ID: 1062610125

View in Genome Browser
Species Human (GRCh38)
Location 9:137369791-137369813
Sequence CACTTTGAACTGCCTCTGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062610125_1062610136 30 Left 1062610125 9:137369791-137369813 CCCGTCAGAGGCAGTTCAAAGTG 0: 1
1: 0
2: 1
3: 15
4: 141
Right 1062610136 9:137369844-137369866 ATTCAGAGCCCAGGGCTAACAGG No data
1062610125_1062610132 21 Left 1062610125 9:137369791-137369813 CCCGTCAGAGGCAGTTCAAAGTG 0: 1
1: 0
2: 1
3: 15
4: 141
Right 1062610132 9:137369835-137369857 ACCACGGCCATTCAGAGCCCAGG No data
1062610125_1062610129 5 Left 1062610125 9:137369791-137369813 CCCGTCAGAGGCAGTTCAAAGTG 0: 1
1: 0
2: 1
3: 15
4: 141
Right 1062610129 9:137369819-137369841 CTCAGCCCTTCTCTTCACCACGG No data
1062610125_1062610134 22 Left 1062610125 9:137369791-137369813 CCCGTCAGAGGCAGTTCAAAGTG 0: 1
1: 0
2: 1
3: 15
4: 141
Right 1062610134 9:137369836-137369858 CCACGGCCATTCAGAGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062610125 Original CRISPR CACTTTGAACTGCCTCTGAC GGG (reversed) Intronic
904830713 1:33304887-33304909 CATTTTGAACTGCTTTTGAGAGG + Intergenic
907159409 1:52359771-52359793 CACTTTGTACTCTCTCTGTCGGG + Exonic
910066676 1:83161746-83161768 GAGTTTTCACTGCCTCTGACTGG - Intergenic
911168732 1:94747722-94747744 CATTTTGAACTGCATGTCACAGG + Intergenic
911836814 1:102630198-102630220 CACCTTGAACTGCTGCTGGCTGG - Intergenic
912180328 1:107211266-107211288 AACTTTGAACTGCATCTTATAGG - Intronic
918277621 1:182968739-182968761 TACTTTGAACTGACCTTGACTGG - Intergenic
919841846 1:201614926-201614948 CACTTAGAACAGTGTCTGACAGG + Intergenic
922743604 1:228030731-228030753 CACTTTGCAGTCCCTCTGCCAGG + Intronic
924534768 1:244925948-244925970 CACTTGGCAATGTCTCTGACAGG + Intergenic
1072603544 10:96955877-96955899 CACTTTGTGCTGCCTCTCCCTGG - Exonic
1073109436 10:101052344-101052366 CACTGGGCACTGCCTGTGACGGG - Intergenic
1074672778 10:115813080-115813102 CATTTTGAAGTGCCTCTGTGGGG + Intronic
1076238422 10:128883663-128883685 CACTGTGATCTACCTCTGAGAGG + Intergenic
1076812160 10:132892693-132892715 CACTTGGAACTGCCTCTGATTGG + Intronic
1090474215 11:127004812-127004834 CATTTTGAACAGCCTCCTACTGG + Intergenic
1090692046 11:129194138-129194160 CAGTTTAAACTCCCACTGACAGG - Intronic
1091553538 12:1554708-1554730 CATTCTGACTTGCCTCTGACAGG + Intronic
1091837424 12:3595492-3595514 TGCTTTGAACAGCCTCTGAATGG + Intergenic
1091994742 12:4984496-4984518 CACTCTTAACTGCCTCAGGCAGG + Intergenic
1094838042 12:34331376-34331398 CACTTTGGGCTGCCTCCCACTGG + Intergenic
1095170725 12:39032855-39032877 CACTGTAAACAGCCTCAGACAGG + Intergenic
1095628787 12:44349545-44349567 CACTCTGAAGTGGATCTGACAGG - Intronic
1096116572 12:49058967-49058989 AACTTTAAACTGCCCCTGCCTGG - Intronic
1097847090 12:64378077-64378099 CACTTAGAACAGCATCTAACTGG + Intronic
1106149980 13:27090365-27090387 CACTTTTGACTGACTCTCACTGG + Intronic
1107333434 13:39327092-39327114 CACTTAGCACTGCCTTTGTCTGG - Intergenic
1108088007 13:46816385-46816407 CAAGTTGAAATGCCTCTGCCTGG + Intergenic
1109988863 13:70027359-70027381 CACTTTCAACTGGCTCTAAAGGG - Intronic
1110141657 13:72138149-72138171 CAGTTTGAACAGCCTCTGGCAGG - Intergenic
1111867021 13:93781540-93781562 CAATTTGAAATGCTTCTGACAGG - Intronic
1112208951 13:97354150-97354172 CACTTGGAAATCCATCTGACTGG - Intronic
1112642289 13:101289456-101289478 CACTAGGAACTGGCTCTGACAGG - Intronic
1113119491 13:106911164-106911186 CACTTTCAACCTACTCTGACTGG - Intergenic
1114740554 14:25092521-25092543 GATTTTGAACTACATCTGACAGG + Intergenic
1116067563 14:40003529-40003551 CTCTTTGATCTGCCTCTTAAAGG + Intergenic
1120644691 14:87059545-87059567 CACTTAGAATTGCCTGTGCCAGG + Intergenic
1122009323 14:98732732-98732754 CAATTTGAATTGCCTCTTTCTGG - Intergenic
1128286586 15:66442095-66442117 CTCTTTCCACTGCCTCTGTCCGG + Intronic
1129955980 15:79637236-79637258 CACATTGAAATGCCTATGTCTGG + Intergenic
1130884431 15:88081498-88081520 AACTTCCAACTGCCTATGACAGG + Intronic
1131443037 15:92473089-92473111 CACCTTGAATAGCCTCTGAGAGG + Intronic
1132009808 15:98266175-98266197 CTCTGTGAACTGCTGCTGACTGG - Intergenic
1132427665 15:101732681-101732703 TACTTTTAACTGACTATGACTGG - Intergenic
1132866247 16:2094033-2094055 CCCTGTGAGCTGCCTCTCACAGG - Intronic
1133032059 16:3015824-3015846 CACCTTGCACTGCATCTGGCCGG + Exonic
1134620637 16:15686470-15686492 CATTTTGAACTTCCACTGAGAGG + Intronic
1137773210 16:51034820-51034842 CAGTTGGAACAGCCTTTGACAGG - Intergenic
1143376537 17:6470685-6470707 CACTGGGAACTGCCACTGAGCGG - Intronic
1143715651 17:8766778-8766800 CCCTTGAAACTGCCTCTGAGGGG - Intergenic
1144063842 17:11606945-11606967 CACTTTGGCCTGACTCTCACTGG + Intronic
1145102776 17:20090434-20090456 CACATGCAACTGCCTCTGCCTGG - Intronic
1147649395 17:42053491-42053513 CACCTTTAACTGCCTCTGAGGGG - Intronic
1150579027 17:66455429-66455451 CACTTTGAACTGGAGCTGCCAGG + Intronic
1153017893 18:600755-600777 AACTTGGAACTGTCTCTAACTGG - Intronic
1155084756 18:22447018-22447040 CAATTTCCACTGCCTCTGACTGG + Intergenic
1157999994 18:52607222-52607244 CACTCTGAGCTACCTCAGACTGG + Intronic
1159266445 18:66086770-66086792 CAATGTTAACTGCCTCTGAATGG - Intergenic
1159268750 18:66121120-66121142 CAGTTTCAAATACCTCTGACAGG + Intergenic
1163636450 19:18439050-18439072 CACTTCCAACTCCCTCAGACTGG - Intergenic
1163739399 19:19001643-19001665 CAGTTCGAATTGCCTATGACAGG - Exonic
1164689756 19:30201818-30201840 CTCTTTGCCCTGCCTCTGAATGG + Intergenic
1166495578 19:43300892-43300914 GTGTTTGATCTGCCTCTGACTGG - Intergenic
927524989 2:23731051-23731073 CAATTTGAAAAGACTCTGACAGG + Intergenic
929013430 2:37470723-37470745 CACTCTGGACTGCCTGGGACGGG + Intergenic
929758428 2:44786953-44786975 CACTTGCCACTGCCTCTGCCTGG - Intergenic
930470858 2:51810845-51810867 CATTCTGTACTGCCTCTGACGGG - Intergenic
931078234 2:58740537-58740559 AACTGTGAACAGCCTCTGACAGG - Intergenic
932024899 2:68122997-68123019 GACTTTGTACTGCCCCTGAGTGG + Intronic
933477669 2:82812863-82812885 CACCATGAAGTGCCTCAGACTGG - Intergenic
933525818 2:83437285-83437307 CACATTGACCTCCCTCAGACAGG - Intergenic
935644321 2:105321042-105321064 CACACTGGACTTCCTCTGACTGG + Intronic
935833855 2:107028701-107028723 CAGTTTGGTCTGCCTCTGAAAGG + Intergenic
938283038 2:130080779-130080801 GATTTTGAACTGGCTCTGGCTGG - Intronic
938333666 2:130469333-130469355 GATTTTGAACTGGCTCTGGCTGG - Intronic
938356148 2:130651334-130651356 GATTTTGAACTGGCTCTGGCTGG + Intronic
938432572 2:131258120-131258142 GATTTTGAACTGGCTCTGGCTGG + Intronic
939623597 2:144449572-144449594 CACCTTGCACTGAATCTGACGGG - Intronic
940133959 2:150415435-150415457 CACTTTTTACTGCCTGAGACTGG - Intergenic
944572538 2:201059113-201059135 GACTTTGGACTGTGTCTGACTGG + Intronic
947731817 2:232435453-232435475 CACTTCCTACTGCCTCTGCCTGG + Intergenic
1175840190 20:62021690-62021712 CCCTTTTAACTGCCTCTCAGAGG - Intronic
1180921540 22:19524058-19524080 CACTTTGCACTGCATGTGCCCGG + Exonic
1181328399 22:22069527-22069549 AACTGTGAACTGGCTCTGAGTGG - Intergenic
950920805 3:16692823-16692845 CACTTTGCACTCCCTCTCATTGG + Intergenic
951427221 3:22562008-22562030 CACTTTGAATTGTCTATAACAGG + Intergenic
958264566 3:91422784-91422806 GACTTTGAACTGGGTCAGACAGG + Intergenic
964655740 3:159064260-159064282 CACTTTGTACAGCCCCTGACTGG + Intronic
964716268 3:159725571-159725593 CACTTTTAACTGCCTAGGATTGG + Intronic
966155926 3:176916582-176916604 CACTTTGTGCTGTTTCTGACTGG - Intergenic
970383293 4:15530265-15530287 TACATTGAAATGCCTCTGGCCGG - Intronic
970722241 4:19001363-19001385 CACTATGAAATCCCTCTAACAGG - Intergenic
971088629 4:23311939-23311961 CTGCTTGATCTGCCTCTGACAGG - Intergenic
972611741 4:40662043-40662065 CACCTTGAACCTGCTCTGACGGG + Intergenic
973964977 4:56152732-56152754 CAGCTTGAAGTGCCTCTCACTGG - Intergenic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
979165583 4:117525935-117525957 CAGTCTGCACTGCCTCTCACAGG + Intergenic
984901594 4:184591237-184591259 CATTTTGAACTGCCTGTGTGGGG + Intergenic
986997383 5:13622601-13622623 CACTGTTAAATGCCTCTGAGTGG - Intergenic
987141039 5:14946657-14946679 CACTTTAAAATACCTCTGATTGG + Intergenic
987291231 5:16510386-16510408 CACATTGCCCTGCCTCTGACAGG - Intronic
994538983 5:101070624-101070646 CCTTTTGAACTGCCTCAGACAGG - Intergenic
997743369 5:136277469-136277491 CACATTGAACTGTCTTTGAAGGG - Intronic
997916990 5:137936857-137936879 CAGAATGAAGTGCCTCTGACAGG + Intronic
1001020502 5:168178540-168178562 CACCTTGGACAGCCTCTGACAGG - Intronic
1001307279 5:170584632-170584654 CACTGTGACCTGCCTCTGCCGGG - Intronic
1002469161 5:179424622-179424644 CACTCTGAACTTACTCTGATTGG + Intergenic
1005997876 6:30942551-30942573 ATCTTTGAGCTGCCTCTGAAAGG + Intronic
1007156874 6:39753403-39753425 CTCTTTCAAATGCCTCTGACAGG + Intergenic
1012691362 6:102316582-102316604 CAGTTTGAAGTGCCTCATACTGG - Intergenic
1014515536 6:122374103-122374125 CTCTTTGCACTGCTTCTGCCTGG + Intergenic
1014669831 6:124288284-124288306 CACAGTGAACTGCCTCTTAGAGG + Intronic
1017367155 6:153656623-153656645 CACTCTGAACTGACTTTGCCTGG + Intergenic
1020625659 7:10576022-10576044 CACTTTGAATTAACTCTGAATGG - Intergenic
1021245613 7:18257916-18257938 CAGTGTGAACTGACACTGACTGG - Intronic
1022844020 7:34191856-34191878 CACTGTGATCTCCCTCTGAGTGG + Intergenic
1024817796 7:53291874-53291896 ATCTCTGCACTGCCTCTGACTGG - Intergenic
1026858447 7:73769855-73769877 CACCTTGCACTGCATCTGGCCGG + Exonic
1026867243 7:73831377-73831399 CACCTTGCACTGCATCTGGCCGG - Exonic
1027277432 7:76573015-76573037 GAGTTTTCACTGCCTCTGACTGG + Intergenic
1029678699 7:102092329-102092351 CACTGGGCGCTGCCTCTGACTGG + Intronic
1030327600 7:108237158-108237180 AACTTTCCACTGCCTTTGACAGG - Intronic
1037663076 8:20943718-20943740 CACTTTGAACAGGCTCTGGGAGG + Intergenic
1039741086 8:40383304-40383326 CCCTTAGAACTGTCTCTGACTGG + Intergenic
1039990530 8:42483846-42483868 CATTTTAAACTGTCTCTGAAGGG - Intronic
1041853928 8:62427066-62427088 CATCTTGAGCTCCCTCTGACAGG - Intronic
1044785878 8:95792308-95792330 CATTTTGAACAGCCACTGAGAGG + Intergenic
1047683070 8:127274870-127274892 CACTATGAAGCGCCTCTGAGAGG - Intergenic
1047821967 8:128530790-128530812 CACTTTGTACTCCCTATGTCTGG + Intergenic
1048083494 8:131153618-131153640 GACTTTGACCTTCCTCTTACTGG + Intergenic
1049518746 8:143077471-143077493 CACTCTGCACTGCTTCTGAGCGG - Intergenic
1052447761 9:28586908-28586930 CACTTTGAAAAGCCCCTGAATGG - Intronic
1054911382 9:70458376-70458398 AACTTTGAAATGCCTTTGGCTGG + Intergenic
1055638798 9:78303431-78303453 GGCTATGAACTTCCTCTGACTGG + Intronic
1056190415 9:84179263-84179285 CACTTTGATCCTCCTCTGTCTGG + Intergenic
1056528340 9:87464914-87464936 GACTTTGACCTTCCTCTGATGGG - Intergenic
1056968501 9:91183834-91183856 CCCTCGAAACTGCCTCTGACAGG + Intergenic
1057550387 9:96047805-96047827 CCCAGCGAACTGCCTCTGACTGG - Intergenic
1059705028 9:116814724-116814746 CACTCCTAACTGCCTCTTACAGG - Intronic
1059938346 9:119334034-119334056 CATTTAGAGCTGCCTCTGTCAGG - Intronic
1061114443 9:128600396-128600418 CCCTTTGGACCGCCTCTTACTGG - Intronic
1062610125 9:137369791-137369813 CACTTTGAACTGCCTCTGACGGG - Intronic
1187997875 X:24948067-24948089 CACTCTGAAATTCCTCTGAAAGG + Intronic
1189054483 X:37685341-37685363 CACTTTGAAAAGCCTCTGTGTGG + Intronic
1189272388 X:39760487-39760509 CCCTTTGGACTGGCTCTGCCTGG - Intergenic
1192539240 X:71954368-71954390 CACTGTGCACTGCCTCTGTGGGG + Intergenic
1192600536 X:72459079-72459101 GACTTTGAACTGACTCTTAGAGG - Intronic
1193450570 X:81659676-81659698 CATTTTGAACTGCCTTTAAAGGG - Intergenic
1193694830 X:84695731-84695753 TCCTTTGAAGTGCCTGTGACTGG - Intergenic
1195232731 X:102867458-102867480 CACCTTGCAGTGCCTCTGGCAGG + Intergenic
1195626541 X:107009823-107009845 CACTTTGCTCTCCCTCAGACTGG - Intergenic
1195655360 X:107327130-107327152 CACTTTGCTCTCCCTCAGACTGG - Intergenic
1197585904 X:128347766-128347788 AACTTTGATCTTCCTCTGATAGG + Intergenic
1198003684 X:132468770-132468792 CACTCTGTACTGCCTCTAATGGG + Intronic
1198525644 X:137497659-137497681 CACTTTGAACAGCCTGTGAGTGG - Intergenic
1200372780 X:155744538-155744560 CACTTTAAACTGCGTTTGCCAGG - Intergenic
1202375603 Y:24233345-24233367 TACTTTTAACTGACTATGACAGG - Intergenic
1202495177 Y:25436773-25436795 TACTTTTAACTGACTATGACAGG + Intergenic