ID: 1062611268

View in Genome Browser
Species Human (GRCh38)
Location 9:137374746-137374768
Sequence TCTCTGTCCCTCGGGACTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 198}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062611260_1062611268 14 Left 1062611260 9:137374709-137374731 CCTCGGGGAAAGTGGCCAGACAG 0: 1
1: 0
2: 1
3: 15
4: 201
Right 1062611268 9:137374746-137374768 TCTCTGTCCCTCGGGACTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 198
1062611264_1062611268 -1 Left 1062611264 9:137374724-137374746 CCAGACAGGGTGAAAGGCAGCTT 0: 1
1: 0
2: 1
3: 17
4: 164
Right 1062611268 9:137374746-137374768 TCTCTGTCCCTCGGGACTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 198
1062611258_1062611268 16 Left 1062611258 9:137374707-137374729 CCCCTCGGGGAAAGTGGCCAGAC 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1062611268 9:137374746-137374768 TCTCTGTCCCTCGGGACTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 198
1062611254_1062611268 29 Left 1062611254 9:137374694-137374716 CCTCCAAAGGATGCCCCTCGGGG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1062611268 9:137374746-137374768 TCTCTGTCCCTCGGGACTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 198
1062611259_1062611268 15 Left 1062611259 9:137374708-137374730 CCCTCGGGGAAAGTGGCCAGACA 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1062611268 9:137374746-137374768 TCTCTGTCCCTCGGGACTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 198
1062611256_1062611268 26 Left 1062611256 9:137374697-137374719 CCAAAGGATGCCCCTCGGGGAAA 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1062611268 9:137374746-137374768 TCTCTGTCCCTCGGGACTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 198
1062611252_1062611268 30 Left 1062611252 9:137374693-137374715 CCCTCCAAAGGATGCCCCTCGGG 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1062611268 9:137374746-137374768 TCTCTGTCCCTCGGGACTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062611268 Original CRISPR TCTCTGTCCCTCGGGACTCT GGG Intronic