ID: 1062611451

View in Genome Browser
Species Human (GRCh38)
Location 9:137376384-137376406
Sequence TCTGGTGAACAGGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 417}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062611451_1062611460 19 Left 1062611451 9:137376384-137376406 CCTTCCACCTCCTGTTCACCAGA 0: 1
1: 0
2: 2
3: 37
4: 417
Right 1062611460 9:137376426-137376448 TCATCTATCCATGTGCTTAGAGG No data
1062611451_1062611455 -10 Left 1062611451 9:137376384-137376406 CCTTCCACCTCCTGTTCACCAGA 0: 1
1: 0
2: 2
3: 37
4: 417
Right 1062611455 9:137376397-137376419 GTTCACCAGACACTCCCTACAGG No data
1062611451_1062611456 -9 Left 1062611451 9:137376384-137376406 CCTTCCACCTCCTGTTCACCAGA 0: 1
1: 0
2: 2
3: 37
4: 417
Right 1062611456 9:137376398-137376420 TTCACCAGACACTCCCTACAGGG 0: 19
1: 36
2: 50
3: 57
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062611451 Original CRISPR TCTGGTGAACAGGAGGTGGA AGG (reversed) Intronic
900078233 1:835127-835149 GTGGGTGAACAGGGGGTGGAGGG - Intergenic
900396040 1:2453640-2453662 TCTGCTCCACAGGGGGTGGAAGG - Intronic
901630762 1:10647089-10647111 TCTGGGGAGGAGGAGGGGGAGGG + Intronic
901944563 1:12691228-12691250 TCTGGGGAACAGGTGAGGGAAGG + Intergenic
902649525 1:17827501-17827523 TCATGTGATCTGGAGGTGGAGGG + Intergenic
903084548 1:20843801-20843823 ACTGGAGGACAGAAGGTGGAAGG - Intronic
903296302 1:22345280-22345302 GCTGGTGTACCGGGGGTGGATGG - Intergenic
904307991 1:29602659-29602681 TGTGGTGAACAGGCAGTGAAAGG + Intergenic
904319142 1:29685185-29685207 TCTGATCAGCAGGAGGTGGGGGG + Intergenic
905264303 1:36740384-36740406 CCTGGAGAGCAAGAGGTGGATGG + Intergenic
906304569 1:44708625-44708647 TCAGGACAACAGGAGGCGGAGGG + Intronic
906717996 1:47984512-47984534 CAAGGTGAACTGGAGGTGGAGGG + Intronic
907978169 1:59453867-59453889 TGTGGGGGACAGGAGGAGGAGGG + Intronic
908092498 1:60700787-60700809 TCTGGAGAACAGGTGGTGTTTGG + Intergenic
908180483 1:61599277-61599299 TCTTGTAGACAGGAGATGGATGG - Intergenic
908224240 1:62040058-62040080 TCTGGTGAAGGGGAGGTAAAAGG + Intronic
910503938 1:87927718-87927740 TCTATTGTACAGGAGGTGAAAGG - Intergenic
912283835 1:108347091-108347113 TTTGGAGAACAGGAGGTGTTTGG + Intergenic
912354840 1:109046472-109046494 GCTGGGGAAGCGGAGGTGGAAGG - Intergenic
912355332 1:109050120-109050142 TCTGGAAAAAAGAAGGTGGAAGG + Intergenic
913244578 1:116860357-116860379 TCTGGTGGGCAGGAGTTGGGGGG + Intergenic
913320980 1:117588235-117588257 AGTGTTGAGCAGGAGGTGGATGG - Intergenic
914905658 1:151741487-151741509 TCTGGTGAAGAGGAGGTAAAAGG - Intergenic
915418643 1:155761958-155761980 TCTGGTCAACAGAAGGATGATGG + Intronic
916168718 1:161984980-161985002 CCTGGTGGAGAAGAGGTGGATGG + Exonic
916542266 1:165768520-165768542 ACTCGTGAACAGGAGCAGGAGGG - Intronic
916747912 1:167698482-167698504 TCTGCTGCACATGAGGAGGACGG + Intronic
917175021 1:172224494-172224516 TTTGATGAAGATGAGGTGGATGG + Intronic
917641161 1:176984351-176984373 TCTGGGAAAAAGGAAGTGGAAGG + Intronic
918881551 1:190130515-190130537 TGTGGTGGACAGGAGGCAGAAGG - Intronic
919785026 1:201253386-201253408 TTAGGTGGACAGGAGGTGCAGGG + Intergenic
921854342 1:219965071-219965093 TCTGTTGATGAGGAGGTTGAGGG - Intergenic
922352569 1:224746267-224746289 ACTGGTTCACGGGAGGTGGAAGG + Intergenic
922956977 1:229611298-229611320 TCTTGTAAACAGGAGGAGAATGG - Intronic
924026299 1:239836579-239836601 TCAGGTGAAAAGGAGGTTCAAGG - Intronic
1062967743 10:1623048-1623070 TGTGCTGAGCAGGAGTTGGAAGG + Intronic
1063448621 10:6136257-6136279 CCTGCTCAGCAGGAGGTGGAGGG - Intergenic
1064227212 10:13497723-13497745 TCAGGTGAACAGGTGCTGGAGGG - Intronic
1064577150 10:16758010-16758032 TCTTGCCACCAGGAGGTGGAGGG - Intronic
1064589090 10:16869809-16869831 TCATGGGAGCAGGAGGTGGAGGG + Exonic
1064707814 10:18090948-18090970 TCTGGTGAAGGGGAGGTAAAAGG + Intergenic
1065894089 10:30146364-30146386 TTTGGGGAACAGGTGGTGGTTGG + Intergenic
1067094200 10:43287497-43287519 ACCGGTAAACAGGAAGTGGAAGG + Intergenic
1067289619 10:44931687-44931709 CCTGGTGACCAGCAGGTAGAAGG + Intronic
1067338683 10:45383851-45383873 TGTGGTCAACAGAATGTGGAAGG + Intronic
1068686035 10:59870655-59870677 TCTGACAAACAGGAGATGGATGG + Intronic
1068904811 10:62310822-62310844 TCTGGTGAAGAGGAGGTAAAAGG + Intergenic
1069367201 10:67706317-67706339 TCTGGTGAAGAGGAGGTAAAAGG + Intergenic
1069606969 10:69744929-69744951 TCTGGTGAAGAGGAGGTAAAAGG + Intergenic
1070379154 10:75864366-75864388 TCAGGGGAACAGGAGGTTAAAGG - Intronic
1070775491 10:79107512-79107534 TCTGGTGAATGTGAGGTGGGAGG + Intronic
1071230522 10:83580314-83580336 TCTGGTGAAGAGCAGGGGGTTGG + Intergenic
1072142227 10:92599290-92599312 TCTCGTGATCAGGAGTTGGGAGG - Intronic
1072825918 10:98606121-98606143 TCTGATGAAATGGAGGTGAAGGG - Intronic
1073938084 10:108659003-108659025 TTGGATGAACAGGATGTGGATGG + Intergenic
1074222738 10:111454259-111454281 TGTGGGGAATAGGAGGAGGAGGG + Intergenic
1075316196 10:121455493-121455515 TCTGCTGATCTGGATGTGGATGG + Intergenic
1075361658 10:121841874-121841896 TCTGGGGAACAGGTGGTGTTTGG - Intronic
1075888589 10:125924724-125924746 ACTTGAGCACAGGAGGTGGAGGG + Intronic
1076062200 10:127421636-127421658 GGTGGTGACCAGGAGGTGGGTGG - Intronic
1078406132 11:11071428-11071450 TGGGGTGCACAGAAGGTGGATGG + Intergenic
1078886093 11:15501370-15501392 TCTTTGGAACAGGAGGTGGGAGG - Intergenic
1081682895 11:45021191-45021213 TCTGGAGAAGAGGAAGTGGAGGG + Intergenic
1083427716 11:62597297-62597319 TCTGGTGAGCAGAAGTTGGTGGG - Exonic
1083566733 11:63725123-63725145 TCTGGGGAAGGGGAGATGGAGGG - Intronic
1083909017 11:65694506-65694528 TCTGGTGAAGGGGAGCTGAAAGG + Intergenic
1085277048 11:75307019-75307041 TCTGATGGACAGGAGGTGCCTGG - Intronic
1085717613 11:78886903-78886925 GGTGGAGAAGAGGAGGTGGATGG - Intronic
1086496274 11:87407166-87407188 CCTGGAGAACTGGAGATGGATGG + Intergenic
1091460573 12:641317-641339 TCTGCAAAGCAGGAGGTGGAGGG - Intronic
1091574451 12:1720334-1720356 ACTGGTGGGCAGGGGGTGGAGGG + Intronic
1092956219 12:13552620-13552642 TCTGGTAAACAGCTGGTGGGAGG - Exonic
1093647928 12:21610239-21610261 TCTGAGGAAGAGGAGGTGCAGGG + Intergenic
1094173689 12:27521057-27521079 TCTGGTTAAAGGGAGGTAGAAGG + Intergenic
1094458931 12:30672155-30672177 TCTGGAGACCAGGAATTGGAAGG - Intronic
1094525226 12:31226886-31226908 TCTGGTGGGCAGGAGGTGACTGG + Intergenic
1095693463 12:45117432-45117454 ACTGGTGAACAGGTGGTGTTTGG - Intergenic
1097266925 12:57751481-57751503 TCCGGTGAGAAGGTGGTGGAGGG - Exonic
1097328101 12:58302116-58302138 TCTGGTGAAGGGAAGGTAGAAGG + Intergenic
1097346459 12:58498744-58498766 TCTCATGCACAGGAGGTTGAAGG + Intergenic
1098055788 12:66503738-66503760 TGTGGTGAACAGGAGGCTGCAGG + Intronic
1098213304 12:68188525-68188547 TGTGGTTAGCAGGAGGTTGAGGG + Intergenic
1101246141 12:102885784-102885806 GCTGGTGAACATCGGGTGGAGGG - Intronic
1101456811 12:104841131-104841153 TCTGGGGAAGTGGAAGTGGAGGG - Intronic
1101974449 12:109343793-109343815 TCTGGGAAACAGGAGTGGGATGG + Intergenic
1102446281 12:113005253-113005275 GATGGTGGACAGAAGGTGGAGGG + Intronic
1102641951 12:114374584-114374606 TCTGGTGAAGAGAAGGAGGCAGG + Intronic
1102665647 12:114570414-114570436 TCTGATGAATTGCAGGTGGATGG + Intergenic
1102838579 12:116092364-116092386 TCTGGGGAAAAAGAGGAGGATGG + Intronic
1103716196 12:122946819-122946841 TCTGGTGAACAGCAGCCTGATGG - Intronic
1104164444 12:126214449-126214471 TCTGATGAGGAGGAGGTGAAAGG - Intergenic
1104242340 12:127002137-127002159 TTTGGTGAACAGGTGGTGTTTGG - Intergenic
1104333996 12:127875596-127875618 TTTGGTGAACAGCAGGTTGCAGG - Intergenic
1106115014 13:26810263-26810285 TCTGGTGAAGGGGAGGTAAAAGG - Intergenic
1106158817 13:27182820-27182842 TCTGGGGACCTGGAGGAGGAAGG - Intergenic
1106486194 13:30174696-30174718 TCTGGTGAAGAGGAGGTAAAAGG + Intergenic
1106506647 13:30376335-30376357 TCTGGAGACAAGGATGTGGAGGG + Intergenic
1108090061 13:46840024-46840046 TCAGCTGGAAAGGAGGTGGAGGG + Intronic
1108176508 13:47798200-47798222 TCTGGTTAACTGGATGGGGAGGG + Intergenic
1108734566 13:53269177-53269199 TGTGGTGACAAGGAAGTGGAGGG + Intergenic
1110458981 13:75723142-75723164 TCTGGGGAACAGGTGGTGTTTGG - Intronic
1111287906 13:86119462-86119484 TCAGGCAAACAGGAGGTGCAGGG + Intergenic
1113244793 13:108383147-108383169 TGTGTAGAACAGGAGGTGGGGGG - Intergenic
1113416375 13:110131618-110131640 TCTGGCCAACAGGGGCTGGATGG - Intergenic
1113451367 13:110412417-110412439 GGTGGTGAACACGAGGTGGCAGG - Intronic
1113481652 13:110626064-110626086 TCGGGTGACCAAGAGGTGCAGGG + Intronic
1113986803 13:114324166-114324188 TCTGGTGTTCAGGAAGAGGAGGG - Exonic
1114050250 14:18915588-18915610 GCTGGTGAGAAGCAGGTGGAAGG - Intergenic
1114112308 14:19486344-19486366 GCTGGTGAGAAGCAGGTGGAAGG + Intergenic
1114379988 14:22192950-22192972 TGGGGTGAACTGGGGGTGGAGGG + Intergenic
1115499155 14:34034123-34034145 GCTGATGAACAGAAGGTGCAAGG + Intronic
1118230017 14:63939043-63939065 CCTGGTGAACTGGAGGTTGATGG + Intronic
1118599959 14:67465060-67465082 CCTGGTGCACAGCAGGTGAATGG + Intronic
1121343847 14:93120833-93120855 TCTGGGGATCAGGAGGAGGAAGG + Intergenic
1121527399 14:94628560-94628582 GCTAGTGACCAGCAGGTGGATGG - Intergenic
1122324038 14:100872039-100872061 TCCATGGAACAGGAGGTGGAAGG - Intergenic
1122439571 14:101720828-101720850 ACTTGAGACCAGGAGGTGGAGGG + Intergenic
1123438437 15:20272670-20272692 GCTGGGGGAGAGGAGGTGGAGGG - Intergenic
1124192043 15:27587927-27587949 TATGGTGAAAAGGAGTGGGAAGG + Intergenic
1124444677 15:29719871-29719893 TGTGGTGAGTAAGAGGTGGAAGG + Exonic
1124452384 15:29807485-29807507 TCAGGTAGACAGGAGGAGGAAGG + Intronic
1125144720 15:36453560-36453582 TCTGGTCAAGAGGAGATGGGTGG - Intergenic
1125349863 15:38755311-38755333 TCTGGTGAGGAGGAGGTAAAAGG + Intergenic
1125579784 15:40776884-40776906 TCTAGTGAACAGGGTGTGGGTGG + Intronic
1126145427 15:45469099-45469121 TCTGGTGAGGGGGAGGTGAAAGG - Intergenic
1126669446 15:51102866-51102888 ACTGGTGTACAGGAGGTAAAAGG - Intronic
1127676459 15:61243892-61243914 TCTGCTGACCAGAATGTGGAAGG - Intergenic
1128818375 15:70630418-70630440 ACTGGTGGACAGGCTGTGGAAGG + Intergenic
1129584563 15:76849409-76849431 GTTGATGAACAGGAGGTGGGCGG - Intronic
1129591699 15:76920816-76920838 TCTGGTTATCAGGAGGAGGTAGG - Intergenic
1129926508 15:79369126-79369148 TCTGGTGAAGAAGAGGTAAAAGG - Intronic
1129926633 15:79370065-79370087 TCTGGTGAAGAAGAGGTAAAAGG + Intronic
1130718025 15:86355736-86355758 ACTGGGGAACAGCAGGTGAAGGG + Intronic
1131706296 15:94999821-94999843 GGTGGTGAACAGGTGGTGGCAGG + Intergenic
1131754938 15:95549597-95549619 TCTGGATAAGAGGAAGTGGAAGG - Intergenic
1132977759 16:2719206-2719228 CCATGTGCACAGGAGGTGGAAGG - Intronic
1133289903 16:4713371-4713393 TTTGGAGAACAGGTGGTGGTTGG - Intronic
1133582933 16:7163990-7164012 TTTGGAGAACAGGAGGTGTTTGG + Intronic
1135076234 16:19396135-19396157 TCTGATGAACTGGGGGTGCAGGG + Intergenic
1137474734 16:48797956-48797978 TGTGGCCAAGAGGAGGTGGAAGG - Intergenic
1137474754 16:48798105-48798127 TGTGGCCAAGAGGAGGTGGAAGG - Intergenic
1139215887 16:65123555-65123577 GCTGGTGACCAGGAGCTGGAGGG - Intronic
1139900339 16:70323187-70323209 TCTTGAGCCCAGGAGGTGGAGGG - Intronic
1140364881 16:74373664-74373686 GGTGATGAGCAGGAGGTGGAGGG - Intergenic
1141075370 16:81001710-81001732 TCTGTTGAGTGGGAGGTGGATGG - Intronic
1141652140 16:85398368-85398390 CCTCCTGAGCAGGAGGTGGAGGG + Intergenic
1141824105 16:86467212-86467234 GCTGGTGAACAGCAGCTGGGCGG - Intergenic
1142271258 16:89090732-89090754 TCTGGTGAGCAGGAAGGGGAGGG - Intronic
1142666698 17:1467645-1467667 TTTGGGGGTCAGGAGGTGGATGG - Intronic
1142851767 17:2707879-2707901 TCTGGTGGAAGGGAGGGGGATGG + Intronic
1143824870 17:9597016-9597038 TCAGTTCAACAGGAGGAGGAGGG - Intronic
1143958218 17:10692094-10692116 TCAGGTGAAGAGGAAGAGGACGG + Intronic
1144120491 17:12147949-12147971 TTTGGGGAACAGGTGGTGGTTGG - Intergenic
1144955275 17:19015882-19015904 TCTGGAGAACAGGTGGTGTTTGG + Intronic
1145863609 17:28226840-28226862 GCAGATGAGCAGGAGGTGGAAGG - Intergenic
1146284331 17:31564395-31564417 GCTGTAGAACAGGAGGTGGCTGG + Intergenic
1147263964 17:39224282-39224304 TCTGGAGAACAGGAGCAGGATGG + Intronic
1148508826 17:48150625-48150647 TCTGCAGACAAGGAGGTGGATGG + Intronic
1148911155 17:50943832-50943854 ACTCGGGAACAGTAGGTGGAAGG + Intergenic
1149637285 17:58181038-58181060 TCCGGTGAACAGGAGGGAAAAGG - Intergenic
1150760861 17:67959678-67959700 TGTGTTGCACAGCAGGTGGAGGG - Exonic
1151326065 17:73380430-73380452 TCTGGTGCACGGGAGGACGACGG + Intronic
1151388555 17:73770456-73770478 ACTGGTGACAAGGAGGGGGAAGG + Intergenic
1151447623 17:74177486-74177508 TCTGGTGCACAGCAGGTGTTGGG - Intergenic
1151579787 17:74971580-74971602 CCTGGAGAGCAGGAGGTGGGGGG + Intronic
1152120036 17:78412937-78412959 TCTGGGGAAGAGGGGGTGGGAGG + Intronic
1152305491 17:79518071-79518093 CCTGGGGAAAAGGAGGAGGAGGG - Intergenic
1152316714 17:79585209-79585231 TCTGGGGAACAGGTGGTGTTTGG - Intergenic
1154059516 18:11046651-11046673 TCAGGAGAACAAGAGATGGAGGG - Intronic
1154106344 18:11527048-11527070 TCTTGAGGACAGGAGTTGGAGGG + Intergenic
1155137515 18:23010702-23010724 GCTGGAGAACAAGAGGTGAATGG + Intronic
1157915276 18:51658139-51658161 TCTGGTGAAGGTGAGGTGAAAGG + Intergenic
1159857789 18:73609941-73609963 TTTGGTGAACAGGTGGTGTTAGG - Intergenic
1160833028 19:1112170-1112192 TCTGGTGAGCAGGTGGGGGTGGG - Exonic
1161393051 19:4031330-4031352 TCTGCAGAGCAGGACGTGGAGGG + Intronic
1162265138 19:9566875-9566897 TCTGGTGAACATTTGGTGGCAGG + Exonic
1162723573 19:12676491-12676513 TGTGGTGAACAGATGGTGGCAGG - Intronic
1163176296 19:15566195-15566217 TGTGGTGCACAGGAGGTGGGTGG - Intergenic
1165034409 19:33022570-33022592 GCTGGGGGAGAGGAGGTGGAGGG - Intronic
1166211076 19:41306811-41306833 TAGGAAGAACAGGAGGTGGAAGG - Exonic
1166345194 19:42161398-42161420 TCTTGTACACAGGAGGTAGAAGG - Intronic
1167015552 19:46838710-46838732 CCTGGTGAAGAGGAGGCTGAAGG - Intronic
1167040781 19:47021394-47021416 TCTGGTGGGAAGGAGGAGGAAGG - Intronic
1167311531 19:48740254-48740276 TCTGGTGAACGGAAGGAGGGCGG - Exonic
1167343990 19:48933831-48933853 TCTGGGGAAGAGGAGGCGGGGGG + Intronic
1168198664 19:54796686-54796708 TCTGGAGAACAGGGGCTGGAGGG - Intronic
1168377460 19:55892502-55892524 GCTGGGGCCCAGGAGGTGGAGGG - Intronic
925972771 2:9118652-9118674 TCTGGTGAATAGAATGTAGATGG - Intergenic
926844728 2:17123679-17123701 TCTGGTGAAGGGGAGGTGGAAGG + Intergenic
928857833 2:35821669-35821691 TCTGGTGAAGGGGAGGTAAAAGG - Intergenic
929781695 2:44961341-44961363 TCCTGTGAGCAGGAGGTAGATGG - Intergenic
930825480 2:55693169-55693191 CCTGGTGAAGAGGAGGCTGAAGG + Intronic
931086584 2:58838070-58838092 TCTGGTGACAAGGAGATGGCAGG + Intergenic
931753785 2:65353820-65353842 TCTAGTGACCTGGAGGTGTAAGG - Intronic
931806619 2:65813482-65813504 TATGCTGGCCAGGAGGTGGATGG + Intergenic
932016397 2:68032199-68032221 AGCGGTGAACAGGAGTTGGAGGG + Intergenic
932654277 2:73595142-73595164 GCTGGGGAACAGGAGTAGGAAGG - Intronic
932838475 2:75059728-75059750 TCTGGGGAACAGCAGGTTCATGG - Intronic
933737334 2:85505681-85505703 GCTGGAGAGCAGGAGGTGGAAGG - Intergenic
934538469 2:95156266-95156288 TCTAGTGAGCTGGATGTGGAGGG - Intronic
934860047 2:97757202-97757224 TCAGCTGGACTGGAGGTGGAGGG + Exonic
935422584 2:102885445-102885467 TCTGGGGAGCAGGAGGCTGAAGG - Intergenic
935701488 2:105815983-105816005 CCCGGTGAACAGCAGGTGGAAGG - Intronic
939007769 2:136809187-136809209 TCTGGAGAACACGAGTTGGCAGG + Intronic
939971343 2:148664637-148664659 CCTGAAGACCAGGAGGTGGAGGG - Intronic
940964291 2:159820647-159820669 TTTGGGGAACAGGTGGTGGTTGG - Intronic
941659554 2:168181831-168181853 TCTGGGGAGCAGGAAGTGGTAGG + Intronic
942760863 2:179395649-179395671 TCTGGGGAACAGGATGTTGAAGG + Intergenic
943718320 2:191176692-191176714 TCAGTTCAACAGGAGGTGGGAGG + Intergenic
944516291 2:200514908-200514930 TCTGGTGCACAGAAGGTTGAAGG + Intronic
946017672 2:216617041-216617063 TCAGGGGATCAGGAGGTGGTGGG + Intergenic
946157679 2:217817902-217817924 TCTGGTGACGGGGAGGTGGCAGG + Exonic
947160310 2:227207866-227207888 TCTGGTGAAGGGGAGGTAAAAGG + Intronic
947825803 2:233105361-233105383 TCAGGTGAATAGGAGGTGGTGGG - Intronic
948252936 2:236544984-236545006 TCTGGTCCACAGGTGGTGGCTGG + Intergenic
948332871 2:237183949-237183971 TTTGGGGGAAAGGAGGTGGAAGG - Intergenic
948485739 2:238279702-238279724 ACTGGTGGGAAGGAGGTGGAAGG - Intronic
948764394 2:240212093-240212115 TCTGGAAAACAAGAGGTGGCTGG + Intergenic
948948668 2:241235102-241235124 CCGGGTGAGCAGGAGGTGGCCGG - Exonic
1168928151 20:1599554-1599576 TCTGGTGAGGGGGAGGTGAAAGG - Intronic
1169053247 20:2598161-2598183 TCTGGGGAACAGGTGGTGTTTGG - Intronic
1169280954 20:4266550-4266572 CCTGGTGAACTGGATGTGGAGGG + Intergenic
1169779875 20:9297484-9297506 TCTGGAGAACAGGTGGTGTTTGG - Intronic
1171262191 20:23744168-23744190 TCAGGATAACAGGAGGTTGAAGG - Intergenic
1171271300 20:23819894-23819916 TCAGGATAACAGGAGGTTGAAGG - Intergenic
1171959306 20:31482502-31482524 CCAGGTGAAGAGGAGGTGGTGGG - Intronic
1172906836 20:38376811-38376833 CCTGGTGAAGAGGAGGAGGGTGG - Exonic
1174107340 20:48172030-48172052 TCTGGGCAGCAGGAGGTAGAGGG - Intergenic
1174313361 20:49677138-49677160 TCTGGTGAGCATGGGCTGGAAGG + Intronic
1174511975 20:51060235-51060257 CCTGGTGAACAGGATCTGGATGG + Intergenic
1174671976 20:52316814-52316836 TCTGCTGGACAGGAGCTGTAAGG + Intergenic
1175010136 20:55726482-55726504 TCTGGAAACCAGGAGGTTGAGGG + Intergenic
1175301106 20:57943374-57943396 GCTGGTGAACAGGAAGAGGAAGG - Intergenic
1176804302 21:13464642-13464664 TCTGGTGAAGAGCAGGTTGCCGG - Intergenic
1177210973 21:18070194-18070216 TCTGGGGAACAGGTGGTGTTTGG - Intronic
1177661652 21:24091579-24091601 TCTGGGGAACAGGTGGTGTTTGG - Intergenic
1177710230 21:24764284-24764306 TCTGGTCAACAGGTGGTAGTTGG + Intergenic
1178000507 21:28157641-28157663 TCTGGCCAATAGGAGGTGGAGGG - Intergenic
1178803240 21:35816654-35816676 TCAGTTAAACAGAAGGTGGAAGG + Intronic
1179548979 21:42131354-42131376 GCTGGGGAACAGGAGGAGGGAGG + Intronic
1179548989 21:42131390-42131412 GCTGGGGAACAGGAGGAGGGAGG + Intronic
1179548999 21:42131426-42131448 GCTGGGGAACAGGAGGAGGGAGG + Intronic
1179549008 21:42131462-42131484 GCTGGGGAACAGGAGGAGGGAGG + Intronic
1179549017 21:42131498-42131520 GCTGGGGAACAGGAGGAGGGAGG + Intronic
1179549027 21:42131534-42131556 GCTGGGGAACAGGAGGAGGGAGG + Intronic
1179549047 21:42131606-42131628 GCTGGGGAACAGGAGGAGGGAGG + Intronic
1179583245 21:42358353-42358375 GCTGGGGACCAGGAGGTGGAGGG + Intergenic
1180468729 22:15637962-15637984 GCTGGTGAGAAGCAGGTGGAAGG - Intergenic
1180974716 22:19842024-19842046 CCTGATGAGCAGGAGGTGGGAGG - Intronic
1181107515 22:20583825-20583847 GCTGGTGAGAAGCAGGTGGAAGG + Intronic
1181173890 22:21025393-21025415 TCAGGGGAACAGGATGTGGGTGG - Intronic
1181324221 22:22032482-22032504 TCTTGTGAGCAGGGGGTAGAGGG - Intergenic
1182078749 22:27513927-27513949 TCGGCTGAAGAAGAGGTGGATGG - Intergenic
1182097072 22:27633212-27633234 TCTGGTGCGGAGCAGGTGGAGGG - Intergenic
1182511461 22:30823034-30823056 TCTGGGGAAGAAGAGGTAGATGG - Intronic
1182754047 22:32664476-32664498 TTTGGGGAACAGGAGGTGTCTGG + Intronic
1183206991 22:36426453-36426475 CCTGGTGGACAGGAGTGGGAGGG - Intergenic
1184066403 22:42124167-42124189 CCTGCTGAGCAGGAGGTGGCAGG + Intergenic
1184068871 22:42136319-42136341 CCTGCTGAGCAGGAGGTGGCAGG + Intergenic
1184892984 22:47390741-47390763 CCTGCTGAGCAGCAGGTGGAGGG - Intergenic
949336355 3:2979292-2979314 TCTGGTGAAGGGGAGGTAAAAGG + Intronic
950672058 3:14533089-14533111 TGATGTGAACTGGAGGTGGAAGG - Intronic
950820862 3:15757023-15757045 TAAGGTGAAGAGGAAGTGGAGGG - Intronic
951601434 3:24380474-24380496 TCTGGTGGAGAGGAGGGGGAAGG - Intronic
952107310 3:30085235-30085257 CCTGGTGAAGGGGAGGTGAAAGG + Intergenic
953075841 3:39569648-39569670 TCAGGTCAACAGGAAGGGGAAGG + Intergenic
953228368 3:41041877-41041899 TCTGTTGGAAAGGAGGAGGAAGG + Intergenic
953532333 3:43749828-43749850 TCTTGAGCCCAGGAGGTGGAAGG - Intergenic
954296453 3:49677021-49677043 CCTGGTGAGCTGGAGGTGGCAGG + Exonic
954315615 3:49799745-49799767 TCTGGTGAGGAGGTGGTGGGTGG - Exonic
954511843 3:51132275-51132297 TCTGGAGAACAGGATGGGAATGG - Intronic
954767642 3:52934376-52934398 ACTGCTGAAAAGCAGGTGGAAGG + Intronic
955613894 3:60785051-60785073 TCTGGTGGACAGGGGCTGGTAGG - Intronic
955695316 3:61629947-61629969 TTTGTTCAACAGAAGGTGGATGG + Intronic
955879790 3:63531094-63531116 TGTGGTGAAGAGGAGGAGGCAGG + Intronic
958151119 3:89696277-89696299 TCTGGTGAAAAGGAAGTAGAAGG - Intergenic
959671255 3:108980199-108980221 TCTGGTGAAGGGGAGGTAAAAGG - Intronic
959702827 3:109314639-109314661 TCTGGGTAACAGGAAGTAGAAGG - Intronic
960189792 3:114689439-114689461 ACTGGGGGAAAGGAGGTGGAAGG + Intronic
961776845 3:129293342-129293364 TCTGGGGAACAGGTGGTGTCTGG - Intronic
961841368 3:129716000-129716022 TCTGGTGAAGGGGAGGTAGCAGG - Intronic
961931259 3:130535762-130535784 TCTGGTGAAGAGTAGATAGAGGG - Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
963212290 3:142706609-142706631 TGTAGTGAACAGGATGGGGAGGG + Intronic
964078426 3:152721170-152721192 TCTGGTGAAGGGGAGGTGAAAGG + Intergenic
964211727 3:154235811-154235833 TCTGGAGAAGAGGAGGAAGAAGG - Intronic
964474395 3:157085535-157085557 TCTTGTGAAGAAGAGGTGGCTGG + Intergenic
965470614 3:169085734-169085756 TCTGCTGAGCAGAAGGTGCATGG + Intronic
965979306 3:174667747-174667769 TCTGGTGAAGGGGAGGTTAAAGG + Intronic
967042041 3:185702781-185702803 ACTTGTGAACTGCAGGTGGAGGG - Intronic
967400314 3:189053537-189053559 GTTGGTCAACAGGAAGTGGAAGG - Intronic
967470185 3:189851923-189851945 TCTGGTGAGGAGGACGTGAAGGG + Intronic
968079445 3:195836019-195836041 TGTAGGGAACAGGAGGTGGGAGG - Intergenic
968335835 3:197912879-197912901 GTTGGTGAACAGGAGTTGCAGGG - Intronic
969506149 4:7589070-7589092 CCTGGTGCACAGGAGGTGTGGGG + Intronic
969547814 4:7843290-7843312 TATGATGAAGAGGAGGAGGATGG - Exonic
969676251 4:8616017-8616039 TCTGATGAACATGAGGTTGAAGG + Intronic
970319103 4:14858023-14858045 TCTGGGGATCAGGAGGTGTTTGG - Intergenic
971213919 4:24646138-24646160 TCTGGGGACCAGGAGGTGTATGG + Intergenic
972246050 4:37245739-37245761 TTTTGTGAACCGGAGGTCGAGGG + Intronic
972665923 4:41165551-41165573 TCTGGTGAAGATGAGGTAAAAGG - Intronic
972667944 4:41184912-41184934 TCCTGTGAACAGGAGGTGGAAGG - Intronic
974415317 4:61599413-61599435 TCTTGTAACCAGGAGGTGGAGGG - Intronic
975471746 4:74777272-74777294 TGTGCTGAAAAGAAGGTGGAGGG + Intronic
978175160 4:105721213-105721235 TCTGGAAAACATGAGGTGGGCGG - Intronic
978273864 4:106925123-106925145 TCTCTTGCACAGGAGGTGAAGGG - Intronic
980277800 4:130677809-130677831 CCTGGTGAAGAGGAGGTAAAAGG - Intergenic
980857787 4:138460855-138460877 TCAGGTGAACAGCAGGTCGGTGG + Intergenic
981337305 4:143581713-143581735 TCTGGTGAAGAGCAGGGGGTTGG - Intronic
981716152 4:147754349-147754371 TTTGATGCACAGGAGGTGAAAGG + Intronic
982199507 4:152946631-152946653 TCTGCTGAACAGGCTGTGGAGGG - Intronic
982472905 4:155815645-155815667 TCTGAACAACAGGATGTGGAAGG + Intergenic
984617937 4:181919633-181919655 TCTGATGAACAGGACTAGGAAGG - Intergenic
985867704 5:2528198-2528220 TCTGTTGCACAGGAGGTGACTGG + Intergenic
987230825 5:15892013-15892035 GCTGGTGAGCAGGAGGAGGCAGG - Intronic
988724375 5:33911388-33911410 TGTGGAAAACAGGAGTTGGAGGG - Intergenic
989735371 5:44697069-44697091 TCTGGTGAAGAGGACGTAAAAGG - Intergenic
990301997 5:54458613-54458635 TCTGTTCAAAAGGAGGAGGAGGG + Intergenic
991214322 5:64144759-64144781 GCTGGTGATCAGAGGGTGGAAGG - Intergenic
992580293 5:78167982-78168004 TTTGGTGAACAGGTGGTGTTTGG - Intronic
993289919 5:86053874-86053896 ACTGGAGAACAATAGGTGGAAGG - Intergenic
994357482 5:98810293-98810315 TATGGAGAACAGGAGGTACAGGG - Intergenic
994692408 5:103034799-103034821 TTGGGTGAACAGCAGGTTGATGG - Intergenic
995260176 5:110094713-110094735 TCTGGAGAACAGGAAGTGGTTGG - Intergenic
995260346 5:110096674-110096696 TCTGGAGAACAGGAAGTGGTTGG + Intergenic
995883443 5:116867613-116867635 TCTGGTGGGCAGGAGTTGGGGGG + Intergenic
996022783 5:118610191-118610213 TCTGATGCACAGAAGCTGGATGG + Intergenic
996710886 5:126542554-126542576 ACTGGGGAGCATGAGGTGGAAGG + Exonic
997206505 5:132053478-132053500 TCAGGTGTAGAGAAGGTGGAAGG + Intergenic
998960786 5:147484242-147484264 TTTGGTGAAGGGGAGGAGGATGG - Intronic
1002019355 5:176352738-176352760 TCTCTTGAACAGGTGGAGGAAGG - Exonic
1002098523 5:176845995-176846017 ACAGGAGAAAAGGAGGTGGAAGG + Intronic
1002286982 5:178170071-178170093 ACTGGTGAAAGGGAGGTAGAAGG + Intergenic
1002288054 5:178178469-178178491 TCTGGTGACGGGGAGGTAGAAGG + Intergenic
1002958594 6:1893075-1893097 TCAGGTGGGAAGGAGGTGGATGG - Intronic
1003412622 6:5878926-5878948 CTTGGTGAACAGGAAGTGGCCGG - Intergenic
1003688512 6:8328210-8328232 TCTGGTGAGCATGAGGTGTCAGG - Intergenic
1003756778 6:9130217-9130239 TATGCTGAACAGGAGGTTCAAGG - Intergenic
1005276772 6:24227812-24227834 TCTGGTAAACAGAAGGGGGCAGG + Intronic
1005657525 6:27956744-27956766 TTTGGGGAACAGGAGGTGTTTGG - Intergenic
1006313958 6:33279517-33279539 CCTGGTGAAGAGGAAGAGGAAGG - Exonic
1007224852 6:40305977-40305999 GCTGGGGGACAGGAGGTTGAAGG - Intergenic
1008222963 6:48876796-48876818 TCTGATGAACTGGGGGTGCAGGG - Intergenic
1008618919 6:53252867-53252889 TTTGGGGAACAGGTGGTGGTTGG + Intergenic
1008834042 6:55804634-55804656 TCTGGTAAAGAGGAGGCTGATGG + Intronic
1009946473 6:70347156-70347178 CTTGGTGAAGAGGGGGTGGAAGG + Intergenic
1010585819 6:77657885-77657907 TAGTGTGAACAGGAGGAGGAGGG - Intergenic
1011095385 6:83656174-83656196 TCTGGAGAAAAGGTGATGGATGG + Intronic
1011372968 6:86659629-86659651 TTTGGGGAACAGGTGGTGGTTGG + Intergenic
1013222527 6:108091581-108091603 ACTGGGGAAAAGGAGGTAGATGG + Intronic
1017723048 6:157257853-157257875 GCGGGTGATCAGGAGTTGGAAGG + Intergenic
1017944375 6:159081760-159081782 TTTGGGGAACAGGAGGTGTTGGG + Intergenic
1018446826 6:163866096-163866118 TCTGGTGCACCGGAGATGGTTGG + Intergenic
1018612664 6:165660792-165660814 TCGGGTGCACACGCGGTGGACGG + Intronic
1018713177 6:166512296-166512318 CGTGGTGAACAGGAGCTGGAAGG + Intronic
1018934764 6:168266460-168266482 TCTGGTGAGGAGGAGGTGAAAGG - Intergenic
1018996612 6:168715073-168715095 GATGGTGAAGAGGAGGGGGATGG + Intergenic
1019180590 6:170185327-170185349 TGTGGAGCACAGGAGGAGGATGG - Intergenic
1019848501 7:3529772-3529794 GCTGGTGACCAGGTGGTCGAGGG + Intronic
1020055061 7:5112019-5112041 TTTGGGGAACAGGGGGTGGTTGG + Intergenic
1020433990 7:8142564-8142586 TATGGTGAAAAGAAGGTGCAGGG + Intronic
1021311963 7:19107424-19107446 TCTGGGGCTTAGGAGGTGGAAGG + Intronic
1021460334 7:20879778-20879800 TCTCATGAACTGGAGGTGGCAGG - Intergenic
1022687845 7:32613235-32613257 GCTGGTTACCAGGAGGTAGAGGG + Intergenic
1023277978 7:38541117-38541139 TCTTCTGAACAGGACATGGAGGG + Intronic
1023768850 7:43536542-43536564 TCTTGTGAAGAGGAGTTGAAGGG + Intronic
1024430666 7:49284673-49284695 TCTGCTGAAGGGGAGGTGAAAGG + Intergenic
1024494588 7:50030214-50030236 TCTGGTGAAGAGGAGAGAGAGGG + Intronic
1025927450 7:65971139-65971161 TCTTGAACACAGGAGGTGGATGG + Intronic
1026451954 7:70537172-70537194 ACTGGTGGGAAGGAGGTGGAGGG - Intronic
1027487313 7:78778287-78778309 TGTGGAGAAAAGAAGGTGGAAGG - Intronic
1028465817 7:91150169-91150191 TCTGGTCAGGAGGAAGTGGAAGG + Intronic
1029095768 7:98084100-98084122 TCTGGTGAAGGGGAGGTAAAAGG + Intergenic
1029141934 7:98417501-98417523 CCTGGTCAATAGGAGTTGGAGGG + Intergenic
1029440048 7:100582459-100582481 TCTGGGGAAAAGGAGGTGTCGGG + Exonic
1031006281 7:116476099-116476121 TCTGGGGAACAGGTGGTGTTTGG - Intronic
1031153516 7:118082515-118082537 TCTGCAGAAAAGGAGGAGGATGG + Intergenic
1032936221 7:136734745-136734767 TCTGGGGAACAGGTGGTGTTTGG - Intergenic
1033052077 7:138014753-138014775 TCTGGTGAAGGGGAGGTAAAAGG - Intronic
1033053347 7:138027209-138027231 TCTGGTGAAGGGGAGGTAAAAGG - Intronic
1033234159 7:139624986-139625008 TCTGTTGAGAACGAGGTGGAGGG - Intronic
1033382761 7:140839771-140839793 TCTGGTGAAAAGGAGATAAAAGG - Intronic
1033657730 7:143384348-143384370 TTTGGAGAACAGAAAGTGGAAGG + Intronic
1033691026 7:143737242-143737264 ACTGGTGATCAGGAGCTGAAAGG - Intergenic
1034476725 7:151288930-151288952 TATTGTGAAGAGGAGTTGGAGGG + Intergenic
1034950174 7:155291540-155291562 TCAGGTGAAATGGAGGTGAAAGG - Intergenic
1035527405 8:324616-324638 GTGGGTGAACAGGGGGTGGAGGG + Intergenic
1036049293 8:5178235-5178257 TTTGGAGAACAGGAAGTCGATGG - Intergenic
1037453606 8:19041240-19041262 TCTGGTTTACAGGAGGTAGTGGG - Intronic
1037600727 8:20391651-20391673 TCTGGGGCCCAGGAGTTGGAGGG - Intergenic
1037607391 8:20449166-20449188 AATGGTCAACAGCAGGTGGAAGG - Intergenic
1038018884 8:23536529-23536551 GCTGGGGAAAATGAGGTGGAAGG - Intronic
1039176903 8:34818620-34818642 TCAGCTGAAGAGGAGGAGGAAGG - Intergenic
1039546236 8:38413435-38413457 GCAGGTGGAGAGGAGGTGGAGGG + Exonic
1039743861 8:40406189-40406211 TCTGGTGAAACAGAGGTGTAAGG + Intergenic
1039777793 8:40753793-40753815 TCTGGTGAAAAACATGTGGAAGG - Intronic
1040903125 8:52437993-52438015 TCTGAGGAACAGTGGGTGGAGGG - Intronic
1041248804 8:55914668-55914690 GCTGATGAAAAGGAGGTAGAAGG - Intronic
1041377396 8:57217619-57217641 TCAGGTGACCAGGAGGTGATGGG - Intergenic
1042076378 8:64999743-64999765 TCTGGAGAAAAAGATGTGGAGGG - Intergenic
1043423951 8:80130146-80130168 TGAGATGAAGAGGAGGTGGAGGG + Intronic
1044336356 8:90988346-90988368 TCTGTTGAACGGTAGGAGGATGG + Intergenic
1044603881 8:94032447-94032469 TCTGGTGACCCTGAGGTGGGAGG - Intergenic
1045063344 8:98426567-98426589 GTTGGGGAACAGGAGCTGGAGGG - Intronic
1045747622 8:105441780-105441802 CCTGGTGAGCAGGAGGTTTATGG - Intronic
1046776783 8:118172910-118172932 TCTGGTTACCAGGGGCTGGAAGG - Intergenic
1047596191 8:126380043-126380065 CCTGGAGAACAGAAGTTGGATGG + Intergenic
1047823147 8:128543538-128543560 TTTGGTGACCAGGGGGTGGGAGG - Intergenic
1049063848 8:140297200-140297222 TCTGGAGAACATGAGGTGACAGG - Intronic
1049308091 8:141918154-141918176 TCTGGGAAAGAGGAGGGGGATGG + Intergenic
1049876945 8:145030157-145030179 TCTGATGAACTGGGGGTGAAGGG - Intergenic
1050354426 9:4769552-4769574 TCTGTCGAACAGGAAGTGGTAGG - Intergenic
1054766423 9:69046133-69046155 TATGGTGAAGGGGAGGTGAAAGG + Intronic
1055132739 9:72794081-72794103 TCTGGTGACAAGGAGGGGGGTGG - Intronic
1056100554 9:83296831-83296853 TCTTGGTAACAGGTGGTGGAAGG - Intronic
1056719751 9:89061494-89061516 TCTGGAGAACAGGAGGTCTTAGG - Intronic
1057444211 9:95102746-95102768 AGTGGTGGTCAGGAGGTGGAAGG - Intronic
1058157376 9:101530596-101530618 GATGGTGAACAGAAGGTGGCTGG + Intronic
1059351671 9:113669800-113669822 TCTGGTCAATAGAATGTGGATGG + Intergenic
1059388002 9:113980130-113980152 TCTGGGCAGCAGGAGCTGGAAGG + Intronic
1059779103 9:117507965-117507987 CCTGGTGAAGAGTAGGTGGTGGG + Intergenic
1060389422 9:123266924-123266946 TCTGGAGTACAGTAGGTGGAGGG - Intronic
1060434874 9:123584767-123584789 TCTGACGATGAGGAGGTGGATGG - Intronic
1060556790 9:124512160-124512182 CCTGGAGAGCTGGAGGTGGAGGG + Intergenic
1061850184 9:133410386-133410408 TCGGGTGACCAGGAGATGGCAGG + Intronic
1062027637 9:134347802-134347824 TCTGGTGGCCAGGAGGGGGCTGG + Intronic
1062066658 9:134531584-134531606 CCTGGTCAAGAGTAGGTGGAGGG + Intergenic
1062611451 9:137376384-137376406 TCTGGTGAACAGGAGGTGGAAGG - Intronic
1062671309 9:137711568-137711590 AGTGGTTACCAGGAGGTGGAGGG + Intronic
1186822738 X:13307641-13307663 TTTGGGGAACAGGTGGTGGTTGG + Intergenic
1186941608 X:14514364-14514386 TTTGGGGAACAGGAGGTGTTTGG - Intergenic
1187230773 X:17420598-17420620 TCTGGTGAACGACAGATGGATGG - Intronic
1187589339 X:20699323-20699345 TTTGGGGAACAGGAGGTGTTTGG - Intergenic
1188163627 X:26833780-26833802 TCTTGTGAACAGCATGTGGTTGG + Intergenic
1188909770 X:35832381-35832403 TCTGGTGAAGGGAAGGTGTAAGG + Intergenic
1190213679 X:48466812-48466834 ACAGGTCAGCAGGAGGTGGATGG + Exonic
1190413053 X:50156120-50156142 GCAGATGAGCAGGAGGTGGAAGG - Intergenic
1190716866 X:53111997-53112019 TTTGGGGAACAGGTGGTGGTTGG + Intergenic
1192047558 X:67692169-67692191 CCTGCTGAACAGGAAGTAGAGGG - Intronic
1192756289 X:74049703-74049725 CCTGGTGAAAAGTAGGTGGTGGG - Intergenic
1193399055 X:81020824-81020846 CCTGGTGAAGAGGAGGTGGTTGG + Intergenic
1193499941 X:82263088-82263110 TCTTGTTCACAGGAGGTGGTGGG + Intergenic
1194125423 X:90010648-90010670 ACTGGGGAAGAGGGGGTGGAAGG - Intergenic
1194602181 X:95935686-95935708 TTTGGGGAACAGGTGGTGGTTGG + Intergenic
1195014082 X:100761392-100761414 TTTGGTGAACAGGTGGTGTTTGG - Intergenic
1196090247 X:111733160-111733182 TTTGGAGAACAGGTGGTGGTTGG + Intronic
1196477223 X:116102153-116102175 TTTGGGGAACAGGAGGTGTTTGG + Intergenic
1196941967 X:120785883-120785905 ACTGAAGAACAGGAGCTGGAAGG - Intergenic
1197310087 X:124894086-124894108 GGTGGTGAAGAGGAGGTGAAGGG - Intronic
1197402282 X:126006543-126006565 TGTAGTGAACAGGTGGTGGCAGG - Intergenic
1198984023 X:142428730-142428752 TCTGGCGGGCAGGAGGTGGGGGG + Intergenic
1199807616 X:151316078-151316100 AATGGTGAACAGGAGGTAGGAGG - Intergenic
1200904266 Y:8465283-8465305 TTTGGTGAGCAGGATGTGGCAGG - Intergenic
1200961263 Y:8998199-8998221 TCTGATGAACTGGGGGTGCAGGG - Intergenic
1200982625 Y:9276253-9276275 TCTGATGAACTGGGGGTGTAGGG + Intergenic
1202127770 Y:21583448-21583470 TCTGATGAACTGGGGGTGTAGGG - Intergenic
1202151510 Y:21848032-21848054 TCTGATGAACTGGTGGTGCAAGG + Intergenic