ID: 1062615472

View in Genome Browser
Species Human (GRCh38)
Location 9:137394106-137394128
Sequence GGGTTAGGGAAGCGGCGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 11, 2: 3, 3: 6, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062615472_1062615484 9 Left 1062615472 9:137394106-137394128 CCCAGCCGCCGCTTCCCTAACCC 0: 1
1: 11
2: 3
3: 6
4: 183
Right 1062615484 9:137394138-137394160 AGCCTCCATTTCCCTAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062615472 Original CRISPR GGGTTAGGGAAGCGGCGGCT GGG (reversed) Intronic
900524687 1:3122837-3122859 GCTCTAGGGAGGCGGCGGCTGGG + Intronic
902286221 1:15410194-15410216 GGGTTGAAGACGCGGCGGCTGGG - Exonic
903002692 1:20277556-20277578 GGGTGGGGGAAGAGGCAGCTTGG + Intergenic
903230829 1:21921496-21921518 GGGGCAGGGAAGCAGGGGCTTGG - Intronic
903329157 1:22588358-22588380 GGGGTTGGGGAGCGGCTGCTTGG + Intronic
904338130 1:29811012-29811034 GGCTTTGGGATGCAGCGGCTTGG + Intergenic
905779062 1:40691900-40691922 GTGATAGGGAAGCGGCGGCGGGG + Intronic
907487530 1:54787951-54787973 GGGTAAGGGCAGAGGTGGCTGGG - Intronic
908832316 1:68191550-68191572 GGGTTAGGGAAGAGGGTGCCTGG - Intronic
913497398 1:119441069-119441091 GAGTCAGGGAAGAGGCTGCTGGG - Intergenic
917445038 1:175099700-175099722 GGGTTAGGGAGGAGGGAGCTGGG + Intronic
917816042 1:178711306-178711328 GGGTTGGGGAAGCGGAGAATTGG + Intergenic
918066386 1:181104937-181104959 GCTTGAGGGAAGCGGCGGCACGG - Intergenic
918076596 1:181175593-181175615 GGGTCAGGGGAGGGGCGGCTGGG - Intergenic
919748924 1:201024658-201024680 GGGGCAGGGAAGAGGCGTCTGGG - Intergenic
920100516 1:203514309-203514331 AGGTAAAGGAAGCGGGGGCTGGG - Intergenic
920508936 1:206536523-206536545 GAGTAAGGGAAGGGGCAGCTGGG + Intronic
920704856 1:208243627-208243649 GAGCTGGGTAAGCGGCGGCTGGG - Exonic
923551778 1:234970062-234970084 GGGTTCGGGCAGCGGGGGATGGG + Intergenic
1063663898 10:8050678-8050700 GGGGGAGGGACTCGGCGGCTCGG + Intergenic
1066355137 10:34676087-34676109 GAGTTATGGAGGCGGAGGCTTGG - Intronic
1068736304 10:60417031-60417053 GGCTGAGAGAAGCGGAGGCTAGG + Intronic
1069034198 10:63630443-63630465 GGGAGAGGGAGGCGGCGGTTGGG + Intergenic
1070161283 10:73868154-73868176 GAGATAGGGAAGGGGAGGCTGGG - Intronic
1070586805 10:77772634-77772656 GGGTCAGGGAAGCAGTGGCAGGG + Intergenic
1072733164 10:97861707-97861729 GGGTTTGGGAAGTGGGGGCAGGG + Intronic
1074503126 10:114044005-114044027 GGGTCAGGGCAGCCGCGGCGCGG - Intergenic
1075025038 10:118978226-118978248 GGCTTAGGGTAGGGGCGGGTGGG - Intergenic
1077093495 11:789870-789892 GGGAGAGGGAGGCGGCGGCCGGG - Intronic
1077247521 11:1546810-1546832 GGGTTCGGGGAGCGCCGGGTGGG + Intergenic
1078164623 11:8871266-8871288 GGGTGAGGGAGGCGGGGGCCGGG + Intronic
1080458339 11:32434550-32434572 GGATAGCGGAAGCGGCGGCTGGG - Intronic
1081969226 11:47186497-47186519 GGGTTGAGGCAGCGGCGGCCAGG - Intergenic
1082103337 11:48192654-48192676 GGGTTTGGTAAGAGGCGTCTGGG - Intergenic
1084400255 11:68939242-68939264 GGATTAGGTAGGCGGAGGCTGGG + Intronic
1084574514 11:69980264-69980286 GGGTTAGGGAAGTGGGGAATGGG + Intergenic
1084671595 11:70610051-70610073 GGGTGAGGGGAGCGGCTGCCAGG + Intronic
1086064533 11:82732473-82732495 GGGTTTGGGAAGGGGCGCCGGGG - Exonic
1088143242 11:106643982-106644004 GGGTTAATGAAGAGGCTGCTTGG + Intergenic
1088544666 11:110947400-110947422 GGGCTAGGGAAGGGCAGGCTGGG - Intergenic
1088994201 11:114982276-114982298 GGGTAAAGGAAGCAGCAGCTGGG + Intergenic
1089063166 11:115642735-115642757 GGGCTGGGGAAGCGAGGGCTGGG + Intergenic
1089388036 11:118080597-118080619 GGGCTAGGGAGGTGGCTGCTGGG - Intronic
1089762738 11:120740361-120740383 GGGTGAGGGAAGGAGGGGCTGGG - Intronic
1090619545 11:128549017-128549039 GGGTTAGGGACCGGGAGGCTGGG + Intronic
1090656936 11:128853492-128853514 GGGCTGGGGAAGAGGCGGATGGG + Intronic
1090668496 11:128930592-128930614 GGGTTAGGGAGGCCGGGGTTAGG + Intergenic
1090668509 11:128930623-128930645 GGGTTAGGGAGGCCGGGGTTAGG + Intergenic
1090668516 11:128930638-128930660 GGGTTAGGGAGGCTGGGGTTAGG + Intergenic
1090668522 11:128930653-128930675 GGGTTAGGGAGGCCGGGGTTAGG + Intergenic
1090668554 11:128930728-128930750 GGGTTAGGGAGGCCGGGGTTAGG + Intergenic
1090668561 11:128930743-128930765 GGGTTAGGGAGGCCGGGGTTAGG + Intergenic
1090668574 11:128930773-128930795 GGGTTAGGGAGGCCGGGGTTAGG + Intergenic
1090668581 11:128930788-128930810 GGGTTAGGGAGGCCGGGGTTAGG + Intergenic
1090668588 11:128930803-128930825 GGGTTAGGGAGGCTGGGGTTAGG + Intergenic
1090668594 11:128930818-128930840 GGGTTAGGGAGGCCGGGGTTAGG + Intergenic
1090668601 11:128930833-128930855 GGGTTAGGGAGGCCGGGGTTAGG + Intergenic
1090668608 11:128930848-128930870 GGGTTAGGGAGGCCGGGGTTAGG + Intergenic
1090668623 11:128930880-128930902 GGGTTAGGGAGGCTGGGGTTAGG + Intergenic
1090668629 11:128930895-128930917 GGGTTAGGGAGGCCGGGGTTAGG + Intergenic
1090668636 11:128930910-128930932 GGGTTAGGGAGGCCGGGGTTAGG + Intergenic
1090668643 11:128930925-128930947 GGGTTAGGGAGGCCGGGGTTAGG + Intergenic
1092548188 12:9469675-9469697 GGGTTAGGGAGGCGGTGCTTAGG - Intergenic
1092595151 12:9995029-9995051 GGGTTATAGAAGCAGCAGCTGGG - Intronic
1094041823 12:26126564-26126586 GGTCGCGGGAAGCGGCGGCTGGG + Intronic
1094375271 12:29783232-29783254 CGGTTCGGGAGGCGCCGGCTGGG - Intronic
1094504817 12:31052778-31052800 GGGTTAGGGAGGCGGTGCTTAGG + Intergenic
1096493681 12:52026938-52026960 GGGTTGAGGAAGAGGCTGCTTGG + Intronic
1097196028 12:57242921-57242943 GGGTTAGGGCAGGGGCCGCGCGG + Intergenic
1104882232 12:132080639-132080661 GGCTTTGGGAAGCGGCTGCCTGG - Exonic
1111396255 13:87672500-87672522 GGGATAGGGAGGCGGCGGGAGGG - Intergenic
1112323428 13:98427651-98427673 GGGTTAGGGTAGGGGAGGGTGGG - Intronic
1118780602 14:69005315-69005337 GGGCTAGGGAAGGTGAGGCTGGG - Intergenic
1122661322 14:103297551-103297573 GGCCTAAGGAAGCGGGGGCTGGG - Intergenic
1125792993 15:42383866-42383888 GAGTTAGGGCAGTGTCGGCTGGG - Intronic
1128870575 15:71152545-71152567 GTAGTAGGGAAGAGGCGGCTTGG + Intronic
1129482975 15:75842923-75842945 AGGCTAGCGAAGCGGTGGCTCGG + Intergenic
1129670472 15:77605225-77605247 TGGTTAGGGAAGCTGAGGCAGGG - Intergenic
1129983693 15:79897222-79897244 CGGTTAGGGGAGCGGTGGCGAGG + Intronic
1132311608 15:100861798-100861820 GAGTTTTGGAAGCCGCGGCTGGG - Intergenic
1136455135 16:30376082-30376104 GGGGTAGGGATGCTGAGGCTGGG + Intronic
1137288780 16:47037745-47037767 GGGCTCCGGAGGCGGCGGCTGGG + Intergenic
1137423253 16:48354092-48354114 GGGTTAGGGGTGGGGCGGGTGGG + Exonic
1140310130 16:73840877-73840899 GGGTTGGGGAAGAGGTGGGTAGG + Intergenic
1140723176 16:77788973-77788995 GGGGTGGGAAAGCTGCGGCTGGG + Intronic
1141995895 16:87636154-87636176 GGCTTTGGGAATCAGCGGCTTGG + Intronic
1142427174 16:90007336-90007358 GGGGTTGGGAAGCAGAGGCTGGG + Intronic
1142852686 17:2711795-2711817 GGGGCAGGGAAACGGCGGCGGGG - Intronic
1144473207 17:15562749-15562771 GGGTTAGGGAAGTGGGTTCTAGG - Intronic
1144923275 17:18781971-18781993 GGGTTAGGGAAGTGGGTTCTAGG + Intronic
1148062468 17:44846305-44846327 GGGTCAGGGAAGCAGTGACTTGG - Intergenic
1148337619 17:46851954-46851976 GGATGAGGAGAGCGGCGGCTGGG - Intronic
1148676553 17:49448870-49448892 AGGCTAGGGAAGGGGAGGCTGGG + Intronic
1148758998 17:49989767-49989789 GAGTCAGGGAAGCTGCTGCTGGG + Intergenic
1149935787 17:60805530-60805552 GACTTAAGGAAGTGGCGGCTGGG + Intronic
1150479639 17:65499395-65499417 GGGTTAGGGAGCAGGAGGCTGGG - Intergenic
1151660796 17:75516930-75516952 GGGTAAGGGAAGCGGGGGCGAGG + Intronic
1151787004 17:76279966-76279988 GGGTGAGGGCAGAGGGGGCTGGG - Intronic
1152211426 17:79004789-79004811 GGGTTAGGGAAGGGGGAGTTAGG + Intronic
1152211523 17:79005060-79005082 GGGTTAGGGAAGGGGGAGTTAGG + Intronic
1154132761 18:11750967-11750989 GGGTAGGGGAAGCGCCGCCTGGG + Intronic
1158259032 18:55587873-55587895 GGGGGAGGGAAGCGGCGGGAGGG + Intronic
1158681008 18:59566788-59566810 GGGTTGGGGCAGCAGCGGGTGGG - Intronic
1160330687 18:77988614-77988636 GAGTGAGGGAAGGGGAGGCTGGG + Intergenic
1161169988 19:2807811-2807833 GGGTGAGGGCAGCGGGGGCGGGG + Intronic
1161980420 19:7627445-7627467 GGGTGTGGGGAGAGGCGGCTGGG + Intronic
1162651247 19:12090741-12090763 GGGTTGGGGAAGGGGCTGCAGGG - Intergenic
1165012562 19:32859468-32859490 GGGTCAGTGAAGAGGTGGCTGGG - Intronic
1167374057 19:49101900-49101922 GGGTTGGGGAAGCGGAGGGTCGG - Intronic
1168312533 19:55468133-55468155 GGGATAGGGGAGAGGAGGCTGGG - Intergenic
926321691 2:11752793-11752815 GGGTTAGGAAAGCTGTGGCAGGG + Intronic
926893079 2:17655076-17655098 GGGAAAGGGAAGCTGAGGCTTGG + Intronic
929608584 2:43252759-43252781 GGGTTTGGGGAGAGGTGGCTAGG - Intronic
930575269 2:53139393-53139415 GGCTGAGGGAGGCGGCGGATGGG - Intergenic
933833964 2:86231288-86231310 GGGTTGGGGAGGTGGAGGCTCGG - Intronic
934902037 2:98167136-98167158 GGGACAGGGAAGGGGCGGATTGG + Intronic
939178718 2:138780587-138780609 GCGGGAGGGAGGCGGCGGCTCGG + Intergenic
942044648 2:172093088-172093110 GGGGTAGGAAAGCGGTGGGTGGG - Intergenic
947432946 2:230046522-230046544 GGTTTAGGGAAACGGCACCTTGG + Exonic
1177894583 21:26844601-26844623 GGTTTCCGGAAGCGGCGTCTCGG + Exonic
1180170776 21:46057116-46057138 GGGTTGGGGAAGGGGCAGCACGG - Intergenic
1182986745 22:34725449-34725471 GGGTCGGGGAAGGGGGGGCTAGG + Intergenic
1183726104 22:39590487-39590509 GGCAGAGGGAAGCGGAGGCTGGG - Intronic
1184308820 22:43628072-43628094 GGGTCAGGGGGGTGGCGGCTTGG - Intronic
1184711042 22:46249759-46249781 GGGGTTGGGGAGCGGGGGCTGGG + Intronic
1184787452 22:46678750-46678772 GGGTGAGGGATCCGGCGGCATGG + Exonic
1185055650 22:48577088-48577110 AGGTTTGGGAAGCAGGGGCTTGG + Intronic
952241181 3:31532814-31532836 GGGTGGAGGAAGCGGCGGCGGGG - Exonic
954711613 3:52507749-52507771 GGGTGGGGGAAGCAGAGGCTGGG + Intronic
955756461 3:62229546-62229568 CTGTTAGGGAAGCGGTGGGTGGG + Intronic
956103661 3:65794435-65794457 GGGCTGGGGAAGTGGCTGCTGGG - Intronic
963733139 3:148991697-148991719 GGAGAAGGGAGGCGGCGGCTGGG - Intronic
965778450 3:172257941-172257963 GGGGTGGGAAAGCGGCGGGTGGG + Intronic
967842581 3:194018788-194018810 GGGTTACGGAAGAGGAGGATGGG - Intergenic
968186179 3:196634731-196634753 GGGCTAGAGAAGTGGGGGCTGGG + Intergenic
968186194 3:196634778-196634800 GGGCTAGAGAAGTGGGGGCTGGG + Intergenic
969122360 4:4919646-4919668 GGGGTAGGGAGGTGGGGGCTAGG + Intergenic
973200313 4:47493794-47493816 GGGTTGGGGAGGGGGCGGCAGGG + Intronic
984635578 4:182106091-182106113 GGGTCAGGGGAGGGGAGGCTTGG - Intergenic
985951992 5:3229453-3229475 AGGTTAGAGAACCGGAGGCTGGG - Intergenic
989103451 5:37840114-37840136 GGGGTCGGGAGGCGTCGGCTGGG + Intergenic
989229814 5:39073902-39073924 GGGCGAGGGAAGCGGGCGCTGGG + Intronic
991127877 5:63088071-63088093 GGGCTAGGGAAGAGGGAGCTGGG + Intergenic
997211717 5:132080819-132080841 GGGGCAGGGAAGAGGAGGCTGGG - Intergenic
997709387 5:135990919-135990941 GCGTTTGGGAATCCGCGGCTGGG + Intergenic
998406429 5:141876991-141877013 GGGTTGGGGAGGCGCCGACTGGG + Intronic
998754286 5:145359014-145359036 GAATTAGGGAAGTGGCTGCTGGG - Intergenic
999237667 5:150108866-150108888 GGGTGAGGGAAGAGCCAGCTGGG + Intronic
999241612 5:150131236-150131258 GGGATAGGGCAGTGGGGGCTGGG - Intronic
1002604138 5:180371923-180371945 TGGTGATGGAAGCTGCGGCTTGG - Intergenic
1003135966 6:3435048-3435070 GGGTGCTGGAAGCGGCTGCTGGG + Intronic
1004044349 6:12011544-12011566 GGGTTAGGGACGCGGGGGGCGGG - Intronic
1005954969 6:30657257-30657279 GGGACAGGGAAGTGGGGGCTGGG + Intronic
1007482012 6:42156521-42156543 TGGTTAGGGAAGCCGGGGGTAGG - Intronic
1011471303 6:87710441-87710463 GGGTTAGGAAAGCTGCTCCTGGG - Intergenic
1017259685 6:152371706-152371728 GGGTTGGGGAAGGGACGGGTAGG + Intronic
1018628715 6:165804752-165804774 GGGGTCGGGGAGCGGCGGCGGGG + Intronic
1019381715 7:727451-727473 GGGTGGGGGAAGCGGCGCATGGG - Intronic
1022234294 7:28446202-28446224 GGGGGAGGGGAGGGGCGGCTGGG - Intronic
1024005202 7:45220124-45220146 GGGCTGGGGAAGAGGGGGCTGGG - Intergenic
1026059264 7:67011574-67011596 GAGTTAGAGAAGCAGAGGCTGGG + Intronic
1027390162 7:77696380-77696402 GGGGTAGGGAAGGGGCGGAGCGG - Intergenic
1034578322 7:152020755-152020777 GGATCAGGGAAGCAGCAGCTGGG + Intergenic
1035404041 7:158587165-158587187 GGTTTAGGGGAGGGGCGTCTCGG - Intronic
1038156372 8:24994590-24994612 GGATGAGTGAAGCGGTGGCTTGG + Intergenic
1038399059 8:27269231-27269253 GGGTTAGGCAAGCTGGGGATGGG + Intergenic
1038401205 8:27286344-27286366 GGGAGAGGGAAGAGGAGGCTGGG - Exonic
1038562382 8:28591388-28591410 GGGGGAGGGAAGAGGCTGCTGGG + Intergenic
1038689050 8:29744524-29744546 AGGTTAGGGAAGGAGCTGCTGGG - Intergenic
1039730205 8:40266800-40266822 GGGTTAGGGAAAGGACAGCTGGG + Intergenic
1039848525 8:41343151-41343173 GGGATAGGGAAGTGGGGGCCGGG + Intergenic
1044832362 8:96262255-96262277 GGGCTAGGGAAGAGGCGGGAGGG + Intronic
1045409647 8:101904292-101904314 GGATTAGGGGAGCGGGGGCGGGG - Intronic
1045810617 8:106216088-106216110 GGTTTAAGGAAACGGCGCCTTGG - Intergenic
1049192134 8:141294412-141294434 GGGTTGGTGAGGCGGGGGCTGGG - Intronic
1049462869 8:142738228-142738250 GGGTCAGGGAATGGGTGGCTGGG + Intergenic
1049755298 8:144308831-144308853 GGCCTGGGGAAGGGGCGGCTTGG + Intronic
1058991158 9:110256263-110256285 GGGAAAGGGACGCGGCGTCTCGG - Intronic
1060402470 9:123356588-123356610 GGGTTGGGGGATCGGGGGCTGGG + Intronic
1061726091 9:132582726-132582748 GGGCAGGGGCAGCGGCGGCTGGG + Exonic
1062615472 9:137394106-137394128 GGGTTAGGGAAGCGGCGGCTGGG - Intronic
1062615482 9:137394135-137394157 GGGTTAGGGAAATGGAGGCTGGG - Intronic
1062615492 9:137394164-137394186 GGGTTAGGGAAGCAGAGGCTGGG - Intronic
1062615501 9:137394193-137394215 GGGTTAGGGAAGCGGAGGCTGGG - Intronic
1062615512 9:137394222-137394244 GGGTTAGGGAAGCGGAGGCTGGG - Intronic
1062615523 9:137394251-137394273 GGGTTAGGGAAGCGGAGGCTGGG - Intronic
1062615534 9:137394280-137394302 GGGTTAGGGAAGCGGAGGCTGGG - Intronic
1062615545 9:137394309-137394331 GGGTTAGGGAAGCGGAGGCTGGG - Intronic
1062615556 9:137394338-137394360 GGGTTAGGGAAGCGGAGGCTGGG - Intronic
1062615567 9:137394367-137394389 GGGTTAGGGAAGCGGAGGCTGGG - Intronic
1062615578 9:137394396-137394418 GGGTTAGGGAAGCGGAGGCTGGG - Intronic
1062615589 9:137394425-137394447 GGCTTAGGGAAGCGGAGGCTGGG - Intronic
1062615599 9:137394454-137394476 GGGTTAGGGAAGCGGAGGCTGGG - Intronic
1062615610 9:137394483-137394505 GGGTTAGGGAAGCGGAGGCTGGG - Intronic
1062615621 9:137394512-137394534 GGGTTAGGGAAGCGGAGGCTGGG - Intronic
1062615632 9:137394541-137394563 GGATTAGGGAAGCGGAGGCTGGG - Intronic
1185641584 X:1591849-1591871 GGGCTTGGGAGGCGGCGCCTAGG + Intronic
1188521342 X:31041668-31041690 GGGTTAGGGAAGGGGAGGAAGGG + Intergenic
1192317403 X:70063524-70063546 AGGTTAGGAAAGCGGGGGCGGGG - Exonic
1196925537 X:120630102-120630124 GGGTAAAGGAGCCGGCGGCTGGG + Exonic
1197719425 X:129735007-129735029 GGGTTAAGGATGGGGAGGCTAGG + Intergenic
1199600712 X:149539902-149539924 AGCTTAGGGGAGCGGGGGCTTGG - Intergenic
1199649831 X:149939888-149939910 AGCTTAGGGGAGCGGCGGCTTGG + Intergenic
1200787428 Y:7273040-7273062 GGGTCAGGGGAGCAGCGTCTAGG + Intergenic