (GRCh38)
Location 9:137367257-137367279
Sequence CTGGGGCCAGAGAGGGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 585
Summary {0: 1, 1: 0, 2: 7, 3: 90, 4: 487}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062609407_1062609410 -8 Left 1062609407 9:137367257-137367279 CCAAGAGCCCTCTCTGGCCCCAG 0: 1
1: 0
2: 7
3: 90
4: 487
Right 1062609410 9:137367272-137367294 GGCCCCAGCTCTTGTAGACCTGG No data
1062609407_1062609418 28 Left 1062609407 9:137367257-137367279 CCAAGAGCCCTCTCTGGCCCCAG 0: 1
1: 0
2: 7
3: 90
4: 487
Right 1062609418 9:137367308-137367330 CGCCCGGAGCACAGCCCTGCAGG No data
1062609407_1062609415 12 Left 1062609407 9:137367257-137367279 CCAAGAGCCCTCTCTGGCCCCAG 0: 1
1: 0
2: 7
3: 90
4: 487
Right 1062609415 9:137367292-137367314 TGGAGTCTGCACCCATCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062609407 Original CRISPR CTGGGGCCAGAGAGGGCTCT TGG (reversed) Intronic
900157938 1:1211043-1211065 CTGTGGCTGGAGAGGGGTCTTGG - Intergenic
900157949 1:1211086-1211108 CTGTGGCTGGAGAGGGGTCTTGG - Intergenic
900521235 1:3106404-3106426 CTGGGGCCCGAGGGGGCTGGAGG + Intronic
900582213 1:3414868-3414890 CAGGGGTCAGAGAGGTCCCTGGG - Intronic
900631768 1:3640261-3640283 CTGAGGCCAAGGAGGGCGCTGGG + Intronic
900730462 1:4255586-4255608 CTGGGGTAGGAGAGGGGTCTGGG + Intergenic
900825810 1:4925805-4925827 CTGGGGGCAGAAAAGGGTCTTGG - Intergenic
900995442 1:6121056-6121078 CTGAGGCCAGACATGGCACTGGG + Intronic
901755224 1:11437386-11437408 CTGGGGCAGGACAGGGCTCAGGG - Intergenic
902332640 1:15738119-15738141 CTGGCGGCAGCAAGGGCTCTTGG + Exonic
902796838 1:18805649-18805671 CTTGGGCCAGGGAGCTCTCTGGG + Intergenic
902823334 1:18956520-18956542 CCGAGGCGAGAGAGGGCACTCGG + Exonic
902839446 1:19065991-19066013 CTGGGGCCAGATTGGGTTCAGGG - Intergenic
902989852 1:20179147-20179169 CTGAGGCCACAGGGAGCTCTGGG - Intergenic
903164451 1:21510399-21510421 CTTGGGCCAGGAAGGGCTTTGGG + Intronic
903848032 1:26290052-26290074 CAGGGGCCAGAGAGAGCTGCAGG - Intronic
904004263 1:27355540-27355562 CTAGGGACAGAGGGGGCACTGGG - Intronic
904988632 1:34573469-34573491 CTGGGCCCAAAAAGGGCTGTCGG + Intergenic
905284499 1:36870482-36870504 CTGGGCCCACAGAGGGCTCTGGG + Intronic
905304522 1:37008207-37008229 CTTGGGGCTCAGAGGGCTCTAGG + Intronic
905363256 1:37434643-37434665 CTGGGACCAGAGAGGTAGCTGGG - Intergenic
905464732 1:38144327-38144349 CTGTGGCCTCAGAGGGCTCAGGG - Intergenic
905847190 1:41242448-41242470 CTGAGGCCTGAGAGGGCGCGAGG + Intergenic
906150646 1:43585559-43585581 CAGGGGGCAGGGAGAGCTCTAGG - Intronic
906194228 1:43920090-43920112 CTGTGGCCTGAGGGGGCTCCTGG - Intronic
906314189 1:44775759-44775781 CTGGGGGCTGCGAAGGCTCTGGG + Intronic
907671505 1:56478069-56478091 CAGGGGTCAGAAAGGGCTCTTGG + Intergenic
909321038 1:74286271-74286293 TGGGGGCCAGAGAGAGGTCTGGG - Intronic
911677065 1:100670802-100670824 CTTTGGCCAGAGAGAGTTCTGGG + Intergenic
912704503 1:111902062-111902084 GTGAGGCCGGAGGGGGCTCTGGG - Intronic
913037593 1:114986969-114986991 CTGGTGCCAGAGGGGGCAATAGG + Intronic
914386198 1:147172333-147172355 CTAGGGCCAGTGAGGGCACCGGG - Intronic
915458873 1:156057895-156057917 CTGGGGCCAGAGAAGCCTTTGGG + Intronic
915527859 1:156487204-156487226 CTGGGACGAGAGAGGGATCAGGG + Intronic
915988376 1:160489240-160489262 CTGGGGACACAGTGTGCTCTGGG - Intronic
916252509 1:162752958-162752980 CTGGGGCCATAGAGGAATTTAGG + Intronic
916585071 1:166143252-166143274 AGGGTGCCAGGGAGGGCTCTGGG + Intronic
919745748 1:201008293-201008315 CTGGGGTCAGAGAAGACTCAGGG + Intronic
920099440 1:203507779-203507801 CTAGGGCCAGAGGAGGCTCGTGG + Intronic
920250510 1:204619499-204619521 CTGAGGCCAGAAAAGGCCCTGGG + Exonic
920310008 1:205043372-205043394 CTGGGGCGAGAGAAGGGTGTTGG - Exonic
922415563 1:225419227-225419249 CTGGGCCCAGAGAGGGCAGGTGG - Intronic
922734287 1:227971176-227971198 CTGGGCCCAGAGAGGACGCCCGG - Intergenic
922803250 1:228373533-228373555 CTGGGGTCAGAGAGGACTATGGG - Intronic
922903188 1:229154356-229154378 TTGTGCCCACAGAGGGCTCTGGG - Intergenic
923844352 1:237712362-237712384 CAGGGGTCAGTGTGGGCTCTGGG + Intronic
924172474 1:241356839-241356861 CCGGGGGCCGGGAGGGCTCTGGG + Intronic
924709122 1:246519541-246519563 ATGGGGACAGTGAGGGCTGTGGG - Intergenic
1062844170 10:691135-691157 CTGGGGTCAGGGATGGCTGTGGG - Intergenic
1062972934 10:1662287-1662309 CTGGGGCCAGCCTGGGCTCCTGG - Intronic
1064096699 10:12429168-12429190 CTGAGACCAGAGAGGGCTTGGGG - Intronic
1064447345 10:15407422-15407444 CTGGGGCCAGTGAGCCCTCTGGG + Intergenic
1065655751 10:27947791-27947813 CTGGGGCAGGAGGAGGCTCTTGG - Intronic
1065783300 10:29190494-29190516 CTGGGGGCAGAATGGGCTCTGGG - Intergenic
1066733117 10:38451128-38451150 CTGGGCCCGGAGAGGACGCTGGG - Intergenic
1067088155 10:43253631-43253653 CAAGGCCCAGAGGGGGCTCTAGG + Intronic
1068776018 10:60869167-60869189 CTGGGGCCAGAGAGCGGGTTGGG - Intergenic
1069826136 10:71256393-71256415 CTGGGCCCAGGCAGGGCACTGGG - Intronic
1069871596 10:71536364-71536386 ATGGAGCCAGAGAAGGCCCTGGG + Intronic
1069905235 10:71728393-71728415 CTGGGGGCAGAGAGGCATATGGG - Intronic
1070526610 10:77300910-77300932 GTGGGGCCAGCGAGTGCCCTAGG - Intronic
1071446276 10:85751050-85751072 GTGGGCCCAGAGGGGGCTCTGGG + Intronic
1071896042 10:90068015-90068037 TTGGGGCCACAGAGAGCTCCAGG + Intergenic
1072040410 10:91601191-91601213 GTAGGGCCAGAGAGGGCTGCTGG + Intergenic
1072716486 10:97755971-97755993 CCGGAGCCAGGGAGGGCTCTGGG - Intronic
1073448825 10:103597384-103597406 CTGGGGTGAGAGAGGGCTGCTGG + Exonic
1074024270 10:109617471-109617493 CTTGGGCCAGAGAGTTGTCTTGG + Intergenic
1074065234 10:110007771-110007793 GCGGGGCCAGAGAGAGCTCGGGG + Intronic
1075418102 10:122280421-122280443 CTGGGGACAAGGAGGGCTCTGGG - Intronic
1075634392 10:124020349-124020371 CTGGCACCAGAGCAGGCTCTGGG + Intronic
1075713360 10:124542484-124542506 CTGGGACTGGAGAGGGCGCTGGG + Intronic
1075943517 10:126411313-126411335 CTGGGTCCACAGAGAGCTCTGGG - Intergenic
1077115855 11:884376-884398 CTGGTCTCAGAGAGGCCTCTGGG - Intronic
1077197588 11:1289028-1289050 CTGGGGAAAGCGAGGGCCCTGGG + Intronic
1077230234 11:1455379-1455401 CTGGGGCCAGGGAGGGCGCCCGG - Intronic
1077235221 11:1478845-1478867 CTGGGTCGTGTGAGGGCTCTGGG - Intronic
1078550537 11:12277184-12277206 CTGGGGTGACAGAGGGCTATTGG + Intronic
1079125267 11:17714337-17714359 CTGGGGACAGAGAGGGGACCTGG + Intergenic
1081595958 11:44459672-44459694 ATAAAGCCAGAGAGGGCTCTGGG - Intergenic
1081638928 11:44739762-44739784 CTGGGCCCAGAGACAGCCCTGGG + Intronic
1081745657 11:45470791-45470813 CTGGGGTCTGAGAGGCCTTTTGG - Intergenic
1081847709 11:46252615-46252637 CTGGGGCAGGAGAGGTCACTGGG + Intergenic
1081854821 11:46296591-46296613 CTAGGGCCGCAGAGCGCTCTAGG + Intronic
1082764756 11:57158133-57158155 CTTGGGGCAGGGAGGGCTCTGGG - Intergenic
1082834663 11:57642786-57642808 CTGGACCCTGAGAGGGATCTTGG + Intergenic
1083161290 11:60855816-60855838 GTGGGTCTAGAGAGGGCACTAGG + Intronic
1083288495 11:61676445-61676467 CTGAGGCCAGAGTGGGAACTTGG + Intergenic
1083306401 11:61764240-61764262 CTGAGGCCAGGGAGGGGCCTGGG + Intronic
1083598131 11:63929507-63929529 CTGGTACTAGAGAGGGTTCTGGG + Intergenic
1083602923 11:63960194-63960216 GTGGGGCAGGAGAGGCCTCTGGG - Intergenic
1083732780 11:64661834-64661856 CTGGCCGCAGAGTGGGCTCTTGG - Intronic
1083961757 11:66018542-66018564 CTGGGCCCTGTGAGGGCTCCAGG - Intronic
1083962466 11:66021920-66021942 CTGAGGAGAGAGAGGGCACTGGG - Intronic
1083962755 11:66023423-66023445 CTGAGGAGAGAGAGGGCACTGGG - Intronic
1084425952 11:69084706-69084728 CTGGGGCCGCAGGGTGCTCTGGG + Intronic
1084469141 11:69345094-69345116 CTGAGCTCAGAGAGGGCTCAGGG + Intronic
1084487300 11:69456161-69456183 CTGGGGCCAGACAGGCATCAGGG + Intergenic
1084512619 11:69615705-69615727 CAGGGGCCAGAGAGGCCTCTGGG + Intergenic
1084536985 11:69763033-69763055 GAGTGGCCAGAGAAGGCTCTGGG + Intergenic
1084588335 11:70076347-70076369 TTCTGGCCTGAGAGGGCTCTGGG - Intergenic
1084611986 11:70209067-70209089 CTGGGGCAAGAGAAAGATCTGGG - Intergenic
1085453870 11:76655070-76655092 CTGGGGACAGATAGGACTCCAGG + Intergenic
1085711303 11:78831319-78831341 CTGGGGCCATAGAGGGAGTTAGG - Intronic
1086372104 11:86165170-86165192 CTGGGGCTAAAGCGGGCTCTCGG - Intergenic
1086424853 11:86672984-86673006 TTGGGGCCAGACAGGGATCTTGG + Intergenic
1087081659 11:94176851-94176873 CTGGGGCCAGAAACTGCTCCCGG + Intronic
1088349387 11:108867841-108867863 CTGGGTCCAGAGAGATTTCTGGG - Intronic
1089125431 11:116173155-116173177 CTGGGGACAGAGAAGGCTCTAGG + Intergenic
1089273414 11:117316343-117316365 CCGGGGCTGGAGAGGGGTCTGGG + Intronic
1089318293 11:117607026-117607048 CTGGGACCAGACAGTGTTCTAGG + Intronic
1090131367 11:124145703-124145725 CTGGGGCCAGAGAAGATTCAAGG + Intronic
1090395128 11:126413903-126413925 CTGGGGACAGAGAGGTCCCTGGG + Intronic
1090979897 11:131710454-131710476 CTAGAGCCAGAGAAGACTCTGGG - Intronic
1091009021 11:131981572-131981594 CTGTGGCAAGAGAGGACTGTAGG + Intronic
1091460980 12:643179-643201 CAGGGGCCACCGAGGGCTCCAGG + Intronic
1091593438 12:1858886-1858908 ATGGGAGCTGAGAGGGCTCTTGG - Intronic
1091935800 12:4433576-4433598 TTCCTGCCAGAGAGGGCTCTGGG - Intronic
1092243456 12:6849766-6849788 CTGGGGGCAGAACAGGCTCTGGG + Exonic
1092263209 12:6963250-6963272 CGGAGGCCAGGGCGGGCTCTAGG + Intergenic
1096162081 12:49387171-49387193 CTGGGGCCACACTGGCCTCTGGG - Intronic
1096591846 12:52665290-52665312 CCTGGGCCAGGGAGGGCCCTTGG - Intergenic
1097043885 12:56172950-56172972 CTGGTGCCAGAGACGGCTAAGGG - Intronic
1097058688 12:56266791-56266813 CTGTGGCGAGAAAGGGCACTGGG - Intergenic
1098049128 12:66434772-66434794 CTGGGGGCAGAGAGGGCCTTTGG + Intronic
1101824538 12:108210024-108210046 CTGGGGGATGGGAGGGCTCTGGG - Intronic
1102012174 12:109625596-109625618 CTGAGGACAGAGAGGGCTTAGGG - Intergenic
1104934331 12:132356448-132356470 CTGGGGCCGGGCAGGGGTCTTGG - Intergenic
1105837575 13:24224341-24224363 CTGGGGGCTCTGAGGGCTCTGGG - Exonic
1106408265 13:29493054-29493076 CTGGGGGAAGAGAGTGTTCTAGG + Intronic
1109433352 13:62266466-62266488 CTGGGGTCACAGAGAGCTTTAGG + Intergenic
1110412840 13:75222457-75222479 GTGGGGCTAGATAGGACTCTGGG - Intergenic
1113428229 13:110227924-110227946 CAGGGACCAGGAAGGGCTCTGGG - Intronic
1113889126 13:113726733-113726755 CTGGGAGCTGAGAAGGCTCTGGG + Intronic
1113929483 13:113958818-113958840 CAGGGGCCAGAGAGGCCCCAAGG - Intergenic
1113948747 13:114059587-114059609 CTGCGGGCACAGAGGGCGCTCGG + Intronic
1114524484 14:23359499-23359521 CTGGGGCAGGAGAGGGCACTGGG + Exonic
1115715128 14:36095006-36095028 CGTGGGCCAGAGTGCGCTCTTGG - Intergenic
1116396464 14:44452912-44452934 ATGGGGGCAGAGTGGGCTATGGG + Intergenic
1116400222 14:44497383-44497405 CTGGGGACAAAGAGGCTTCTGGG - Intergenic
1116499948 14:45608346-45608368 CAGGTGCCTGAAAGGGCTCTTGG - Intergenic
1116958188 14:50944636-50944658 CTGGGGCCGCAGTGGGCTCGGGG + Exonic
1117273642 14:54170316-54170338 CTGGGACCAGCCATGGCTCTTGG - Intergenic
1117493240 14:56273687-56273709 CAGTGGCAAGAGAGGGCTCAGGG + Intronic
1117828404 14:59726971-59726993 CTGCGGCCACAAAGGGCCCTGGG - Exonic
1118316775 14:64730538-64730560 CAGGGGACAGAGGGTGCTCTGGG + Intronic
1118887848 14:69881137-69881159 CTGGGGCAAGTAAGGGCTCCAGG + Intronic
1119147576 14:72331009-72331031 CCCAGGCCAGAGAGGGCTTTCGG + Intronic
1119632808 14:76248741-76248763 CTGGAAGCAGAGAGGACTCTGGG + Intronic
1120521922 14:85534051-85534073 CGAGGGCCAGGAAGGGCTCTGGG - Intronic
1121168757 14:91836058-91836080 CGGGGGCCTGAGAGAGCTTTAGG - Intronic
1121220196 14:92279211-92279233 CAGGGGACAGAGAGGGCTTGAGG + Intergenic
1121494368 14:94381738-94381760 CTGGGGCTGGAGAGGGACCTGGG + Intronic
1121579260 14:95014617-95014639 CTAGGTCCAGAGGGGGATCTTGG - Intergenic
1121787104 14:96670352-96670374 CTGGAGCCGAAGTGGGCTCTAGG + Intergenic
1122283596 14:100638428-100638450 CTGGGACAAGACAGGGCTGTTGG - Intergenic
1122694503 14:103546223-103546245 CTGGTCCCAGTGGGGGCTCTGGG - Intergenic
1122767551 14:104082439-104082461 CAGGGGCCAGAGTGGGGCCTGGG - Intergenic
1122790040 14:104180371-104180393 CTCGGGACAGAGCGGGTTCTCGG - Intronic
1122810281 14:104284333-104284355 CTGGGCTGAGAGAGGACTCTGGG + Intergenic
1122842670 14:104473960-104473982 ATGGGGCCAGAAGGGGCTCGAGG - Intergenic
1122939095 14:104973300-104973322 CGGGGGCCAGGGAGGGCTGAGGG + Intronic
1123062282 14:105599690-105599712 GTGGGGGCAGAGAGGGCCCGGGG + Intergenic
1123087024 14:105721418-105721440 GTGGGGGCAGAGAGGGCCCGGGG + Intergenic
1123759757 15:23423131-23423153 CTGGAGCCAGAAAGGAATCTGGG - Intergenic
1124497363 15:30194599-30194621 CTGGGGCCTGAAGGGGCTTTGGG - Intergenic
1124746210 15:32344048-32344070 CTGGGGCCTGAAGGGGCTTTGGG + Intergenic
1125483303 15:40095126-40095148 TTGTAGCCAGAGAGGGCTCATGG - Intronic
1127726982 15:61759936-61759958 CTTGGGCTAGACAAGGCTCTGGG - Intergenic
1127910642 15:63413294-63413316 CTGGGTCCAGAGATGTCGCTAGG - Intergenic
1128443142 15:67732008-67732030 CTGGGGTCAGTGAGGGCTCTGGG - Intronic
1129110989 15:73336968-73336990 CTGTGGCCAGAGATGGCTTTGGG - Intronic
1129190443 15:73934359-73934381 GTGAGGCCAGGGAGGGTTCTGGG - Intronic
1129336143 15:74853294-74853316 CTGGGGCCTGGGAGGGGTGTGGG + Intronic
1129504711 15:76071725-76071747 CTGGGGTCAGTGAGGGGTCTGGG - Intronic
1129706272 15:77796338-77796360 CTGGGGGCAGGCAGGGCTCTGGG + Intronic
1129838690 15:78730130-78730152 CAGCAGCCAGAGAGGGGTCTTGG - Intergenic
1129890287 15:79067205-79067227 CAGGGGCCAGGGCGAGCTCTGGG + Intronic
1130540463 15:84817698-84817720 CTTGGGGCTGAGAGGGCTCGAGG - Intronic
1130567315 15:85007839-85007861 TTGTGGTCAGAGAGAGCTCTTGG + Intronic
1130897386 15:88181997-88182019 CTGGGACCAGAGGAGGGTCTTGG - Intronic
1131257780 15:90872996-90873018 CTGTGGCCAGAGAGAGCTGTGGG - Exonic
1132702389 16:1227375-1227397 GTGGGGCTGGAGAGGGCACTGGG + Intronic
1132705935 16:1243493-1243515 GTGGGGCTGGAGAGGGCGCTGGG - Intergenic
1133167284 16:3957286-3957308 CTGAGGCCAGAGGAGGCTCCAGG + Intronic
1133253577 16:4501897-4501919 CTGGGGGCAGAGGAGGCTCCTGG - Intronic
1134689428 16:16181537-16181559 CTGGGGCCAGAGTGTGCTGTGGG + Intronic
1135401030 16:22166184-22166206 CTGGGCTCAGACAGGGGTCTGGG + Intergenic
1135885437 16:26301913-26301935 CTGGGCTCAGAGAAGGCACTGGG - Intergenic
1136028849 16:27488311-27488333 TTCGGTCCAGCGAGGGCTCTCGG + Exonic
1136140276 16:28283876-28283898 CTGAGGCCAGAGAAGACCCTGGG - Intergenic
1136579336 16:31142430-31142452 CGCGGGCCCGAGAGGGCTCTAGG - Intronic
1137020399 16:35420070-35420092 CTGGAGCCAAACAGGGCTGTGGG - Intergenic
1140997139 16:80272044-80272066 CTTAGGCCAGGGAGGGATCTTGG - Intergenic
1141689356 16:85587682-85587704 CTGGGGCAGGAGAGGGTTCTCGG - Intergenic
1142123866 16:88400632-88400654 GTGGGGACAGAGCTGGCTCTGGG - Intergenic
1142433458 16:90042910-90042932 CTGTGGTCTGGGAGGGCTCTGGG - Intronic
1142498680 17:320262-320284 ATGGGACCAGCGAAGGCTCTCGG + Intronic
1142642752 17:1294226-1294248 GTGGGGACAGAGAGGGTCCTAGG - Intronic
1143525142 17:7467438-7467460 CTGTGGCCAGAGAGGACACCTGG + Intronic
1143594270 17:7905057-7905079 CAGTGGTCAGGGAGGGCTCTCGG - Intronic
1143670427 17:8392661-8392683 CTGGGCACAGAGAGGGCCTTGGG - Exonic
1144643431 17:16952369-16952391 GTGGGGCCAGAGGGTGCTCTAGG + Intronic
1144770541 17:17757114-17757136 CGGGGTCCAGGGAGAGCTCTTGG + Intronic
1144779229 17:17799577-17799599 CAGGGGCCAGAGAAGGCTGCAGG - Intronic
1145205304 17:20981679-20981701 GTGGGGCCAGAGGGTGCTCTGGG - Intergenic
1145863826 17:28227727-28227749 GTGGGGCCAGACCGCGCTCTCGG - Intergenic
1146290473 17:31603053-31603075 ATGGGGGCTGAGAGGCCTCTCGG - Intergenic
1146658839 17:34651403-34651425 CTGGGGGCATTGAGGGCACTTGG - Intergenic
1147328253 17:39680563-39680585 CTGGAGACACAGAGGTCTCTAGG - Intronic
1148106063 17:45119634-45119656 CTGGGCCAAGACAGGGCCCTTGG + Intronic
1148127034 17:45242263-45242285 CTGGGCCCAGGGAGGGCTGATGG - Intronic
1148439827 17:47706224-47706246 CAGGGGAAGGAGAGGGCTCTGGG - Intronic
1148543904 17:48502416-48502438 CTGGGGGAAAAGAGGGCTGTGGG - Intergenic
1148647917 17:49230004-49230026 CTGGTGCCAGTGAGGCGTCTGGG + Intronic
1148771778 17:50071540-50071562 CTGGGGCCAGGGAGAGCGATGGG + Intronic
1150282289 17:63935719-63935741 CTGATGCCAGAGAGGGCTCCAGG + Intergenic
1151252257 17:72845339-72845361 CTGTGGCCACAGTGGACTCTTGG + Intronic
1151349617 17:73524119-73524141 CTGGGGCCAGGGAGGGCAAATGG - Intronic
1151536233 17:74740473-74740495 CTGGGGCCACAGAGCACACTTGG + Intronic
1151556010 17:74847133-74847155 CTGGGGCAAGAGATGGCTCAGGG - Intronic
1151681879 17:75626689-75626711 CTGGGGCCAAAGCGGGCTGCAGG + Intergenic
1151702872 17:75752639-75752661 CTGGGTCCAGAGAGGGCAAAGGG + Intronic
1151954349 17:77373165-77373187 CTGGGGCCCGAGTGGCCGCTGGG - Intronic
1151975823 17:77483073-77483095 CGGGGTCCAGGGAGGGGTCTGGG + Intronic
1152363407 17:79842548-79842570 CTGGGGCCCCTGAGGGCCCTGGG - Intergenic
1152424450 17:80211334-80211356 TTGGGGCCAGAGAGAGATGTGGG + Intronic
1152459490 17:80433695-80433717 AGGGGGGCAGAGATGGCTCTGGG + Intronic
1152786148 17:82249087-82249109 CTGTGGCCAGAGAGGACCCTGGG + Intronic
1152861034 17:82697401-82697423 CTGGGGCCTGGGAAGGGTCTGGG - Intronic
1156216758 18:35007023-35007045 CAGGGGCCAGAGCAGGCTCTAGG + Intronic
1156480350 18:37432341-37432363 CTGGGCCCAGAGGGGGAGCTTGG + Intronic
1156516644 18:37685932-37685954 CTGGTGCTAGGGAGGGCTCCAGG - Intergenic
1158527306 18:58226634-58226656 CTGGGGACAGGGAAGGCTTTGGG + Intronic
1158542592 18:58370162-58370184 GTGGGGCCAGAAAGGCCTCTGGG - Intronic
1159946464 18:74447726-74447748 CTGGGGGCAGATAGGGCTCCTGG - Intronic
1160240622 18:77119901-77119923 CAGGAGACAGAGAGGGCCCTGGG + Intronic
1160319279 18:77875149-77875171 ATGGGCACAGAGAGGGCTGTGGG - Intergenic
1160490879 18:79335977-79335999 CTGGTGCCAGGGAGGGCTCCTGG - Intronic
1160508178 18:79438762-79438784 CTGGCCCCAGGGAGGGCTCCTGG + Intronic
1160663880 19:313835-313857 GTGGGTCCAGAGCAGGCTCTGGG + Intronic
1160846197 19:1167307-1167329 CTGGGCCCAGAGAGGGCGCGTGG - Intronic
1161067894 19:2247562-2247584 CGGGGGACAGAGAGGGCTCCTGG - Intronic
1161073391 19:2273537-2273559 CTGGGACCACAGAGGGCCCTGGG + Intronic
1161154725 19:2726741-2726763 CTGGGGCCAGATAGTTCTCTGGG - Intronic
1161237678 19:3206032-3206054 CTGGCGGCACAGAGGGCTCAGGG - Intronic
1161358143 19:3831252-3831274 TTGGGGACAGAGAGGTCCCTGGG + Intronic
1161619445 19:5290591-5290613 CTCGGGCCAGAGGAGGCTCCCGG + Intronic
1162283873 19:9723228-9723250 CTGGGAACAGAGAAGACTCTTGG + Intergenic
1162792472 19:13070162-13070184 CAGGGCCCAGAGAGGCCACTAGG - Intronic
1162840083 19:13349905-13349927 CCTGGGCCAGAGAAGGCTCTGGG - Intronic
1163440253 19:17319183-17319205 ATGGGTCCAGAAAGTGCTCTGGG + Intronic
1163469376 19:17487633-17487655 CTGGGGACAGAGAGGGCAGCTGG + Intronic
1163661335 19:18579604-18579626 CAGGGGCCAGTGGGGTCTCTTGG - Intronic
1163698780 19:18776952-18776974 CTAGGGCCAGACTGGTCTCTGGG + Intronic
1163738440 19:18995938-18995960 CTGGAGACAGACAGGGCCCTGGG + Intronic
1163775498 19:19215033-19215055 CAGGGACCAGAGAGGGCTAGAGG - Intronic
1163819771 19:19489573-19489595 ATGGGGCCAGGGAGCGCTGTGGG + Intronic
1164983292 19:32630246-32630268 CTGGAGCCAGAGTGGGTCCTGGG - Intronic
1165128523 19:33617887-33617909 CTGGGGCCTGTGTGGGCTCCGGG - Intergenic
1165843262 19:38802158-38802180 CTGGGGACAGAGAGGGATGGGGG + Intronic
1166042573 19:40212782-40212804 CTGGGTCCAGAGAAGCCACTTGG - Intronic
1166287155 19:41838310-41838332 CTGGGGGGAGGGAGGACTCTGGG - Intronic
1166720087 19:44991526-44991548 CTGGGGTCAGAGAGGACTTCAGG + Intronic
1167106929 19:47435897-47435919 CTGGGGCTAGAGAGAGCTTGTGG - Intronic
1167139611 19:47640643-47640665 ATGGGGGCAGAGAGGGCTGGCGG + Intronic
1167320702 19:48795888-48795910 CTGGTGCCAGAGAGGGGCCAAGG + Intronic
1167846828 19:52171566-52171588 CTGGGGCGGGAGAGGGGCCTGGG + Intronic
1168188075 19:54714049-54714071 CAGGGTCCAGAGAGGGTGCTAGG - Intergenic
1168643470 19:58045039-58045061 CCGGGGGCAGAGAGGGTGCTGGG + Intronic
1168643863 19:58047475-58047497 CTTGGGTCAGAGATGGCTCTTGG - Intronic
925609355 2:5691461-5691483 CTGGCTCCGGAGCGGGCTCTGGG - Intergenic
925907068 2:8545913-8545935 CTGAGGCCCGAGAGAGCCCTTGG + Intergenic
925999046 2:9315465-9315487 CTGGGGTCAGAGATGACTCTTGG + Intronic
927485941 2:23488431-23488453 ATGGGGCCTTGGAGGGCTCTTGG + Intronic
927851830 2:26504308-26504330 CAGGGACCAGAGAGGACTCAGGG + Intronic
927872735 2:26633877-26633899 CTGAGGCCCGAGAGGGGACTTGG - Intronic
927893965 2:26769561-26769583 CAGGGGCCAGAGAGGGCTCGAGG - Intronic
928536946 2:32250271-32250293 CTGTCTCCAGAGAGGCCTCTTGG + Exonic
930248129 2:49005588-49005610 CTGGGGGAAGAGAGGGTTTTAGG + Intronic
930671914 2:54160270-54160292 CTGGGGGAAGGGATGGCTCTGGG + Intronic
930780796 2:55223625-55223647 CTGGGGCGAGGGAGGGCGCGCGG + Intronic
931688649 2:64816485-64816507 CTGGGGCCTGTGTGGGCACTGGG - Intergenic
932428506 2:71659042-71659064 CTGGGGGAGGTGAGGGCTCTAGG - Intronic
932621439 2:73266688-73266710 CTGGGGTAAGAGACTGCTCTGGG - Intronic
932997502 2:76873316-76873338 GTTGTGCCAAAGAGGGCTCTGGG - Intronic
933764630 2:85698262-85698284 ATGGGGCCAGAAAGGGGCCTCGG + Intronic
934069947 2:88374563-88374585 CTGGGGCAAGAGAGGGAAATGGG + Intergenic
934764994 2:96875679-96875701 CTTGGGCCACAGTGGGCTGTAGG + Intergenic
935268388 2:101413629-101413651 CAGAGGACACAGAGGGCTCTTGG + Intronic
938073450 2:128319926-128319948 TTCAGGCCAGCGAGGGCTCTGGG + Intergenic
938867556 2:135438828-135438850 CTGAGGCCAGACAGAGCACTGGG + Intronic
939288001 2:140157316-140157338 CTAGGGGCAGAGAGAGCTGTGGG - Intergenic
940398817 2:153222899-153222921 CTGGGTCCAGAGAGGCGGCTGGG + Intergenic
940427812 2:153550982-153551004 GGGTGGCTAGAGAGGGCTCTTGG + Intergenic
942420854 2:175806061-175806083 CTGAGGTCAGAGCTGGCTCTAGG - Intergenic
944250428 2:197575532-197575554 CTGAGGGCAGAGAATGCTCTTGG + Intronic
945196957 2:207245676-207245698 CTGGGGGCAGGGAGTTCTCTGGG - Intergenic
945978281 2:216287461-216287483 CTGGGGCCAGAGACTGCCCTGGG + Intronic
946374121 2:219297907-219297929 CTGGGGCCTGAGGGGGCCCATGG - Exonic
946621756 2:221570373-221570395 CTGGGGCGAGAGAGGTCTCAGGG + Intronic
947200147 2:227607741-227607763 CGGGGACCTGAGAGGACTCTTGG + Intergenic
947565909 2:231192913-231192935 TAGGGCCCACAGAGGGCTCTAGG + Intergenic
947665704 2:231904237-231904259 CTGGGGCAAGGAAGAGCTCTGGG - Intergenic
947745095 2:232503312-232503334 CTGGCCCCAGGGAGGGGTCTGGG + Intergenic
948015096 2:234682631-234682653 CTGGGACCAGAGAGGCCAGTTGG + Intergenic
948176412 2:235946899-235946921 CTGGGGTCAGAAAGGCCTCACGG - Intronic
948246236 2:236488903-236488925 CTGGGGCCTGTGTGGGCTCTGGG + Intronic
948246259 2:236488989-236489011 CTGGGGCCTGTGTGGGCTCTGGG + Intronic
948246280 2:236489075-236489097 CTGGGGCCTGTGTGGGCTCTGGG + Intronic
948246304 2:236489161-236489183 CTGGGGCCTGTGTGGGCTCTGGG + Intronic
948246334 2:236489275-236489297 CTGGGGCCTGTGTGGGCTCTGGG + Intronic
948246342 2:236489304-236489326 CTGGGGCCTGTGTGGGCTCTGGG + Intronic
948246350 2:236489333-236489355 CTGGGGCCTGTGTGGGCTCCGGG + Intronic
948246359 2:236489362-236489384 CTGGGGCCTGTGTGGGCTCTGGG + Intronic
948246374 2:236489419-236489441 CTGGGGCCTGTGTGGGCTCTGGG + Intronic
948316619 2:237032191-237032213 GTGGGGTCAGAGGGGTCTCTGGG - Intergenic
948566596 2:238891324-238891346 CTGGGCACAGTGAGGGCGCTGGG - Intronic
948830063 2:240594328-240594350 CTGGGAAAAGAGAGGGCTCCAGG + Intronic
1168854320 20:998117-998139 CTAGGGCAGGAGAGGGCTCAAGG + Intronic
1168970795 20:1929528-1929550 CTTCTGCCAGAGAAGGCTCTGGG + Intronic
1171111824 20:22491179-22491201 CTGGGTCCAGGCTGGGCTCTGGG - Intergenic
1171117296 20:22535900-22535922 CTTGGACCAGAGAAGGGTCTTGG + Intergenic
1171494006 20:25542093-25542115 CTGGTGCCAGAGTGGGCAGTGGG + Intronic
1172101655 20:32487395-32487417 TGGGGGCCAGGGTGGGCTCTGGG + Intronic
1172170839 20:32931014-32931036 CTAGGGCCAGAAAGGGCCTTAGG - Intronic
1172479189 20:35260918-35260940 CTGGGGCCAGAGTGGGCAGTAGG + Intronic
1172484729 20:35291350-35291372 CTGAGGCCAGAGAGGGGCTTGGG - Intronic
1172650284 20:36497574-36497596 CCAAGGCCCGAGAGGGCTCTGGG - Intronic
1172810722 20:37646069-37646091 ATGGGGCCAGGAGGGGCTCTTGG + Intergenic
1173163468 20:40669814-40669836 CTGGGCACAGAGGAGGCTCTAGG + Intergenic
1173282192 20:41638844-41638866 CTGGAGGCAGAGGGGACTCTAGG - Intergenic
1173977126 20:47195455-47195477 CAGGGGCCATAAAGGGGTCTTGG + Intergenic
1174197836 20:48786020-48786042 GTGGGGCCTGAGCGGGCTCATGG + Intronic
1174464549 20:50707185-50707207 CTGGAGCCATTGAGGGCTTTAGG + Intergenic
1175080607 20:56417407-56417429 CGTGGTCCAGAGAGGCCTCTGGG - Intronic
1175292130 20:57882799-57882821 CTGGGGGCTCACAGGGCTCTGGG + Intergenic
1175418284 20:58815954-58815976 CTGGGGGCAGTGAGGGCTGCAGG + Intergenic
1175704343 20:61165077-61165099 CTGGGCACTGAGAGGTCTCTGGG - Intergenic
1175925765 20:62470655-62470677 CTGGTGCCAGAGGTGGCTCAGGG + Intronic
1175935707 20:62512990-62513012 GTGGGGGCAGAGAGTGCTCCAGG - Intergenic
1176000012 20:62827454-62827476 CTGGGGCCAGGGAGAGAGCTCGG - Intronic
1176214353 20:63941252-63941274 CTGTGGGGAGGGAGGGCTCTGGG - Intronic
1176268749 20:64224301-64224323 CTGGGGCCAGACAGGATCCTGGG + Intronic
1176427435 21:6557538-6557560 CCGGGGGCAGGGAGGGCTCTAGG - Intergenic
1176957532 21:15123616-15123638 CTGATGGAAGAGAGGGCTCTAGG - Intergenic
1177327249 21:19607008-19607030 CTGGAGCCAGAGTAGGCTCAGGG + Intergenic
1178675862 21:34631296-34631318 CTGGAGCTAGGGAGGGCTCCTGG + Intergenic
1179146639 21:38774169-38774191 CTGGAGCAAGAGTGGGCTATGGG + Intergenic
1179412535 21:41173334-41173356 CTGCGGCAAGAGAGTGCCCTGGG + Intronic
1179702926 21:43165855-43165877 CCGGGGGCAGGGAGGGCTCTAGG - Intergenic
1179710086 21:43208219-43208241 CTGGGGTCAGAGAAGGGGCTGGG + Intergenic
1180981538 22:19880284-19880306 CTGGAGTCAGGGAGGGCCCTTGG + Intronic
1181000291 22:19984999-19985021 CTGGGGCCAGACAGGGATCCAGG - Intronic
1181028366 22:20138328-20138350 CTGAGGCCAGAGGGGCTTCTTGG + Intronic
1181033769 22:20160320-20160342 CTGAGGCCAGAGAGGGCTGAAGG - Intergenic
1181433008 22:22894333-22894355 GAGGGCACAGAGAGGGCTCTGGG + Intronic
1181541276 22:23574495-23574517 GAGGGCACAGAGAGGGCTCTGGG - Intronic
1181551178 22:23639856-23639878 TGGAGGGCAGAGAGGGCTCTGGG - Intergenic
1181630180 22:24147074-24147096 CTGGGGGCAGAGGGGGCTGTGGG - Intronic
1181797105 22:25318827-25318849 GAGGGCACAGAGAGGGCTCTGGG + Intergenic
1182012381 22:27011653-27011675 CTGGGGCCAGACAGTGATCAGGG + Intergenic
1182295002 22:29307270-29307292 CTGGGCCCAGAGAGGGTGCGGGG - Intronic
1182401423 22:30080516-30080538 CTCGGCCCAGAGAGGGCACTCGG + Intronic
1182437336 22:30339090-30339112 CGGGGGGCAGAGAAGGCACTAGG + Intronic
1182611234 22:31549204-31549226 CTGAGCCCAGGGAGGGCTCAAGG + Intronic
1183367800 22:37416530-37416552 CTGGGGAGCGAGAGGGCTCAAGG + Intronic
1183408209 22:37640531-37640553 CTGGGTCCAGGGAGGGGACTGGG + Intronic
1183624480 22:38993173-38993195 CTGGGCCCAGAGAGAGGGCTGGG + Intergenic
1183640223 22:39088189-39088211 CTGGGCCCAGAGAGAGGGCTGGG + Intergenic
1184062062 22:42089234-42089256 CTGCAACCAGAGAGGGTTCTGGG + Intronic
1184253675 22:43275196-43275218 CTGGGGCTGGAGAGGCCTCGTGG + Intronic
1184369081 22:44071087-44071109 CTGGGGCCAGTGTGGGGTGTGGG + Intronic
1184652078 22:45924046-45924068 CTGGGGTCAGGGCTGGCTCTGGG - Intronic
1184711094 22:46250015-46250037 CTGGGGCGAGAGAGGGCAGGCGG - Intronic
1184735611 22:46396026-46396048 CTGGGCCCAGTGAGGACTCCAGG + Intronic
1184981258 22:48097335-48097357 CCAGGGCCAGAGAGGGCTGTTGG - Intergenic
1185117014 22:48943810-48943832 CAGGGGCCAGACAAAGCTCTCGG + Intergenic
1185167401 22:49270105-49270127 CTGGGGTCAGAGAGTGCACGGGG + Intergenic
1185279735 22:49964931-49964953 CAGGGGGCAGACAGGGCTCCAGG - Intergenic
1185301605 22:50083922-50083944 CTGGGGACAGAGGCGGCTCCCGG - Intronic
950008233 3:9704802-9704824 CTGGGCCGGGAGGGGGCTCTGGG - Intronic
950612900 3:14137494-14137516 CTGGGGGAAGACAGGGCTTTGGG - Intronic
950675961 3:14554622-14554644 GTGGGGCAGCAGAGGGCTCTAGG - Intergenic
950769728 3:15301827-15301849 TTGGGGGCAGAGATGGCTCTAGG - Intronic
951062461 3:18225349-18225371 CTGGTGCCAGAGATGGTTTTTGG - Intronic
952818469 3:37465849-37465871 CTGGCACCAGAGGGGGCACTGGG + Intronic
952889713 3:38031727-38031749 CTGGGCCCACAGACGGCCCTGGG - Intergenic
952901712 3:38115544-38115566 GTGGGGGCAAAGAGTGCTCTGGG + Intronic
952970185 3:38645787-38645809 GTGGGGTCAGGGAGGGCTGTCGG - Intronic
953209609 3:40864131-40864153 CAGCAGCCAGAGAGAGCTCTCGG - Intergenic
954201544 3:49026193-49026215 CTGGGGCCAAATTGGCCTCTTGG - Intronic
954257117 3:49414655-49414677 CTGGGCCCAGGGTGGGCTGTGGG + Intronic
954644900 3:52125289-52125311 CTGTGGGCTGAGTGGGCTCTCGG - Intronic
954741357 3:52753361-52753383 CTGTGGCCAGAGATGCCGCTGGG + Intronic
954745268 3:52784225-52784247 GTGGGGCACGAGGGGGCTCTGGG - Intronic
954745486 3:52785314-52785336 CTGGGGAAAGAGAGGCCTCTGGG - Intronic
955835422 3:63049097-63049119 CTGTGGCCAGAGAAAGCCCTCGG - Intergenic
956736965 3:72245537-72245559 CTGGGGCAAGGGATGGCTCTGGG - Intergenic
958156643 3:89763036-89763058 CAGGGGCCAGGGAGCTCTCTGGG - Intergenic
961373067 3:126443361-126443383 CTGGGGCAAGAGAGGTGCCTGGG + Intronic
961378973 3:126484887-126484909 CTGCAGCTAGAGAGGCCTCTTGG + Intronic
961518452 3:127453113-127453135 CTGTGGCCAAACAAGGCTCTTGG - Intergenic
961880565 3:130058687-130058709 CAGGAGCCAGAGTGGGCCCTGGG + Intergenic
962192110 3:133321821-133321843 CTGTGGTCTGAGAGGGCACTTGG - Intronic
962274053 3:133998980-133999002 AGGGGGCAAGAGAGTGCTCTAGG - Intronic
962387541 3:134944120-134944142 CTGGGGCCATAGAGGGAAATGGG - Intronic
962597269 3:136959344-136959366 CTGGGGTCAAAGAGAGGTCTTGG - Intronic
963727362 3:148937397-148937419 CTGGTGACAGGGAGGGATCTGGG - Intergenic
963848448 3:150183101-150183123 CTGGGCTCAGAGAAGGATCTAGG + Intergenic
965424299 3:168502328-168502350 CTGGGGCTAGCGAGGTCACTAGG - Intergenic
965757036 3:172038215-172038237 CTGGAGCCAGAGAAGGCATTTGG + Intergenic
966878710 3:184337846-184337868 CTGGGGCCAGACAGGGCATCAGG + Intronic
967408025 3:189138870-189138892 AAGGGGTCAGGGAGGGCTCTAGG + Intronic
968480884 4:832599-832621 GTGGGGCCAGGAAGGGCACTGGG + Intergenic
968702528 4:2063676-2063698 CTGGGGTGAGACAGGGCCCTTGG - Intronic
968901803 4:3435573-3435595 CTGGGGGGAGACAGGGCTCTGGG - Intronic
968975582 4:3820643-3820665 CTGGGGCCAGTGAGTGCTCAGGG - Intergenic
969265195 4:6059845-6059867 GGGGAGCCAGAGAGGGCTCTGGG - Intronic
969566523 4:7982011-7982033 CTGGGGCCAGAGAGGGGAGAAGG - Intronic
970348022 4:15172791-15172813 CTGGGGCAGGAGGGAGCTCTAGG - Intergenic
972661757 4:41123079-41123101 CTGGGGCAAGAGAGGGCTGCTGG - Intronic
978993206 4:115113587-115113609 CTGGAGCTAGAGAGTGCTCTTGG - Exonic
979328899 4:119406487-119406509 CTGGGCCCAGAGAGGACACCCGG + Intergenic
982207251 4:153006014-153006036 CTGTGGCCAGTGTGAGCTCTAGG + Intergenic
984851200 4:184154088-184154110 GAGGGTGCAGAGAGGGCTCTGGG - Intronic
985664827 5:1176684-1176706 CTGGGGCCAGAGCCGGGGCTGGG - Intergenic
985717385 5:1470291-1470313 CTGGGGGCTGAGTGGGGTCTGGG - Intronic
985885709 5:2676147-2676169 GTGAGGCCAGGGTGGGCTCTGGG - Intergenic
986341278 5:6791351-6791373 CAGGGGCCAGGGAGGGTTGTTGG - Intergenic
986495780 5:8340315-8340337 GTGTGGCCAGCTAGGGCTCTTGG - Intergenic
986726497 5:10601890-10601912 ATGGGGCCAGGGATGACTCTTGG + Intronic
988528547 5:32007806-32007828 CAGGGGCCAGGGAGGGGGCTGGG - Intronic
988733855 5:34001311-34001333 CTGGGGCCAAAGAGGACTTATGG + Intronic
991707168 5:69369401-69369423 CTGGGGGCGCAGAGTGCTCTGGG - Intronic
992199362 5:74368642-74368664 CTGAGGCCAGAGAGGTGCCTAGG - Intergenic
997418179 5:133745228-133745250 CTGGGTCCATAGAAGGCCCTTGG - Intergenic
997720354 5:136073772-136073794 CTGGGCCAAGAGGGGTCTCTGGG + Intergenic
998039844 5:138945084-138945106 CTGGGGGCAGAGGGGACACTGGG + Intergenic
999389611 5:151180613-151180635 CTGTGGCCAGGGAGGGAGCTAGG - Intergenic
1000142637 5:158421004-158421026 CTGGGGTCACTGAGGGCTTTGGG - Intergenic
1000288404 5:159847336-159847358 CTGGCGCCAGAGTGGGAGCTGGG - Intergenic
1000434990 5:161197180-161197202 CTGAGCCCAAAGAGGGCTCAGGG + Intergenic
1001535982 5:172498132-172498154 CTGCGGCTAGAGAGGGCTGAGGG - Intergenic
1001955744 5:175847109-175847131 GTGGGGCCAAGGAGGGCTTTAGG + Intronic
1002695381 5:181085027-181085049 GTGGGGACAGAGAGGGTCCTGGG + Intergenic
1003571429 6:7258770-7258792 GTGGGGTCAGAGAGGGCACCTGG + Intergenic
1003891588 6:10568491-10568513 CTCGGGCCAGAGAGACCACTTGG - Intronic
1005515571 6:26550908-26550930 CTGGGGCCAGAGGGCTCCCTGGG - Intergenic
1005713683 6:28526358-28526380 ATGTGGCCAGAGAGGTCTCCAGG - Intronic
1006815229 6:36845486-36845508 CTGGGGGCAGAAAGGGCTACTGG - Intergenic
1007230516 6:40344825-40344847 CTGGGGTCTGAGTGGGTTCTGGG - Intergenic
1007343644 6:41209873-41209895 CAGGAGCCACAGAGGTCTCTGGG + Intergenic
1007346653 6:41236321-41236343 CAGGAGCCACAGAGGTCTCTGGG - Intronic
1007485162 6:42175821-42175843 CTGGGGGCAGAGAGGGTCCCAGG - Intronic
1007663063 6:43498116-43498138 CTGAGGCCAGAGAGCTCTCTTGG + Intronic
1010951306 6:82040371-82040393 CTAGGGACAGTGAGGGCTGTAGG - Intergenic
1011111979 6:83848867-83848889 CTGGGTCCATAAAGGGATCTTGG - Intergenic
1011345538 6:86366040-86366062 CTGGGACAAGAGAGGGTTCAGGG - Intergenic
1013428814 6:110038078-110038100 CTAGGGCCAGAGAGGGATTTGGG - Intergenic
1014352620 6:120363359-120363381 CTGGGGGAAGAGATGGCTATGGG - Intergenic
1016295024 6:142564780-142564802 CTGTGGCCAGGGATGGCTCAAGG - Intergenic
1016844106 6:148554136-148554158 CTGGGGACAGAGAGGGCCAGAGG + Intergenic
1017066178 6:150531355-150531377 CAGGGGCCAGTGAGGGGGCTAGG - Intergenic
1018811479 6:167301229-167301251 CTGTGGCCAGAGAGCACACTGGG - Intronic
1018865792 6:167746198-167746220 GTGGAGCCTGGGAGGGCTCTGGG - Intergenic
1018901761 6:168055111-168055133 GTGGGGCCAGAGAAGCTTCTCGG + Intergenic
1018909703 6:168094951-168094973 CAGGGGCCAGAGCAAGCTCTGGG + Intergenic
1019406266 7:885747-885769 CTGGGACCAGAAAGGCCACTGGG - Intronic
1019554590 7:1622600-1622622 CTGAGGGCAGAGAGGTCTCACGG - Intergenic
1019803436 7:3105254-3105276 CTGGGGCCAGAGAAGGGGCTTGG - Intergenic
1020604180 7:10315286-10315308 AAGGGGCCAGAGAGCTCTCTGGG + Intergenic
1022469027 7:30670629-30670651 CTGTGGCCAATGAGGGCACTGGG + Intronic
1022472642 7:30691167-30691189 CTGGGGACAGTGAGGGCTCTAGG + Intronic
1022474116 7:30699351-30699373 ATGGGGACAGAGTGGGCTCTGGG - Intronic
1022650259 7:32267487-32267509 CTGGGGCCAAGGAGGGCTTCTGG + Intronic
1024021152 7:45372238-45372260 CTGGTGCCAGAGAAGGGTCAAGG - Intergenic
1024074795 7:45812920-45812942 CTGGGCCTGGAGAGGCCTCTGGG - Intergenic
1025035242 7:55589601-55589623 CTTGGTCCAGGCAGGGCTCTGGG - Intergenic
1025728172 7:64087208-64087230 ATGGGGCCTCAGAGGGCCCTGGG + Intronic
1028316519 7:89408992-89409014 CTGGGGCCAATGAGGGATATTGG + Intergenic
1028991834 7:97057091-97057113 CTGGGGCCGGACAGGGCATTGGG + Intergenic
1029098859 7:98111248-98111270 CAGGGGCCAGAGAGGGCCCAAGG - Intronic
1029950363 7:104577813-104577835 CTTGGGCCAGAATGGGCACTGGG - Intronic
1031721010 7:125176515-125176537 CTTGGGCCTGTCAGGGCTCTGGG - Intergenic
1032051674 7:128654055-128654077 CTGGGCCCGGAGAGGACGCTGGG - Intergenic
1032505848 7:132434186-132434208 CTGATGCCAGTGAGGGCACTGGG - Intronic
1032522433 7:132555989-132556011 ATGGAGCCACAGAGGGCTCTAGG - Intronic
1034258326 7:149736747-149736769 TTGGGGGCAGAGAAGGCTCCAGG + Intergenic
1035557032 8:575016-575038 CTCGGGTCTGAGAGGGCTCCTGG - Intergenic
1035751312 8:1998590-1998612 CTTGGCCTAGAAAGGGCTCTCGG - Intronic
1035962724 8:4155873-4155895 CTGGGAACAGAGAGGGCTATAGG - Intronic
1036555452 8:9855734-9855756 CTGGGAGGAGAGAGGGGTCTGGG + Intergenic
1037658362 8:20906601-20906623 CTGGGGCCGGAGAGGGAGCGGGG - Intergenic
1037753663 8:21698123-21698145 CTGGAGCCACAGATGCCTCTAGG - Intronic
1037911477 8:22746273-22746295 CTGGGGTTAGAGAGAGCTCTGGG + Intronic
1038157992 8:25008984-25009006 CTGGGGATAGAGAGGTCTTTTGG + Intergenic
1038437301 8:27545103-27545125 CTGTGGCCAGTGACTGCTCTAGG - Exonic
1038535799 8:28352083-28352105 TGGGGCCCAGAGAGGGCTCGTGG - Intronic
1039152041 8:34517165-34517187 CTGTGCCCAGAGAGGACCCTTGG + Intergenic
1040380324 8:46865654-46865676 CAGGGGCCTCAGAGGGCCCTGGG - Intergenic
1040388956 8:46933467-46933489 CTGAGGCCACAGAAGGCTTTGGG - Intergenic
1040890872 8:52314711-52314733 TTGGGGCCAGGGAGGGTTCTAGG - Intronic
1041639235 8:60178978-60179000 CTGGGGCAGGAGAGGGGACTGGG - Intergenic
1043620592 8:82187244-82187266 ATGAGGCCAAAGAGGGCCCTTGG + Intergenic
1044611913 8:94099759-94099781 TTGGGGGCAGGGGGGGCTCTGGG + Intergenic
1044873739 8:96644923-96644945 CAGGGGCCTGAGAAGGCTCATGG - Intergenic
1045024687 8:98075623-98075645 CTGGCACCAGAGAGAGCACTGGG - Intronic
1045323300 8:101098120-101098142 CTGGGGCCCCAGAAGGCTATGGG + Intergenic
1045354670 8:101374983-101375005 CAGGGCCCAGGGAGGGCTCCAGG + Intergenic
1046104498 8:109649421-109649443 CTTGGGGCAGAGAGGGCAGTGGG + Intronic
1047937909 8:129799985-129800007 CTGGGCCTGGATAGGGCTCTGGG - Intergenic
1048123650 8:131608671-131608693 CTGGGGGTATAGAGGGATCTGGG - Intergenic
1049196949 8:141320936-141320958 CTGGGGAGAGAGCGGGCTGTTGG + Intergenic
1049303395 8:141883764-141883786 GGGCGGCCAGGGAGGGCTCTGGG - Intergenic
1049379160 8:142303418-142303440 CTTGGCCAAGAGAGGGTTCTCGG - Intronic
1049385454 8:142340863-142340885 CTGGGCCCAGGGAGGTGTCTAGG - Intronic
1049454540 8:142680391-142680413 CTGGAGCCAGTGAGGGCCCCGGG - Intronic
1049461924 8:142734246-142734268 CTGGGGACAGAGAGAGATCTAGG - Intronic
1049586470 8:143434773-143434795 GTGGGCCCCCAGAGGGCTCTGGG + Intergenic
1049687979 8:143946621-143946643 CTGGGGCCGGAGGGCTCTCTGGG - Intronic
1049782755 8:144436287-144436309 CATGGGCCTGAGAGGCCTCTGGG + Exonic
1051629533 9:19128812-19128834 CCGAGGCCAGATAGGGCTCGTGG + Intronic
1051908441 9:22124428-22124450 CTGAGGCCAGACAGGGCTGTGGG + Intergenic
1052730865 9:32283697-32283719 CTGGGGACACAGAGTTCTCTTGG - Intergenic
1052932857 9:34069939-34069961 CTGGAGTCAGAGATGGCACTAGG - Intergenic
1053072664 9:35110453-35110475 GTGGGAACTGAGAGGGCTCTGGG - Exonic
1053108210 9:35432380-35432402 CTGGAGCCAGAGACTCCTCTTGG + Intergenic
1053139956 9:35676081-35676103 CCTGGGCTAGAGATGGCTCTGGG + Exonic
1053645597 9:40117988-40118010 CTGGGGCCTGAGAGGTTCCTAGG + Intergenic
1053760113 9:41345521-41345543 CTGGGGCCTGAGAGGTTCCTAGG - Intergenic
1054326612 9:63715889-63715911 CTGGGGCCTGAGAGGTTCCTAGG + Intergenic
1054538976 9:66257984-66258006 CTGGGGCCTGAGAGGTTCCTAGG - Intergenic
1056048521 9:82744379-82744401 CTGGGGCCTGAGAGAGCTAGCGG - Intergenic
1057075374 9:92135666-92135688 CTGGGGGCATGGAGGGCTCTTGG + Intergenic
1057186050 9:93058245-93058267 CTGGGTCCACACAGGACTCTGGG + Intergenic
1057293973 9:93824804-93824826 CTGGGGGAAGGGAGGGCACTCGG - Intergenic
1057566633 9:96170936-96170958 ATGCGGCCAGAGGGGACTCTGGG - Intergenic
1057875342 9:98749318-98749340 CTGGGGTCAGGGAGGGAGCTGGG - Intronic
1058083489 9:100723679-100723701 CTGGTGCCAGACACGGCACTTGG + Intergenic
1058453395 9:105117327-105117349 ATGGTGCCAGAGAGCTCTCTTGG - Intergenic
1059375397 9:113876640-113876662 CCGGGGCCGGAGGGGGCGCTGGG - Intronic
1059424491 9:114212145-114212167 TTCGGGCCACAGAGGGGTCTAGG - Intronic
1060032645 9:120228667-120228689 CTGGGGCCACAGAAGTCTATGGG + Intergenic
1060115266 9:120935434-120935456 CAGGGGCCAGAGAGAGCCATGGG - Intergenic
1060486963 9:124054065-124054087 CTGGGGCCCCAGAGAACTCTGGG - Intergenic
1060976384 9:127767594-127767616 GTGGAGCCTGAGAGGGCCCTCGG + Intronic
1061036185 9:128115569-128115591 CTGAGGCCAGGGAGGGCCCCAGG + Intergenic
1061117992 9:128626724-128626746 CAGGGCCCAGAGAGGGCTCTGGG - Intronic
1061119722 9:128635415-128635437 CTGGGACTGGAGAGGGCCCTGGG - Intronic
1061373383 9:130210438-130210460 ATGGGGCCAGAGTGGGGACTCGG + Intronic
1061595761 9:131628283-131628305 GTGTGGCCAGGGAGGGCCCTGGG + Intronic
1061918617 9:133770020-133770042 CTGGGCACAGGGAGGGATCTGGG + Intronic
1062063870 9:134515440-134515462 ATGGGAGCTGAGAGGGCTCTGGG - Intergenic
1062436533 9:136548878-136548900 CTGGGGCCGGAGCCGGCCCTGGG - Intergenic
1062445058 9:136590147-136590169 CTGGGGCCAGAAGGGACTCTGGG + Intergenic
1062446319 9:136596886-136596908 CTGGGGCAGGAGAGGGCACCAGG - Intergenic
1062609407 9:137367257-137367279 CTGGGGCCAGAGAGGGCTCTTGG - Intronic
1062730000 9:138103430-138103452 CTGGGGCCTCAGAGGGCTGCTGG + Intronic
1185637642 X:1564831-1564853 AAGGGGCCAGGGAGGTCTCTGGG - Intergenic
1186517062 X:10174079-10174101 CTGGGGGCAGAATGGTCTCTAGG + Intronic
1186699272 X:12071882-12071904 CTGGGGCCAGAAAGTGTTCATGG - Intergenic
1187505273 X:19874315-19874337 CTGGGGCCAGAGTGGGGTTCCGG + Intronic
1190344054 X:49321796-49321818 CCGGGGCAAGAGAGGGCCCTGGG + Intergenic
1190345148 X:49331341-49331363 CCGGGGCAAGAGAGGGCCCTGGG + Intergenic
1190346242 X:49340907-49340929 CCGGGGCAAGAGAGGGCCCTGGG + Intergenic
1190347494 X:49531936-49531958 CCGGGGCAAGAGAGGGCCCTGGG + Intergenic
1190348595 X:49541492-49541514 CCGGGGCAAGAGAGGGCCCTGGG + Intergenic
1190349696 X:49551048-49551070 CCGGGGCAAGAGAGGGCCCTGGG + Intergenic
1190350800 X:49560601-49560623 CCGGGGCAAGAGAGGGCCCTGGG + Intronic
1190351901 X:49570159-49570181 CCGGGGCAAGAGAGGGCCCTGGG + Intergenic
1190353002 X:49579708-49579730 CCGGGGCAAGAGAGGGCCCTGGG + Intergenic
1190354103 X:49589255-49589277 CCGGGGCAAGAGAGGGCCCTGGG + Intergenic
1190355205 X:49598779-49598801 CCGGGGCAAGAGAGGGCCCTGGG + Intronic
1192042534 X:67637978-67638000 CTGGGGCCAGTGAGGGGTGAGGG - Intronic
1192496136 X:71617734-71617756 CAGTGGGCAGAGAGGGCTCTGGG - Intronic
1194901837 X:99521154-99521176 CTGGTGCTAGAGAAGGGTCTTGG + Intergenic
1195217089 X:102712859-102712881 CTGTGCCCGGAGAGGGCTGTGGG + Intronic
1197625411 X:128796536-128796558 CTGGGGCCAGACAGGGCGTGAGG + Intergenic
1197873081 X:131078508-131078530 TTGGAGCAAGAGAGGTCTCTTGG + Intronic
1198438358 X:136638542-136638564 CAGGGGAGAGAGAGGGCTCCAGG + Intergenic
1199607454 X:149587281-149587303 CTGGGAGCAGAGACGGCACTTGG + Intronic
1199631669 X:149782086-149782108 CTGGGAGCAGAGACGGCACTTGG - Intronic
1199880812 X:151973312-151973334 CTAGGGCAAAAGATGGCTCTGGG - Intronic
1199975562 X:152893230-152893252 CTGGGGCCCCAGAGAGGTCTGGG + Intergenic
1201062440 Y:10059311-10059333 CTGGGGGCTGAGAGGCCTGTGGG + Intergenic