ID: 1062612728

View in Genome Browser
Species Human (GRCh38)
Location 9:137382284-137382306
Sequence GCGCTTGTTTATACACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062612728_1062612730 -3 Left 1062612728 9:137382284-137382306 CCTGTCTGTGTATAAACAAGCGC No data
Right 1062612730 9:137382304-137382326 CGCTGCTCCAAGGAGACGCCAGG No data
1062612728_1062612732 9 Left 1062612728 9:137382284-137382306 CCTGTCTGTGTATAAACAAGCGC No data
Right 1062612732 9:137382316-137382338 GAGACGCCAGGACGAATGTCAGG No data
1062612728_1062612736 20 Left 1062612728 9:137382284-137382306 CCTGTCTGTGTATAAACAAGCGC No data
Right 1062612736 9:137382327-137382349 ACGAATGTCAGGACATAGGGAGG No data
1062612728_1062612737 25 Left 1062612728 9:137382284-137382306 CCTGTCTGTGTATAAACAAGCGC No data
Right 1062612737 9:137382332-137382354 TGTCAGGACATAGGGAGGAAAGG No data
1062612728_1062612734 16 Left 1062612728 9:137382284-137382306 CCTGTCTGTGTATAAACAAGCGC No data
Right 1062612734 9:137382323-137382345 CAGGACGAATGTCAGGACATAGG No data
1062612728_1062612735 17 Left 1062612728 9:137382284-137382306 CCTGTCTGTGTATAAACAAGCGC No data
Right 1062612735 9:137382324-137382346 AGGACGAATGTCAGGACATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062612728 Original CRISPR GCGCTTGTTTATACACAGAC AGG (reversed) Intronic