ID: 1062610744

View in Genome Browser
Species Human (GRCh38)
Location 9:137372351-137372373
Sequence CTCCCACAGCACCCCCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 354}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062610744_1062610756 28 Left 1062610744 9:137372351-137372373 CCACTCTGGGGGTGCTGTGGGAG 0: 1
1: 0
2: 3
3: 34
4: 354
Right 1062610756 9:137372402-137372424 CTCTTCTGCTCGGCCCCTCTGGG No data
1062610744_1062610752 18 Left 1062610744 9:137372351-137372373 CCACTCTGGGGGTGCTGTGGGAG 0: 1
1: 0
2: 3
3: 34
4: 354
Right 1062610752 9:137372392-137372414 GCTCCCACAGCTCTTCTGCTCGG No data
1062610744_1062610755 27 Left 1062610744 9:137372351-137372373 CCACTCTGGGGGTGCTGTGGGAG 0: 1
1: 0
2: 3
3: 34
4: 354
Right 1062610755 9:137372401-137372423 GCTCTTCTGCTCGGCCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062610744 Original CRISPR CTCCCACAGCACCCCCAGAG TGG (reversed) Intronic
900431709 1:2605876-2605898 CACCCGCGGCTCCCCCAGAGTGG + Intronic
901678079 1:10898403-10898425 CTCCCACAGCAGGCACAGCGGGG + Intergenic
902703562 1:18189588-18189610 GTCTCCCAGCACCCCCAGTGGGG - Intronic
902782051 1:18711280-18711302 TTCTCACAGCAACCCCTGAGAGG - Intronic
903329200 1:22588570-22588592 ATCCCACTGCTCACCCAGAGTGG - Intronic
903739021 1:25547561-25547583 CTCCCACAGTTCCCACAGCGGGG - Intronic
903761728 1:25703225-25703247 CAGCCTCAGCACCCACAGAGAGG - Intronic
903838682 1:26222793-26222815 CTCCCACGGCCCAACCAGAGTGG - Intergenic
904078586 1:27858009-27858031 CTCCCACAGTAGCCCCTGCGTGG - Intergenic
905283254 1:36862648-36862670 CTCCCTCAGCTCCTCCAGGGCGG + Intronic
905665628 1:39761445-39761467 CTCCCCCAGCAGCCAGAGAGAGG + Intronic
905860121 1:41344851-41344873 CTCACAGAGGAGCCCCAGAGAGG - Intergenic
906460700 1:46033609-46033631 CTCCCATTGGAGCCCCAGAGTGG - Intronic
907345368 1:53773810-53773832 CACCCACAACTCCCCCAGACTGG + Intronic
907445974 1:54507930-54507952 CTCCCTCAGCACCCCCACCCAGG - Intergenic
907708399 1:56852928-56852950 CTCCCACCCCACCCCCAGCACGG - Intergenic
907719969 1:56962740-56962762 CCCCCACCTTACCCCCAGAGGGG + Intronic
907953210 1:59203938-59203960 GTCACACACCACCACCAGAGAGG + Intergenic
909868994 1:80714790-80714812 CTCCCACAGAACCTCCAGAAAGG - Intergenic
910008687 1:82433329-82433351 CTCCCACAGAACCTCCAGAAAGG - Intergenic
910030678 1:82718273-82718295 CTCCCAGAGAGCCTCCAGAGAGG + Intergenic
910168013 1:84348360-84348382 CTCCCACACCATCCCCAGGGCGG - Intronic
915624848 1:157108098-157108120 CTCCCACCTCACCCCCAAAGAGG - Intergenic
916921430 1:169471879-169471901 ATCCCAAAGCAACCCCAGTGTGG + Intronic
917478936 1:175393828-175393850 CTCCCACTGCACCTCCACGGTGG + Exonic
917525696 1:175786514-175786536 TTCCCACAGCACCCCACTAGAGG + Intergenic
918114640 1:181485478-181485500 CTCCCACAGCAACCCCGGCTGGG + Intronic
920172056 1:204078306-204078328 ATCTCAAAGCACCCCCAGAGAGG - Intronic
920304997 1:205013000-205013022 CCACCACAGCGCCACCAGAGAGG - Intronic
920313458 1:205061856-205061878 CTCCCACAGCTCAGCCTGAGTGG + Exonic
920416858 1:205804662-205804684 CTCCCAAACCAGCTCCAGAGAGG + Intronic
922421856 1:225465794-225465816 CTCCCACAGCCAGACCAGAGAGG + Intergenic
923031466 1:230252233-230252255 CTCCCAATGCACACCCACAGAGG - Intronic
923480370 1:234377881-234377903 CTACCACAGCACCCCCACATGGG + Intronic
1063423948 10:5936936-5936958 CTCCCACAGCACCACCAACTAGG - Intronic
1064148694 10:12844902-12844924 CCCCCACATCAGCCACAGAGGGG + Intergenic
1064261111 10:13787352-13787374 CTCCACCCGCACGCCCAGAGAGG + Intronic
1065289366 10:24214650-24214672 CTGCCACGGTACACCCAGAGAGG + Intronic
1065603578 10:27393510-27393532 CTGCCACAGTACCCCCAGACAGG - Intergenic
1067164027 10:43851059-43851081 GTCTCCCATCACCCCCAGAGAGG - Intergenic
1069018993 10:63465287-63465309 CTCCGACACCACCTCCACAGGGG + Intronic
1069467635 10:68656068-68656090 GTCCCACCTCACCCCCAGATGGG + Intronic
1069798288 10:71067062-71067084 CTCTCACACCTCCCCCAGGGAGG - Intergenic
1069868513 10:71518968-71518990 CACCCACAGCACCACGAAAGAGG + Intronic
1070627546 10:78061974-78061996 CTCCCACGGCAGCCACAGAGTGG + Intergenic
1070668705 10:78363148-78363170 CTCCCACTGCACTCACTGAGAGG + Intergenic
1071469624 10:85974341-85974363 CTCACACAGCCCCCTGAGAGAGG - Intronic
1071976974 10:90964931-90964953 CTCCCCAAGCAGCCCCAGGGTGG + Intergenic
1072189716 10:93069626-93069648 ACCCCACAGTACACCCAGAGAGG + Intergenic
1072572831 10:96673489-96673511 CTACCACAGCCCCCCCCGAAAGG + Intronic
1072766234 10:98097206-98097228 CTCACAGAGCTCCCCCAGAATGG + Intergenic
1073057643 10:100712601-100712623 CTCCACCAGGCCCCCCAGAGGGG + Intergenic
1073503981 10:103967544-103967566 CTCGCGCAGCACCCCCACCGCGG + Exonic
1073532446 10:104245058-104245080 CTCCTCAAGCACCGCCAGAGTGG - Intronic
1073736566 10:106354518-106354540 CTACCACTGCACATCCAGAGAGG - Intergenic
1074098705 10:110336096-110336118 CTCTCACAGGACCCCCAGCAGGG + Intergenic
1074314524 10:112349632-112349654 CTCCTGAAGCACCGCCAGAGTGG - Intergenic
1075402872 10:122173457-122173479 CTCCCACAGCCTCCCCAGTTAGG - Intronic
1075617623 10:123903116-123903138 CTCCCACAGCTCCCCTAATGTGG + Intronic
1076135540 10:128043293-128043315 GTCTCCCATCACCCCCAGAGGGG - Intronic
1076758139 10:132585920-132585942 CACACACAGCACCCTCAGGGTGG - Intronic
1076807844 10:132868001-132868023 TTGCCACAGCACGTCCAGAGAGG + Intronic
1076851269 10:133094501-133094523 CGGCCACAGCAGCCCCAGGGAGG + Intronic
1076868476 10:133181235-133181257 CACCCACAGCAGCATCAGAGCGG + Intronic
1077170205 11:1162703-1162725 CTCCCACAGCCTCTCCGGAGAGG + Intronic
1077294514 11:1819411-1819433 CTTCCCCAGCACCTCCAGAGAGG - Intergenic
1077303325 11:1856937-1856959 CTCCCTCAGCAGCCCCTGTGGGG - Intronic
1077310444 11:1886596-1886618 TTCCCAATGCAGCCCCAGAGTGG - Intronic
1079986585 11:27206537-27206559 CTACCACAGAACCTCCAGAAAGG + Intergenic
1080770458 11:35336158-35336180 CACCCACCCCACCCCCTGAGAGG - Intronic
1080798108 11:35584373-35584395 CTCCCACAGGCCCCCCTAAGGGG + Intergenic
1083163861 11:60871742-60871764 CTCCCACCACATCCTCAGAGAGG - Intronic
1083571866 11:63765431-63765453 CACCCACACCTCCCCCAGACTGG + Intronic
1083945275 11:65919716-65919738 CTCCCCCAGCACCCCCTTAGGGG + Intronic
1084190263 11:67495447-67495469 CGCCCCCAGCACCACCAGTGAGG - Exonic
1084305895 11:68283105-68283127 CTCCCTCAGCACCCACCCAGGGG - Intergenic
1084461488 11:69298943-69298965 CTCCCAGCTCACCCCCACAGGGG + Intronic
1084679695 11:70659715-70659737 CTCCACAAGCACCCCCAGACTGG + Intronic
1084968466 11:72756560-72756582 CACCCACAGCACCCCTGGAGGGG + Intronic
1085043546 11:73340754-73340776 GTCCCACAGCACATGCAGAGTGG - Intronic
1086976938 11:93142938-93142960 CTCCCACCCCACCCCCAAACAGG - Intergenic
1087201910 11:95353920-95353942 CTCTCACAGAACCTCCAGACTGG + Intergenic
1089417843 11:118307390-118307412 CTCCCACAGAACTTCCACAGAGG + Intronic
1091321934 11:134657785-134657807 CTCCCCCAGCACCTCCAGCATGG - Intergenic
1091622714 12:2101447-2101469 CTCCCACAGCCCCACCTGGGAGG - Intronic
1092630704 12:10372855-10372877 CTCCCACCACAAGCCCAGAGTGG - Exonic
1093524841 12:20093736-20093758 CTCCTCAAGCACCACCAGAGTGG + Intergenic
1093793125 12:23278361-23278383 GTCTCACATCACCCCCAGATGGG - Intergenic
1096148448 12:49294676-49294698 CTCCTTCACCACACCCAGAGAGG - Exonic
1096607503 12:52777168-52777190 CTCCACCAGCTCCCCCAGAGCGG + Exonic
1096610203 12:52795922-52795944 CTCCGCCAGCTCCCCCAGAGTGG + Exonic
1096652075 12:53066736-53066758 CTGACACCACACCCCCAGAGTGG + Intronic
1100585692 12:95977396-95977418 CTCCCACCTCACCCCCAAAGTGG - Intronic
1100593502 12:96051830-96051852 CTCCCACCACAGGCCCAGAGTGG + Intergenic
1102589208 12:113944682-113944704 CTCCCACCTCACCTCCCGAGTGG - Intronic
1102630536 12:114274842-114274864 TTCTCACAGCAACCCTAGAGCGG + Intergenic
1103012036 12:117465244-117465266 CATCCCCAGCAACCCCAGAGTGG + Exonic
1103953756 12:124565907-124565929 CCTCCTCAGCACCCCCAAAGAGG + Intronic
1104708728 12:130969554-130969576 GTCTCCCATCACCCCCAGAGGGG + Intronic
1105009353 12:132745114-132745136 CTCCCACAGCGCCCGCACCGCGG + Intronic
1105845052 13:24286797-24286819 CTCCAGCAGCACCCCCAGTGAGG + Exonic
1106130763 13:26937479-26937501 CTCCCCCACCACCACCACAGGGG + Intergenic
1106579907 13:31008637-31008659 CTCATACAGCACTCCCAGAAGGG + Intergenic
1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG + Intronic
1108179280 13:47824956-47824978 CTCCCACAGCAAACTCACAGAGG + Intergenic
1108624095 13:52210732-52210754 CTCCCACAGAATTCCCATAGTGG + Intergenic
1108661960 13:52595689-52595711 CTCCCACAGAATTCCCATAGTGG - Intergenic
1108671663 13:52696333-52696355 CTCCCACATCACAACTAGAGTGG - Intronic
1109364702 13:61339571-61339593 CTCCCCCTGCAGCCCCAGTGAGG + Intergenic
1110141005 13:72129457-72129479 CTCCCATATGACCCCCAGGGAGG + Intergenic
1110470486 13:75854467-75854489 CTCCCTCTGCTCTCCCAGAGTGG - Intronic
1110778807 13:79440942-79440964 GTCCCCCATCACCCCCAGATGGG - Intergenic
1112561111 13:100514974-100514996 TTCCCACAGCCCTCCAAGAGCGG - Intronic
1112661862 13:101519162-101519184 CTCTCACATCACCCCCAAAAAGG - Intronic
1113533400 13:111045571-111045593 CTTCCACAGCATCCCAAGACAGG - Intergenic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1114957838 14:27845785-27845807 CTCCCCCAGCGGCCCCAGCGCGG + Intergenic
1116452434 14:45080847-45080869 CTCCACCTGCAGCCCCAGAGCGG + Intergenic
1117222197 14:53617292-53617314 CTCCCACCCCACCCCCTCAGGGG - Intergenic
1117814364 14:59581954-59581976 CTCCCACTGCCTCCCCAGGGAGG - Intergenic
1118324355 14:64771264-64771286 CTCCTACAGCACCCACTGGGTGG - Intronic
1118734463 14:68691600-68691622 AGCCCACAGCACCCCAGGAGGGG - Intronic
1121051189 14:90819943-90819965 CTGCCACAGCAACCCTAGAGAGG + Intergenic
1121561844 14:94881789-94881811 CTCCCACAGCCCCATGAGAGGGG + Intergenic
1121735064 14:96212736-96212758 TTCCATCAGCACCCCCAGAAAGG + Intronic
1122009799 14:98736755-98736777 CTCCCAGAGCACAGCCAGACAGG + Intergenic
1122209602 14:100166064-100166086 CTCCCCCAACTCCCCCAGACAGG - Intergenic
1122327183 14:100889817-100889839 CGCCCAAAGCCCTCCCAGAGAGG - Intergenic
1122494365 14:102141191-102141213 ATCCCACAGCACCTCCAAATAGG + Intronic
1122917717 14:104866409-104866431 CTCCCCCAGCAGCCCTAGGGAGG + Intronic
1123539680 15:21275623-21275645 CTCCCCCGGAACCTCCAGAGGGG - Intergenic
1124223401 15:27869255-27869277 CACCCTCAGCACCCCCACAGCGG + Intronic
1124625444 15:31304960-31304982 CTCTCCCAGCACGCCCAGCGGGG - Intergenic
1126636142 15:50781741-50781763 GTCCCATACCACACCCAGAGTGG - Intergenic
1127768052 15:62207424-62207446 CTCCTCCAGTACCGCCAGAGTGG - Intergenic
1128792547 15:70443706-70443728 CTCCCCCAGCACCTCCGGAGGGG + Intergenic
1128800663 15:70494863-70494885 CCCCCACAACACCCCCTGGGAGG + Intergenic
1129389890 15:75215199-75215221 ATCCCACTACACCCTCAGAGGGG + Intergenic
1129772645 15:78212684-78212706 GAGCCACAGCAGCCCCAGAGAGG + Intronic
1129915470 15:79266160-79266182 CTCACACAGCACTCCCACTGGGG + Intergenic
1129926295 15:79367343-79367365 CTCCCACTGCAAACCCAGTGTGG - Intronic
1130927815 15:88398314-88398336 CTGCCACAGCATCTCCTGAGTGG - Intergenic
1132169570 15:99635554-99635576 ATCCCAGAGCACCACCCGAGAGG + Intronic
1202947989 15_KI270727v1_random:2785-2807 CTCCCCCGGAACCTCCAGAGGGG - Intergenic
1132598207 16:762702-762724 GTCCCACAGGACCCCAACAGGGG - Exonic
1132652311 16:1027065-1027087 TCCCCACAGGACCCACAGAGCGG + Intergenic
1134062270 16:11206289-11206311 CTCCCATAGCAGCCCCACTGGGG - Intergenic
1134379061 16:13707593-13707615 CTCTCCCATCACCCCCAGAAGGG + Intergenic
1135407535 16:22208650-22208672 CCGCCTCAGCACCCCCAAAGTGG - Intronic
1136034105 16:27525677-27525699 GACCCACAGCACCCCCAGGGCGG - Intronic
1136271569 16:29151917-29151939 GTCCCACAGCACTCTCAGTGTGG - Intergenic
1137062988 16:35809200-35809222 CTAGCACTGCAGCCCCAGAGAGG - Intergenic
1137635649 16:49984087-49984109 CTCCTACAGCCTCCCCAGAAAGG + Intergenic
1137874711 16:51984939-51984961 CTCCCAAAGCCTGCCCAGAGTGG - Intergenic
1140821972 16:78671049-78671071 CTCCTGCAGAACCCCCAGAAGGG + Intronic
1141396470 16:83709453-83709475 CACACACGGCACCCCTAGAGTGG - Intronic
1141692708 16:85605647-85605669 CTCCCCCTGCACCCCCGGGGGGG + Intergenic
1141882817 16:86871110-86871132 CTGCCCCAGCACCCCCTGGGTGG - Intergenic
1142068760 16:88077788-88077810 CTCCCAGAGAAAGCCCAGAGAGG - Intronic
1142075184 16:88113901-88113923 GTCCCACAGCACTCTCAGTGCGG - Intronic
1142346297 16:89556179-89556201 ATCCCACACCAGCCCTAGAGAGG + Intronic
1142619548 17:1156100-1156122 TCCCCACAGCACCCCCATTGAGG - Intronic
1143705818 17:8697132-8697154 CCTCCTCACCACCCCCAGAGGGG - Intergenic
1144080955 17:11763374-11763396 GTCCAACAGCACCACCAGAATGG + Intronic
1144281805 17:13733995-13734017 CTTCCACCACACACCCAGAGAGG + Intergenic
1144432464 17:15206764-15206786 CTCCCACCCCACCCCCTGACAGG - Intergenic
1145365923 17:22266785-22266807 CTCCCACAGAACACACAGACCGG - Intergenic
1145375361 17:22342525-22342547 ATGCCACTGCACCCCCAGCGTGG + Intergenic
1146022152 17:29289025-29289047 CTCCCTCAGCTCCCCCAGCTGGG - Intronic
1146689392 17:34862776-34862798 GTCTCCCATCACCCCCAGAGGGG + Intergenic
1147412627 17:40264706-40264728 CTCCCCCACCACCCCCAGGGCGG + Exonic
1147649132 17:42051978-42052000 CCCCCACAGCTGCCCCCGAGTGG + Intronic
1149440344 17:56668707-56668729 ATCTCCCATCACCCCCAGAGGGG + Intergenic
1150322586 17:64228442-64228464 GTCTCCCAGCACCCCCAGATAGG - Intronic
1151097157 17:71511548-71511570 CTCTCACATCACAGCCAGAGGGG - Intergenic
1151698616 17:75730900-75730922 CTCCTGCAGCACCCCCAGTGAGG - Exonic
1152132360 17:78485020-78485042 CTTCTCCAGCACCCCTAGAGAGG + Exonic
1152327126 17:79647995-79648017 CTCCTACTGCACCCCCAGGTGGG - Intergenic
1152630110 17:81407089-81407111 CTCCCACAGACCCCGGAGAGGGG - Intronic
1152855640 17:82663516-82663538 CTCCCCCAGCACCCCCACCTTGG - Intronic
1152905460 17:82968234-82968256 CACGCACAGCAGCCCCAGACTGG + Intronic
1154498473 18:14980082-14980104 CTCCCACTCCACACACAGAGTGG + Intergenic
1155034393 18:22013062-22013084 CTCCCACCTCACCCCCACAAAGG - Intergenic
1155413240 18:25569002-25569024 CTCTCACAGCCCCTCCTGAGTGG - Intergenic
1160015230 18:75135147-75135169 CCCCCACAGCAGCCACAGAGTGG + Intergenic
1160575210 18:79849198-79849220 CCTCCACAGCCTCCCCAGAGGGG + Intergenic
1160740358 19:682783-682805 CCGCCAGAGCTCCCCCAGAGTGG - Exonic
1160979538 19:1810670-1810692 CTCCCACAGCCCCACCAGCATGG - Exonic
1161282230 19:3452286-3452308 CTCCCACGGCAACCCCACTGGGG - Intronic
1161578293 19:5066893-5066915 TGTCCACAGCACCCCCAGCGGGG - Intronic
1162820497 19:13220529-13220551 CTCCCCCAGATCCTCCAGAGAGG + Intronic
1162971670 19:14184315-14184337 CTCCCCTGGCCCCCCCAGAGGGG - Intronic
1163210485 19:15836608-15836630 CTCCCACAGGATCCCCAGGCCGG + Intergenic
1165245435 19:34495830-34495852 AGCCCACAGAACACCCAGAGAGG - Intronic
1167390316 19:49190454-49190476 CTCCCACAGCACTCCCTTAGTGG - Intronic
1167501983 19:49853733-49853755 CTGGGACACCACCCCCAGAGGGG - Intronic
1167556504 19:50199468-50199490 TACCCACAGGACCCACAGAGGGG + Intronic
1168379423 19:55907460-55907482 CTCCCACTGCAGCCCCCGAGTGG - Intronic
926630896 2:15135454-15135476 CTCCCACTGCACCCCAAGCACGG - Intergenic
926942335 2:18151705-18151727 CTTCCCCAGCACCTTCAGAGGGG + Intronic
926993720 2:18710151-18710173 CTCCCTCAGAGCCCCCAGACAGG - Intergenic
927256345 2:21043829-21043851 CTCCCTCTGCGCCCGCAGAGCGG + Intronic
927756837 2:25715426-25715448 TTCCCACAGCCCCCCCAAACTGG - Intergenic
929174656 2:38964062-38964084 CTCACCCATCACCCCCAGATGGG - Intronic
929260758 2:39864195-39864217 CTCACACAGCATCCCCACTGGGG + Intergenic
929596194 2:43177901-43177923 CACCCACACCACCCCCATTGTGG + Intergenic
931138220 2:59428298-59428320 CTCCCACACAACCCCATGAGTGG + Intergenic
931708761 2:64969416-64969438 CTCCACCTGCAGCCCCAGAGTGG + Intergenic
933952336 2:87341852-87341874 ATCCCACAGCACCCGGAGACGGG + Intergenic
934479465 2:94622149-94622171 CTCCCCCAGCGGCCCCAGCGCGG - Intergenic
935702956 2:105828718-105828740 CTCCTACAGCAGCCCCAAGGGGG - Intronic
935978834 2:108606733-108606755 CTTCCAGAGCTCCCCCAGGGAGG - Intronic
936065637 2:109330128-109330150 ATCTCACAGCTGCCCCAGAGTGG - Intronic
936065961 2:109332402-109332424 CTCCCCCAGCACCCCGAGCAGGG + Intronic
936452337 2:112643117-112643139 CTCCAACCTCACCCTCAGAGAGG - Intergenic
936517795 2:113193144-113193166 CCTCCACAGCCTCCCCAGAGAGG - Intronic
936904813 2:117525020-117525042 CTCCCCCAGCTCCCTCAGTGCGG - Intergenic
937018054 2:118624376-118624398 CTCTCCCATCACCCCCAGATGGG + Intergenic
937902739 2:127034401-127034423 CTCTCCCATCACCCCCAGATGGG + Intergenic
938068614 2:128294888-128294910 CAGCCCTAGCACCCCCAGAGAGG + Intronic
938981878 2:136534840-136534862 CTCCTGCAGCGCCCACAGAGAGG + Intergenic
939509596 2:143089686-143089708 CTCCCCCCACACCCCCCGAGTGG - Intergenic
940904499 2:159157071-159157093 CTCCCAGAGCAAGGCCAGAGAGG + Intronic
943102091 2:183499341-183499363 ATCCCAGAGCACCACCTGAGAGG + Intergenic
943331859 2:186569479-186569501 CCCCCACCCCACCCCCCGAGAGG - Intergenic
944296082 2:198064114-198064136 CTCCCAGAGCTCCCTGAGAGTGG - Intronic
945322037 2:208435710-208435732 CTCCCTCAGAGCCTCCAGAGAGG + Intronic
945922514 2:215770201-215770223 CTGCCACAGCACCCCAAGGAAGG + Intergenic
946959901 2:224973553-224973575 CTCCCCTAGCACCCCGAGAAAGG + Intronic
947175289 2:227360443-227360465 CTCCAACAGTACCGCCAGTGGGG - Intergenic
948341577 2:237256879-237256901 CTACCACAGCCCCTCTAGAGTGG + Intergenic
948547860 2:238745539-238745561 CTCCCAGAGCAGCCCCTGGGAGG + Intergenic
949023172 2:241752761-241752783 CCCCCACACCACCCCCAGGAGGG + Intronic
949023233 2:241752927-241752949 CCCCCACGCCACCCCCAGGGCGG + Intronic
1169208678 20:3753946-3753968 CCCCCACACCCACCCCAGAGAGG + Exonic
1169630293 20:7622918-7622940 CTCCTCAAGCACCGCCAGAGTGG + Intergenic
1170010023 20:11712858-11712880 CTCCCACTTCATCCCCAGACAGG + Intergenic
1170439497 20:16364492-16364514 AGCCTACAGCACCCCTAGAGTGG - Intronic
1170440806 20:16377188-16377210 CACCCACAGCACCTCCTAAGGGG - Intronic
1171185873 20:23123680-23123702 GTCCCACAGCTGCCACAGAGTGG + Intergenic
1172177322 20:32980294-32980316 CACCCACAGGGCCGCCAGAGTGG - Intergenic
1172852087 20:37973777-37973799 CCCCCTCAGAACCCCAAGAGAGG - Intergenic
1172865742 20:38095632-38095654 CGCCCCCAGCAGACCCAGAGAGG + Intronic
1173096870 20:40041722-40041744 CTCACACAGCACAGCCTGAGAGG + Intergenic
1173191659 20:40881525-40881547 CCCCCAAAGCACCCCCCAAGAGG + Intergenic
1173497413 20:43529577-43529599 CTCCTCAAGCTCCCCCAGAGTGG - Intronic
1175050551 20:56151665-56151687 TTCCCACAGCAGCACCTGAGAGG - Intergenic
1175222724 20:57426626-57426648 CTCCCACAGCACCCCCAGGAGGG + Intergenic
1175321577 20:58091994-58092016 CTCCCCAAACACCCCCAGTGTGG - Intergenic
1175852933 20:62103679-62103701 CTCCCACAGCAGGCACGGAGGGG - Intergenic
1176171973 20:63700156-63700178 CTCCCTCAGACCCCCCAGAAAGG + Exonic
1176336383 21:5603368-5603390 CTCTCCCAGCAAGCCCAGAGAGG - Intergenic
1176391374 21:6217580-6217602 CTCTCCCAGCAAGCCCAGAGAGG + Intergenic
1176470045 21:7098594-7098616 CTCTCCCAGCAAGCCCAGAGAGG - Intergenic
1176493606 21:7480372-7480394 CTCTCCCAGCAAGCCCAGAGAGG - Intergenic
1176507036 21:7658011-7658033 CTCTCCCAGCAAGCCCAGAGAGG + Intergenic
1177866726 21:26521025-26521047 CTCCCTCCGCACCCCCTGACGGG - Intronic
1178697503 21:34807317-34807339 TTCCAACAGCACCCCTTGAGCGG + Intronic
1179062821 21:37995351-37995373 CTCCCTCAGCACCTCCAAAACGG - Intronic
1179123361 21:38569168-38569190 CTCCCCCCCCACCCCCAGTGGGG + Intronic
1179779088 21:43688023-43688045 CTCCCACAGGCCCCGCAGAGGGG + Exonic
1179930566 21:44568513-44568535 CTCCCCTGGCACGCCCAGAGGGG - Intronic
1179990935 21:44947936-44947958 GTCCCTCGCCACCCCCAGAGCGG - Intronic
1182127095 22:27824024-27824046 CTCCCACACCACCTCTTGAGAGG - Intergenic
1183004524 22:34890176-34890198 CCCACACAGCATCCCCAGTGGGG + Intergenic
1183459593 22:37941794-37941816 CTCCCATAGCCATCCCAGAGGGG - Exonic
1183470989 22:38006668-38006690 CTCCCACAGACCCCCCAGGAAGG + Intronic
1183540133 22:38425008-38425030 CACCCACAGGACCCTAAGAGAGG + Intergenic
1183662615 22:39230454-39230476 CCCCCTCAGTGCCCCCAGAGAGG + Intronic
1184248836 22:43249008-43249030 CTCCACCAGCACCCCCTGACTGG - Intronic
1184501588 22:44878025-44878047 TTCCAACAGCTCCTCCAGAGGGG + Intergenic
950902792 3:16512925-16512947 CTCCCAGGGCACACGCAGAGGGG + Intronic
951525572 3:23649679-23649701 CTCCCAGAGCACCCCCTGCTAGG + Intergenic
952819474 3:37473467-37473489 TTCCCACAGCACCCCCAGGAGGG - Intronic
952838828 3:37627376-37627398 CTCCCGCAGCAGCCCCAGAGAGG - Intronic
953422973 3:42769601-42769623 CTCCTCAAGCACCGCCAGAGTGG - Intronic
954436953 3:50501349-50501371 CTCCCCCTGGACCCTCAGAGCGG + Intronic
954589244 3:51766651-51766673 CTCCCACATCAGCCTCTGAGTGG - Intergenic
958712378 3:97732992-97733014 CTCCCACTGTCCCCACAGAGAGG + Intronic
959540220 3:107528396-107528418 CTGCCACAGTACCTCCAAAGAGG - Intronic
960987725 3:123291624-123291646 CAGGCTCAGCACCCCCAGAGAGG - Intronic
962412350 3:135152376-135152398 CTCCTGCTGTACCCCCAGAGAGG - Intronic
962741157 3:138363434-138363456 CTTCCGCAGCACCCCCAGGCTGG + Intronic
962922712 3:139965420-139965442 CTCCCACATTACCCCTGGAGAGG - Intronic
963296099 3:143548286-143548308 CACCCCCACCACCCCCAGACAGG - Intronic
967009902 3:185423059-185423081 GTCCCCCATCACCCCCAGATAGG + Intronic
968234687 3:197024550-197024572 CTCCCACAGCCCGCCCAGGCAGG - Intronic
968549097 4:1213336-1213358 CTCTCACTGCACCCCCAGCAGGG - Intronic
968642371 4:1721110-1721132 CTCCCAGAGCGCCCCGCGAGCGG - Exonic
968935371 4:3607495-3607517 CTCCCTAAGCAACCCCAGCGAGG + Intergenic
968949400 4:3682822-3682844 CTCCCAAAGCACACCCAGGAGGG + Intergenic
971085178 4:23266621-23266643 CTCCCCCATCACCCCCCGACAGG - Intergenic
971482761 4:27128776-27128798 CTCCCACGGCATCTTCAGAGAGG + Intergenic
972790804 4:42369578-42369600 CTCCTCCAGCACGGCCAGAGCGG - Intergenic
975477909 4:74844151-74844173 GTCCCCCATCACCCCCAGATGGG + Intergenic
975882635 4:78928881-78928903 GTCTCCCATCACCCCCAGAGGGG - Intronic
976440966 4:85074006-85074028 GTCCCTCATCACCCCCAGATGGG - Intergenic
976672281 4:87666645-87666667 CTCCTACATCTGCCCCAGAGGGG - Intergenic
977721407 4:100244166-100244188 CCCCCACCCAACCCCCAGAGAGG + Intergenic
981747905 4:148068722-148068744 CTGCCACAGGACCCACAGGGAGG - Intronic
985699725 5:1363311-1363333 CTCCCACAGCAGCCCCAGGGAGG - Intergenic
988138129 5:27201198-27201220 CTCACACAGAATCCCCAAAGGGG - Intergenic
988928579 5:36013723-36013745 CTCAAACAGCAGCCCCACAGGGG + Intergenic
990835712 5:60017444-60017466 CTCCCCTAGCACCCCCTGAATGG + Intronic
992490190 5:77235072-77235094 CTCACAGAGCAGCCCCACAGAGG + Intronic
993923040 5:93830925-93830947 GTCTCTCATCACCCCCAGAGAGG - Intronic
997341169 5:133145686-133145708 CATCCACAACACTCCCAGAGAGG + Intergenic
997511626 5:134458607-134458629 CTCCCCCAGGGCCCCCAGATAGG + Intergenic
997599796 5:135131491-135131513 GTCACACAGCAACCCCAAAGGGG - Intronic
999283984 5:150383099-150383121 TGGCCCCAGCACCCCCAGAGAGG + Intronic
999650024 5:153756225-153756247 ATCCCACAGCAGATCCAGAGGGG + Intronic
999809513 5:155114736-155114758 CTCCTCAAGCACCTCCAGAGTGG - Intergenic
1001462125 5:171925064-171925086 CTCCAACAGCAAGCCCAGGGCGG + Intronic
1001629113 5:173161380-173161402 CTCCCACAGCACACGCTGAGAGG - Intronic
1001853511 5:174990395-174990417 CTTCCACATTACCCCCAGAGTGG - Intergenic
1002791636 6:441565-441587 CTCACCCAGGACCCACAGAGGGG + Intergenic
1003060795 6:2860553-2860575 CTCCACCTGCACCCCCAGTGTGG + Intergenic
1003400266 6:5784998-5785020 CTCCCACAGCGTCCCCAGCTGGG - Intergenic
1003486457 6:6584325-6584347 GTCCCCCATCACCCCCAGATGGG - Intergenic
1006380516 6:33694617-33694639 CTCTCATAACACCCCCTGAGAGG - Intronic
1007252005 6:40502141-40502163 TGCCCACAGCAGCCCTAGAGGGG + Intronic
1010106784 6:72179804-72179826 CTCCCAGCGCACCACCAGACAGG + Exonic
1010120893 6:72374871-72374893 CTCTCCCATCACCCCCAGATGGG - Intronic
1015533459 6:134244120-134244142 CTCCCACCCCACCCCCTGACAGG + Intronic
1016442478 6:144097927-144097949 ATCCCCCATCACCCCCAGATGGG - Intergenic
1017294284 6:152776147-152776169 CTCCCACTGCACCCCCTGATAGG - Intergenic
1019497399 7:1346830-1346852 CTCCCACGACACCCACAGAGGGG - Intergenic
1019511315 7:1418999-1419021 CGCAGCCAGCACCCCCAGAGGGG + Intergenic
1019932588 7:4233826-4233848 CTCCCCCAGCACCACCAGCAAGG + Intronic
1021838864 7:24706326-24706348 CTCCCCCAGCACCGCCACTGTGG + Exonic
1022352515 7:29579289-29579311 CTCTCTCAGCACACACAGAGAGG - Intergenic
1022519099 7:30994473-30994495 CTCCTCCAGCACGGCCAGAGCGG + Intergenic
1023905780 7:44520877-44520899 AGCCCACAGCCACCCCAGAGAGG + Intronic
1024279920 7:47710376-47710398 CTCCTGCAGCACCAGCAGAGGGG + Intronic
1025185877 7:56858034-56858056 GTCTCACATCACCCCCAGATGGG - Intergenic
1025686049 7:63718907-63718929 GTCTCACATCACCCCCAGATGGG + Intergenic
1026010969 7:66635854-66635876 CTCCCACAGCACCCTTAGCTGGG + Intronic
1026016232 7:66672961-66672983 CTCCCACAGCACCCTTAGCTGGG + Intronic
1026270403 7:68831507-68831529 GTCTCACATCACCCCCAGATGGG - Intergenic
1026722812 7:72846543-72846565 CTCCCACCTCACCCCCATAAGGG + Intergenic
1026901388 7:74039402-74039424 CCCCCATGGCACCCCCAGGGAGG + Intronic
1027482696 7:78718597-78718619 GTCCCCCATCACCCCCAGATGGG + Intronic
1027513030 7:79107415-79107437 CTCCCCTAGAAGCCCCAGAGAGG + Intronic
1028927945 7:96380451-96380473 CTCCCTCAGATCCCACAGAGTGG + Intergenic
1029291459 7:99505038-99505060 CTCGCACAGCATCACCAAAGCGG - Exonic
1029949195 7:104564805-104564827 CTCCCACAGAAAGCCCAGATGGG - Intronic
1030361897 7:108603960-108603982 CACCCACAGCACTCACAGTGGGG - Intergenic
1030981279 7:116187472-116187494 CTTCCAGAGAACCACCAGAGAGG - Intergenic
1031292191 7:119951458-119951480 CTCCACCTGCACCCCCAGTGTGG - Intergenic
1032079077 7:128849730-128849752 TCCCCACAGCACCCCCGAAGTGG + Intronic
1035641008 8:1185090-1185112 CTGCCCCAACACCCCAAGAGAGG - Intergenic
1035648908 8:1249277-1249299 TTCCCACGGGACCCACAGAGAGG - Intergenic
1036038182 8:5043037-5043059 GTCCCCCATCACCCCCAGAAGGG - Intergenic
1037673740 8:21037115-21037137 CTCCCACAGCATTCCCAGGATGG + Intergenic
1037969826 8:23164127-23164149 CTCCCCCAGCACCTCCAGGAGGG + Intergenic
1038687221 8:29729478-29729500 GTCTCCCATCACCCCCAGAGGGG - Intergenic
1042337760 8:67646502-67646524 ACTCCACAGCACCTCCAGAGAGG - Intronic
1047468440 8:125143069-125143091 CTCCCAGGACACCCCCAGTGTGG + Intronic
1048703081 8:137116036-137116058 CTCCTCCAGCACCGCCAGAGTGG + Intergenic
1048938105 8:139373759-139373781 CTCTCCCATCACCCCCAGATGGG + Intergenic
1049429203 8:142551340-142551362 CCCCCACAGCAGCCCCGGGGTGG - Intergenic
1049830687 8:144699389-144699411 CACCCACAGCACCCCCACACCGG - Intergenic
1053312792 9:37029949-37029971 CTCCCCCACCATCCCGAGAGCGG - Intronic
1053442744 9:38129477-38129499 CTCCCTAAGAGCCCCCAGAGAGG - Intergenic
1053928347 9:43089775-43089797 CTCCCCCAGCGGCCCCAGCGCGG + Intergenic
1054285360 9:63163516-63163538 CTCCCCCAGCGGCCCCAGCGCGG - Intergenic
1054291442 9:63296968-63296990 CTCCCCCAGCGGCCCCAGCGCGG + Intergenic
1054389460 9:64601507-64601529 CTCCCCCAGCGGCCCCAGCGCGG + Intergenic
1054454816 9:65424408-65424430 CTCCCTAAGCACCCCCAGCGAGG - Intergenic
1057335529 9:94152131-94152153 CTCCCCGAGCAACCCCGGAGGGG + Intergenic
1058068089 9:100571811-100571833 GTCCCCCATCACCCCCAGATGGG - Intronic
1060340546 9:122771806-122771828 CTCCCCCTGCAGCCCCTGAGAGG - Intergenic
1060350997 9:122859916-122859938 GTCCCACAGTACCCACAGACAGG - Exonic
1060811827 9:126614568-126614590 ACCCAGCAGCACCCCCAGAGTGG - Exonic
1061627331 9:131848758-131848780 CCCCCGCAGCGCCTCCAGAGGGG + Intergenic
1061824861 9:133251916-133251938 CGCCCCCAGCACCCCTAGTGCGG + Intronic
1062539124 9:137033997-137034019 TTGCCCCAGCACCCTCAGAGGGG + Intronic
1062564326 9:137157183-137157205 CTCCCCCAGCTCCCTAAGAGCGG - Intronic
1062610744 9:137372351-137372373 CTCCCACAGCACCCCCAGAGTGG - Intronic
1203425262 Un_GL000195v1:31534-31556 CTCTCCCAGCAAGCCCAGAGAGG + Intergenic
1185836942 X:3353412-3353434 CTCTCCCATCACCCCCAGATGGG - Intergenic
1186206025 X:7201575-7201597 CTCCCACAGCACAAGCAGAAAGG - Intergenic
1189309816 X:40011328-40011350 CTGCCACCCCAGCCCCAGAGAGG + Intergenic
1189487603 X:41445288-41445310 CTCCCCCAGCAGCCCACGAGTGG + Intergenic
1190225820 X:48544291-48544313 GTCCCACATCTACCCCAGAGGGG + Intronic
1190541769 X:51484610-51484632 GCCCCGCAGCACCCCAAGAGAGG + Intergenic
1190765625 X:53473449-53473471 CTCCCCCAGCACTACCAGATTGG - Intergenic
1192234532 X:69287297-69287319 CTGGCTCAGCTCCCCCAGAGAGG + Intergenic
1192554118 X:72076868-72076890 CTCCCAGAGCACAGACAGAGGGG + Intergenic
1196582756 X:117395092-117395114 CTCCAACTGCAGCCCCAGTGCGG + Intergenic
1196716131 X:118812580-118812602 CTCCCAAAGCACCACCATAGAGG - Intergenic
1201239629 Y:11946324-11946346 CTCTCCCATCACCCCCAGATGGG + Intergenic