ID: 1062612728

View in Genome Browser
Species Human (GRCh38)
Location 9:137382284-137382306
Sequence GCGCTTGTTTATACACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 49}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062612728_1062612734 16 Left 1062612728 9:137382284-137382306 CCTGTCTGTGTATAAACAAGCGC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1062612734 9:137382323-137382345 CAGGACGAATGTCAGGACATAGG No data
1062612728_1062612735 17 Left 1062612728 9:137382284-137382306 CCTGTCTGTGTATAAACAAGCGC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1062612735 9:137382324-137382346 AGGACGAATGTCAGGACATAGGG No data
1062612728_1062612732 9 Left 1062612728 9:137382284-137382306 CCTGTCTGTGTATAAACAAGCGC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1062612732 9:137382316-137382338 GAGACGCCAGGACGAATGTCAGG No data
1062612728_1062612730 -3 Left 1062612728 9:137382284-137382306 CCTGTCTGTGTATAAACAAGCGC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1062612730 9:137382304-137382326 CGCTGCTCCAAGGAGACGCCAGG No data
1062612728_1062612736 20 Left 1062612728 9:137382284-137382306 CCTGTCTGTGTATAAACAAGCGC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1062612736 9:137382327-137382349 ACGAATGTCAGGACATAGGGAGG No data
1062612728_1062612737 25 Left 1062612728 9:137382284-137382306 CCTGTCTGTGTATAAACAAGCGC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1062612737 9:137382332-137382354 TGTCAGGACATAGGGAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062612728 Original CRISPR GCGCTTGTTTATACACAGAC AGG (reversed) Intronic
900303025 1:1987303-1987325 GCGCTTGTTTATGCAGACCCAGG - Intronic
902216130 1:14935558-14935580 GGGCTTGTTAACACCCAGACTGG - Intronic
907264438 1:53248489-53248511 GCTTTTGTGTATATACAGACTGG + Intronic
908480156 1:64531762-64531784 GTGTGTGTTTATACACTGACGGG + Intronic
910622058 1:89266533-89266555 GAACTTCTGTATACACAGACGGG + Exonic
917965015 1:180173031-180173053 GCTCTTGTTTATTTACAGACAGG - Intronic
919214889 1:194540337-194540359 ACGCTTGTTTCTACACACAAAGG - Intergenic
919768244 1:201140972-201140994 GAGCTTGTCTTTACAGAGACTGG - Intronic
924177125 1:241402613-241402635 GAGCATGTTTGTATACAGACAGG - Intergenic
1062771267 10:103598-103620 GCGCTTTTTTATTGACAAACAGG - Intergenic
1071165904 10:82806108-82806130 GCATTTGTTTATAGAGAGACTGG + Intronic
1071757279 10:88557476-88557498 AGACTTGTTTATACACTGACTGG - Intronic
1089767865 11:120781651-120781673 GGGCTTGTGAAGACACAGACAGG - Intronic
1090778022 11:129982290-129982312 GTGTGTGTGTATACACAGACTGG + Intronic
1092468070 12:8752538-8752560 GCCCTTTTTTAGACACAGTCTGG - Intronic
1109873984 13:68373937-68373959 GCCTCTGTTTATACACAGATAGG - Intergenic
1110499806 13:76213829-76213851 GGGTTTGTTAGTACACAGACAGG + Intergenic
1110545889 13:76755017-76755039 GAGCTTATTTATAGACTGACAGG + Intergenic
1113007428 13:105722862-105722884 GAGCGTGTTTATACACTGAAGGG - Intergenic
1117101916 14:52357666-52357688 GTGCTTGTTTCTCCACAGCCTGG - Intergenic
1121097948 14:91230878-91230900 GTGTTTGTTTGTAGACAGACTGG + Intergenic
1121432463 14:93897792-93897814 ACACTTGTTTGTACACAAACGGG - Intergenic
1130896001 15:88170963-88170985 GGGCTGGTTTATACACACAGAGG - Intronic
1131804232 15:96105092-96105114 GGGCTTGTTAATAAACAGAGTGG - Intergenic
1143176605 17:4959198-4959220 TGGTTTGTTTATACACAGAAAGG - Intergenic
1156014510 18:32533004-32533026 GGGCTTGTTAAAACACAGATGGG - Intergenic
1161582646 19:5089125-5089147 GAGCTTGTGTATTCACAGAGTGG - Intronic
1165087171 19:33358577-33358599 GGGCATGTTTAAACACAGACAGG - Intergenic
1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG + Intergenic
932411567 2:71550892-71550914 GTTCTTCTTTATACACTGACAGG + Intronic
947297408 2:228647170-228647192 GAGCTTGTTTAATCTCAGACTGG - Intergenic
1170308648 20:14968620-14968642 GGGCTTGTTCAAGCACAGACTGG + Intronic
1174439472 20:50538480-50538502 CTGCTTGTTTTTACACAGAAAGG - Intronic
1176102158 20:63369481-63369503 GGGCTTGTATATGCACAAACAGG + Intronic
1181212173 22:21295344-21295366 GCGTGTGTTTAGACACAGATAGG + Intergenic
953967913 3:47324210-47324232 GAGCTTTTTAAGACACAGACTGG + Intronic
954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG + Intronic
957498628 3:81024233-81024255 GGGGTTGTTTATAGACAGTCTGG + Intergenic
961872265 3:129997185-129997207 TCGCATGTCTATACAAAGACAGG - Intergenic
972845962 4:42989659-42989681 GGGTTTGATTATACACAGAAGGG + Intronic
974288453 4:59899621-59899643 GCACATGTATATACACATACAGG - Intergenic
989646637 5:43640929-43640951 GTGCTTTTTTATCCACAGACTGG + Intronic
990527035 5:56638317-56638339 GCTCCTGTTTACACACAGCCTGG + Intergenic
1007394296 6:41568946-41568968 GAGCTTGTTTAAACAGAGGCTGG + Intronic
1022216295 7:28265560-28265582 GGGCTTGTTTAAACACAGATTGG + Intergenic
1024968632 7:55048565-55048587 GCATCTCTTTATACACAGACTGG + Intronic
1031232078 7:119120820-119120842 GTGCTTATTTCTACACAGTCTGG + Intergenic
1049040344 8:140108025-140108047 ACGTGTGTTTATACATAGACAGG + Intronic
1062583811 9:137240135-137240157 GCGCCTGTTTAAAAACAAACGGG - Intergenic
1062612728 9:137382284-137382306 GCGCTTGTTTATACACAGACAGG - Intronic
1186783221 X:12934244-12934266 GGGCTTGTTAAAACACAGTCTGG + Intergenic
1194396040 X:93387590-93387612 GAGCTTGTTAAAACACAGATTGG + Intergenic
1195657825 X:107349302-107349324 GCTCTTTTTTATATACAGAGAGG - Intergenic
1201577968 Y:15480333-15480355 GCCATTGTTAATACACAGGCTGG + Intergenic