ID: 1062611268

View in Genome Browser
Species Human (GRCh38)
Location 9:137374746-137374768
Sequence TCTCTGTCCCTCGGGACTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 198}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062611258_1062611268 16 Left 1062611258 9:137374707-137374729 CCCCTCGGGGAAAGTGGCCAGAC 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1062611268 9:137374746-137374768 TCTCTGTCCCTCGGGACTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 198
1062611256_1062611268 26 Left 1062611256 9:137374697-137374719 CCAAAGGATGCCCCTCGGGGAAA 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1062611268 9:137374746-137374768 TCTCTGTCCCTCGGGACTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 198
1062611260_1062611268 14 Left 1062611260 9:137374709-137374731 CCTCGGGGAAAGTGGCCAGACAG 0: 1
1: 0
2: 1
3: 15
4: 201
Right 1062611268 9:137374746-137374768 TCTCTGTCCCTCGGGACTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 198
1062611264_1062611268 -1 Left 1062611264 9:137374724-137374746 CCAGACAGGGTGAAAGGCAGCTT 0: 1
1: 0
2: 1
3: 17
4: 164
Right 1062611268 9:137374746-137374768 TCTCTGTCCCTCGGGACTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 198
1062611254_1062611268 29 Left 1062611254 9:137374694-137374716 CCTCCAAAGGATGCCCCTCGGGG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1062611268 9:137374746-137374768 TCTCTGTCCCTCGGGACTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 198
1062611259_1062611268 15 Left 1062611259 9:137374708-137374730 CCCTCGGGGAAAGTGGCCAGACA 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1062611268 9:137374746-137374768 TCTCTGTCCCTCGGGACTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 198
1062611252_1062611268 30 Left 1062611252 9:137374693-137374715 CCCTCCAAAGGATGCCCCTCGGG 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1062611268 9:137374746-137374768 TCTCTGTCCCTCGGGACTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062611268 Original CRISPR TCTCTGTCCCTCGGGACTCT GGG Intronic
900234690 1:1582537-1582559 TCCCTTTCCCCCAGGACTCTTGG + Intergenic
901130063 1:6956775-6956797 CCTCTGTCTGTCGGGACTGTGGG + Intronic
901221399 1:7585929-7585951 TCTGTGTCCCCCAGGACCCTGGG + Intronic
901269783 1:7942701-7942723 TCTCTCTCCCTGGCCACTCTCGG + Intronic
901749214 1:11395764-11395786 CCTCTCTCCCTCGGCTCTCTCGG + Intergenic
901921247 1:12539380-12539402 TCTCTGTCCCTGTGGAGTCTCGG - Intergenic
904278175 1:29397687-29397709 TCTCTGTCTCTGGGGTCTCGAGG + Intergenic
906743247 1:48203030-48203052 TCTCTGAATCTCAGGACTCTTGG - Intergenic
907430672 1:54409488-54409510 TCTCGGTCCCTGGGGGCTCCTGG - Intronic
907998282 1:59654977-59654999 TCTGTGTCCCTGGGCACTCAGGG + Intronic
909290332 1:73874911-73874933 TTTCTGCCCCTGGAGACTCTAGG - Intergenic
909979554 1:82082503-82082525 ATTCAGTCCCTCGTGACTCTAGG + Intergenic
910647091 1:89525322-89525344 TCTCTTTCCCCCGGGAGTCTCGG + Intronic
911313224 1:96323442-96323464 TCTCAGTCCCTTGGGAAGCTGGG - Intergenic
911557566 1:99363509-99363531 CTTCTGTCCTTGGGGACTCTAGG - Intergenic
912418571 1:109528489-109528511 ACTCTCTTCCTCAGGACTCTTGG - Intergenic
913374259 1:118133292-118133314 TCTCTCTCCATCTGCACTCTGGG - Intronic
913626446 1:120664979-120665001 TCTCTCTCCCTAAGGGCTCTGGG + Intergenic
915731706 1:158058689-158058711 TTTCAGTCCCTCGGGGATCTTGG + Intronic
916314778 1:163436957-163436979 GCTCTGACCCTCGCAACTCTTGG - Intergenic
916541368 1:165758255-165758277 TTTCTGTTCCTCAAGACTCTTGG + Intronic
917289108 1:173453933-173453955 TATCTGCCCATGGGGACTCTTGG + Intergenic
919254706 1:195105903-195105925 TCCCTTTCCCTAGGGAATCTAGG - Intergenic
919803184 1:201365622-201365644 TCTCTCTCCATCGGGGATCTTGG + Exonic
920807201 1:209246010-209246032 TCCCTGTTCCTCGGGGCTCCTGG - Intergenic
1064278994 10:13933765-13933787 TCTGTGTCCCAGGGGCCTCTAGG - Intronic
1065319185 10:24493252-24493274 TCTCAGTCCCACAGGCCTCTGGG - Intronic
1067227706 10:44386335-44386357 TCCCTGTCCCTGGGGAGTCCTGG + Intronic
1068924060 10:62516643-62516665 TCACTGACCCTCAAGACTCTAGG + Intronic
1072755695 10:98019378-98019400 CCTCTGGCCCTGGGGACTTTTGG + Intronic
1073357659 10:102869913-102869935 ACCCTGTCCCCCGGGACTCCTGG + Intronic
1074358446 10:112806158-112806180 TCCCAGTCCCTCAGGTCTCTCGG + Intronic
1074708206 10:116154863-116154885 TCTCTGTGCCTCTGTGCTCTTGG + Intronic
1075871414 10:125774430-125774452 TCTCTGTCTCTCTAGACTTTGGG - Intronic
1076057439 10:127387074-127387096 CCTCTGGCCCTCGGGCCTCCCGG - Intronic
1076120694 10:127934729-127934751 GCTCTGTGCCTGGGGGCTCTGGG + Intronic
1082833450 11:57636409-57636431 TCGCTGTTCCTCGTGCCTCTAGG - Intergenic
1082912558 11:58393188-58393210 TCTTTGTGCCTCAGGAATCTTGG - Intergenic
1083745762 11:64735710-64735732 TCTCTGTTCCCCGGGGCTCTGGG - Intronic
1083866815 11:65459582-65459604 TCTCTATCCCTAAGAACTCTTGG - Intergenic
1085387254 11:76164311-76164333 TCTCTTTCCCTTGTGACCCTGGG - Intergenic
1088215353 11:107501928-107501950 TCTGTTTACCTGGGGACTCTGGG + Intergenic
1089305242 11:117522334-117522356 TCCCTTTCCCTCTGGACTGTGGG + Intronic
1091907364 12:4199972-4199994 CCTCTGTCCTTCCTGACTCTGGG + Intergenic
1099944046 12:89223932-89223954 TCTCTGAGCTTCGTGACTCTGGG - Intergenic
1100403924 12:94256476-94256498 TCTCGGTGCCTCGGTACTCTTGG - Intronic
1102115679 12:110401450-110401472 TCTCTGACTCCCAGGACTCTCGG - Intronic
1102385715 12:112507754-112507776 TCTCAGTCCCTTGAGACTTTGGG + Exonic
1103240354 12:119408297-119408319 TCTCTGTGGGTCGGGAATCTAGG + Intronic
1104617588 12:130283488-130283510 TCTCTGGCCCTTGCTACTCTAGG - Intergenic
1112974801 13:105304168-105304190 TCTCTCTCCCTGTGGACTCGAGG - Intergenic
1114332112 14:21647492-21647514 TCTCTCTCCCTCTAGTCTCTTGG + Intergenic
1117041581 14:51773720-51773742 CCTCTCTCCCTCGGGATACTAGG - Intergenic
1118460349 14:65981394-65981416 TCTCTGTCCCTGGGCACTTCGGG - Intronic
1118838176 14:69491398-69491420 TCACTCTCTCTCTGGACTCTTGG + Intronic
1119046815 14:71325742-71325764 TCTCTTTGCCTCTGGAGTCTGGG + Intronic
1120261964 14:82197130-82197152 TGTCTGTCACTTGTGACTCTTGG - Intergenic
1120875435 14:89371147-89371169 TCTCTGACCCTGGTGACTCTTGG - Intronic
1126692198 15:51296286-51296308 TCTCTTTCCCTCAGGTCTCAGGG - Intronic
1128327622 15:66735275-66735297 TCTCTGTCCCTTGGCACTGTTGG + Intronic
1128879878 15:71233182-71233204 TTTCTGTCCCTCTGGTCTTTGGG + Intronic
1129030311 15:72612710-72612732 TCTCTGCCTCTCGGGACCTTGGG + Intergenic
1129681558 15:77661203-77661225 TCTCTGTCCCTCTGCCTTCTTGG - Intronic
1131155657 15:90073633-90073655 TCCCTGTCTCTCGGGTGTCTGGG + Intronic
1131394794 15:92077698-92077720 TCTGTCTCCCTCAGGACCCTGGG + Intronic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1133428081 16:5710757-5710779 TCTGTGTCCCTGGGGACCCCTGG + Intergenic
1133745577 16:8684139-8684161 TCCCTGTTCCTGGGGATTCTAGG + Intronic
1134360592 16:13527436-13527458 TCTCTGCCCCTCTCAACTCTGGG - Intergenic
1134686904 16:16165484-16165506 TCCCTGTCCCTGGGAATTCTAGG + Intronic
1137859910 16:51836230-51836252 TCTGTCTCCCTCTGGACTGTAGG + Intergenic
1138589175 16:57990329-57990351 TCTCAGTCTCCAGGGACTCTTGG + Intergenic
1140934416 16:79657273-79657295 TCTCTCTCTCTCGGGAATCCTGG + Intergenic
1142396114 16:89832613-89832635 TCACTGTCCCTGGGCACCCTCGG + Intronic
1142429140 16:90017012-90017034 CCTCTGTCCCTGTGGACCCTTGG + Intronic
1142670376 17:1485257-1485279 TCTCTGACCCTGGATACTCTGGG - Intronic
1143021408 17:3918805-3918827 TGTCTGTCCCTGAGGACGCTGGG - Intergenic
1143782511 17:9236700-9236722 GCTCTATCCCTCTGGACTCCCGG + Intronic
1146482932 17:33219627-33219649 ACTGTGTCCTGCGGGACTCTGGG + Intronic
1146896824 17:36548092-36548114 TCTTTGTCCCTAGGGTCTGTAGG + Intronic
1148648093 17:49230640-49230662 CCTCAGTCCCTCGGGACTGGAGG - Exonic
1152223405 17:79081707-79081729 GCCCTGTCCCTCTGGGCTCTAGG + Intronic
1153155468 18:2144510-2144532 TTTTTGTCTCTCGGGACACTTGG - Intergenic
1153584612 18:6608289-6608311 TCTCTTACCCTCGGTACTCCTGG - Intergenic
1153659824 18:7316871-7316893 CCTCTGACCCTGGGGACTGTCGG + Intergenic
1154128113 18:11712179-11712201 TCTTTGTCCCTCAGCACGCTGGG + Intronic
1154134752 18:11766478-11766500 TGGCTGTCTCTGGGGACTCTGGG - Intronic
1154491539 18:14925802-14925824 AATCTCTCCCTCGGGCCTCTGGG - Intergenic
1157555317 18:48609762-48609784 TCCCTGTCCCTGGTGCCTCTAGG + Intronic
1157697017 18:49730993-49731015 TTTCTGTCCCTCTGGATTCCAGG - Intergenic
1160420570 18:78741084-78741106 TCTCTGTCCCCCGTGGCTCCGGG - Intergenic
1160686892 19:441043-441065 CCTCTGTCCCTGGTGGCTCTGGG + Intronic
1160725157 19:614602-614624 TCCCTGGCTCTCTGGACTCTAGG - Intronic
1160776536 19:859206-859228 TCTCTGTCCCTGTGGCCTCTGGG - Intergenic
1160817289 19:1042051-1042073 TCTCTGTCCCCAGGGTCTCCCGG + Exonic
1161137288 19:2627185-2627207 TTTCTGTCCCAGGGGACGCTGGG + Intronic
1161309383 19:3585615-3585637 TCTCGGTCCCCCGGGCCTCCCGG - Exonic
1162402343 19:10453863-10453885 TCTCTGTACCCAGGGTCTCTGGG + Intronic
1162730475 19:12715537-12715559 TCTCTGCCCCTCTGCACTCAGGG - Exonic
1162756653 19:12864974-12864996 CCTCTGTCCCTCGGGAGGCCAGG + Intronic
1162951198 19:14072956-14072978 TGTCTGGCCCTGGGGACTCCTGG - Exonic
1163118199 19:15200588-15200610 TCCCTGTTCCTTGGGCCTCTGGG + Intronic
1164394604 19:27851757-27851779 CCTCACTCCCTCGGGCCTCTGGG + Intergenic
1164415418 19:28043222-28043244 TCCCAGTCCCTTGGGACTCTGGG - Intergenic
1164519975 19:28971674-28971696 TCCCAGCCCCTCAGGACTCTGGG - Intergenic
1165498782 19:36171070-36171092 TTCCTCTCCCTGGGGACTCTAGG + Intergenic
1166301542 19:41914279-41914301 TCTCTGTCTCTCCGGTCACTTGG + Intronic
1167072025 19:47227232-47227254 TCTCTGGCCTTCTGGTCTCTAGG - Intronic
1168219080 19:54947535-54947557 TCTCTGGCCCTTGGTACGCTAGG + Intronic
926110904 2:10183283-10183305 TTTATGTCCCTCAGGACTCACGG + Intronic
928122446 2:28592711-28592733 TCTCTGACCGTAAGGACTCTTGG + Exonic
928633999 2:33224036-33224058 TCTCTGTCCCAGGGGACTGATGG + Intronic
930665845 2:54097669-54097691 TCTCTGTCCCTCTTTATTCTCGG + Intronic
932594841 2:73087441-73087463 TCTCTGTCCTTGGAGACCCTGGG - Intronic
934818223 2:97348655-97348677 TCTCTGTCTCTTGTTACTCTGGG + Intergenic
935384320 2:102485139-102485161 TCTCGGTCCTTCAGGCCTCTTGG + Intronic
939535187 2:143418825-143418847 GCTCTTTCCCTCTGCACTCTTGG - Intronic
945396047 2:209319729-209319751 TCTCTGTCTCTCCTGTCTCTTGG - Intergenic
948257366 2:236577943-236577965 CCTCTGCTCCCCGGGACTCTGGG + Intronic
948728185 2:239947321-239947343 GCTCTGTCCCTGGGGGCTCTGGG - Intronic
1168801618 20:647058-647080 TCCCTTTCCCCAGGGACTCTTGG + Exonic
1172955624 20:38756118-38756140 TCTCTTTCCCTCCTGACTCTGGG - Intronic
1173406974 20:42774799-42774821 TCTCTGCTCCTTGGGGCTCTGGG + Intronic
1175693200 20:61081272-61081294 TTCCTGTCCCACTGGACTCTTGG + Intergenic
1175779634 20:61674222-61674244 TCTCCGCCCCACGGGACTCGGGG - Intronic
1175862702 20:62158821-62158843 TCTCTGTGCTGGGGGACTCTTGG - Intronic
1176254561 20:64145051-64145073 TCTCTGTCCCTTAGGTCCCTAGG + Intergenic
1181600097 22:23946284-23946306 AGTCTGTCCCTCCGGGCTCTGGG - Intergenic
1181608407 22:23995029-23995051 AGTCTGTCCCTCTGGGCTCTGGG + Intergenic
1182433655 22:30316159-30316181 TCGGTGTCCCTCAGGACTTTGGG - Intronic
1182477435 22:30583850-30583872 TCTCTGCCCCACAGGACTCGGGG - Intronic
1184707626 22:46225174-46225196 TCTGTGTCCATCTGGACACTGGG + Intronic
1185028915 22:48431615-48431637 CCTCTGTCTCCCAGGACTCTCGG + Intergenic
1185185649 22:49398132-49398154 TCTCTGTCCCTCCGTACTCCTGG - Intergenic
953280605 3:41551827-41551849 TCTCTGTTCATCAGGGCTCTTGG - Intronic
953603007 3:44386712-44386734 TCTCTGTCCCTCCGGACTTTGGG + Intronic
954605225 3:51904332-51904354 CCTCTGTCCCTGGGGTCTCAAGG + Intergenic
954705996 3:52480790-52480812 TCTCTGTCCCTGTGGACCCATGG + Intronic
955411666 3:58659428-58659450 TCTCTGTCCATCTTGGCTCTGGG - Intronic
961675210 3:128560841-128560863 TCTCTGTCCTGGGGGGCTCTGGG - Intergenic
961818507 3:129563500-129563522 TCTCTGAGCCTCGGCACTGTTGG - Intronic
966878777 3:184338202-184338224 TCACTGACCCTCGGGCCCCTGGG - Intronic
969020558 4:4137477-4137499 CCTCTCTCCCTCGGGATACTAGG - Intergenic
969733274 4:8969859-8969881 CCTCTCTCCCTCGGGATACTAGG + Intergenic
969792864 4:9503935-9503957 CCTCTCTCCCTCGGGATACTAGG + Intergenic
977858207 4:101921984-101922006 TCTTTGTCCCTGTGGACACTGGG + Intronic
979951987 4:126904651-126904673 TCGCTGTGCCTGGGGACTCTTGG + Intergenic
980594313 4:134932992-134933014 TCTCTGGAACTCGGGAGTCTTGG - Intergenic
982135629 4:152271875-152271897 TTTCTGTGCCTCGGTTCTCTGGG - Intergenic
985305314 4:188533038-188533060 TCTCAGTCCCTCCAGATTCTGGG + Intergenic
985873727 5:2579109-2579131 CCTCTCTCCCAGGGGACTCTCGG + Intergenic
986170523 5:5310949-5310971 TCTCTGGTCCTCGTGGCTCTGGG - Intronic
987115397 5:14722664-14722686 TTTCTATCCCTAGGGACTCATGG - Intronic
988109989 5:26807666-26807688 TCTCTGCCCCTCAAGACTTTGGG + Intergenic
990224250 5:53631504-53631526 GCTCTGTCCCAGGGGAATCTGGG + Intronic
997262415 5:132475165-132475187 TCTCTGGCTCTGGGGCCTCTGGG + Intronic
1000041352 5:157487402-157487424 TCTCTGACCCTAAGGACTCTGGG - Intronic
1000256289 5:159541617-159541639 TCTCTCTTCCTCAGGACACTGGG - Intergenic
1001001479 5:168011612-168011634 TCTGTGTCCCTCGTTCCTCTTGG + Intronic
1001281530 5:170389530-170389552 TCTGTTTCCCACGAGACTCTGGG - Exonic
1002549156 5:179974181-179974203 TCTCTGTCTCTATGGACCCTCGG + Intronic
1004757681 6:18630811-18630833 AGTCTCTCTCTCGGGACTCTGGG - Intergenic
1005414321 6:25585056-25585078 TCTCTGTCCATCAGTGCTCTGGG - Intronic
1007601899 6:43087399-43087421 CCTCTCTCCCTGGGGACACTAGG + Intronic
1010955723 6:82088788-82088810 TCTCTGACCCTCTGGTTTCTTGG - Intergenic
1013490885 6:110645609-110645631 CCTCGGTCCCTCGGGACTACAGG + Intronic
1017631026 6:156396826-156396848 TCTCTGTCCCTCAGTAATCCCGG - Intergenic
1018246404 6:161828657-161828679 ACTCTGTCTCTCAGCACTCTGGG + Intronic
1018585142 6:165349686-165349708 TTTCTGCCCCTTGGGCCTCTGGG - Intronic
1018694881 6:166383233-166383255 TCTCTGACCCACAGGACTGTGGG + Intergenic
1019742489 7:2681827-2681849 TCTCTGTCTCTTGGGGTTCTTGG - Intronic
1020085795 7:5309434-5309456 GCTCTGCCGCTTGGGACTCTGGG + Intronic
1022415849 7:30176419-30176441 TTTCTGTGCCTCAGGAATCTGGG + Intergenic
1022575119 7:31489971-31489993 TCTCTGTCCCTGGGGAACCCAGG + Intergenic
1022979403 7:35590055-35590077 TATCTGTCCGTGGAGACTCTTGG - Intergenic
1023622716 7:42089092-42089114 TCTCTGTCCTTAGGGGCACTTGG - Intronic
1025029882 7:55548404-55548426 CCTCTGCCCCTCCGGACTCGGGG + Intronic
1026622052 7:71958362-71958384 TCTCTGTCTCATGAGACTCTTGG + Intronic
1029079110 7:97958517-97958539 TCTCTCCCCCTCGGGATACTAGG - Intergenic
1029301511 7:99585392-99585414 TCTCTTTCCCTCTGGACATTAGG + Intronic
1030143233 7:106326779-106326801 TCTCTGTCCCTCTGTCCTCAAGG + Intergenic
1033244816 7:139708661-139708683 CCTCTGTCTCTGGGGACACTGGG + Intronic
1033472651 7:141663863-141663885 TGTCTGTCCCTCAGGACTCAGGG - Intronic
1034200473 7:149280493-149280515 TCTATCTCCCTGGGGACTGTGGG + Intronic
1034474651 7:151275476-151275498 TCTTTGTCCCGCAGGACCCTGGG - Intronic
1034562234 7:151888355-151888377 TCCCTTTCTCTCTGGACTCTTGG + Intergenic
1035270829 7:157719017-157719039 TCTCTGGCCCTGGGGGCTCCAGG + Intronic
1037390439 8:18387002-18387024 TCTCTGTCCCGCGAGTCTCGAGG - Intergenic
1037427728 8:18774942-18774964 TCTCTTTCCCTCGGGGCATTTGG - Intronic
1038487410 8:27946719-27946741 TCTCTGGCCCTGGGCACACTTGG - Intronic
1039985958 8:42448287-42448309 TCTCTCTCCCTGTGGTCTCTAGG - Intronic
1040565758 8:48565214-48565236 TCTCACTCCCTTGGGACTTTGGG + Intergenic
1043198037 8:77325248-77325270 TCTCTTGCCCTCAGCACTCTTGG - Intergenic
1044738783 8:95304611-95304633 TCCTTGTCCTTGGGGACTCTTGG + Intergenic
1047255552 8:123210940-123210962 TCTCTGTCCCTCCAGAATGTAGG + Intergenic
1049235610 8:141510806-141510828 TCTCTGTCCCTCAGGAAGGTGGG + Intergenic
1049803576 8:144529048-144529070 TCCCTCTCCCTCGGGCCTCGGGG + Exonic
1051100296 9:13513508-13513530 TCTCTGTCTCTGTCGACTCTGGG - Intergenic
1053303700 9:36969356-36969378 TCCCTCTCCCCCGGGACTCATGG + Intronic
1059798042 9:117720880-117720902 TGTCTTTCCCTTTGGACTCTGGG + Intergenic
1061003621 9:127916424-127916446 TCGCTGTCCCTCAGTAGTCTAGG + Exonic
1061948981 9:133925571-133925593 ACTCTGCCCCTGGGGACTTTGGG - Intronic
1062480115 9:136747218-136747240 TCTGTGTCCCTGGGGCCTCCAGG - Intronic
1062611268 9:137374746-137374768 TCTCTGTCCCTCGGGACTCTGGG + Intronic
1062710109 9:137970942-137970964 TCTCTCGCCCTCCGGACTCAGGG - Intronic
1186111169 X:6257330-6257352 TCACTATCCCTGGGGACTCCAGG - Intergenic
1187203037 X:17154408-17154430 TCTCTGTCTCACTGGACTGTGGG - Intergenic
1188476629 X:30599121-30599143 TCTCTGTGCCTCGTGACATTAGG + Intergenic
1190687711 X:52889203-52889225 TCTATGTCACTGGGGTCTCTTGG + Intergenic
1190698271 X:52966589-52966611 TCTATGTCACTGGGGTCTCTTGG - Intronic
1190816345 X:53933262-53933284 TCTCTGTACTTCGAGATTCTAGG + Intergenic
1191995063 X:67085568-67085590 TCTGTGTTCCTCGGGAATATTGG + Intergenic
1192125668 X:68498906-68498928 TCGCTGTCCCTCGGTCCTCGGGG - Exonic
1198608341 X:138369316-138369338 TTTCTGTTTCTCGGGACTGTGGG + Intergenic