ID: 1062616440

View in Genome Browser
Species Human (GRCh38)
Location 9:137398673-137398695
Sequence ACGTGGGTGCCTGTGTGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 4, 2: 9, 3: 43, 4: 361}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062616440_1062616447 18 Left 1062616440 9:137398673-137398695 CCAAGACACACAGGCACCCACGT 0: 1
1: 4
2: 9
3: 43
4: 361
Right 1062616447 9:137398714-137398736 CCCGCATCCCCAAGACACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062616440 Original CRISPR ACGTGGGTGCCTGTGTGTCT TGG (reversed) Intronic
900102791 1:969488-969510 ATGTGTGTGCATGTGTGTATAGG + Intronic
900270015 1:1782253-1782275 ACCTGGGAGCCTGAGTGACTGGG - Intergenic
900362414 1:2295615-2295637 ACGTGACTGTGTGTGTGTCTGGG + Intronic
900642003 1:3692097-3692119 ACGTGTTTGCCTGTGTGTTGTGG + Intronic
900675391 1:3882053-3882075 ATGTGTGTGCGTGTGTGTTTGGG + Intronic
901693004 1:10985997-10986019 AGGTGTGTGCGTGTGTGTGTAGG - Intergenic
901844895 1:11975560-11975582 GAGTGGGTGTGTGTGTGTCTTGG + Intergenic
902338002 1:15764906-15764928 GGGAGGGTGGCTGTGTGTCTGGG + Intronic
903224425 1:21886760-21886782 AGGTGGGTGCATGGGTGGCTGGG + Intronic
903345040 1:22678501-22678523 ATGTGTGTGCATGTGTGTGTGGG - Intergenic
903668080 1:25020042-25020064 ATGTGTGTGCATGTGTGTGTGGG - Intergenic
904036762 1:27563108-27563130 GCGTGCGTGTGTGTGTGTCTTGG - Intronic
904036768 1:27563226-27563248 GCGTGCGTGTGTGTGTGTCTTGG - Intronic
904177750 1:28642981-28643003 ACGCTGCTGCCTGTGAGTCTTGG - Exonic
904412300 1:30331798-30331820 ACATGTGTGCCTGTGTGCATGGG + Intergenic
904687734 1:32273054-32273076 GTGTGGGAGCCTGTGTGTGTAGG + Intronic
904687748 1:32273128-32273150 GAGTGGGTGCCTGTGTGTGGGGG + Intronic
905232102 1:36520978-36521000 AGGTGGGTGCCAGTGAGTGTGGG + Intergenic
905347186 1:37319133-37319155 GCCTGGGTGTATGTGTGTCTAGG + Intergenic
905347204 1:37319240-37319262 GCCTGGGTGTATGTGTGTCTAGG + Intergenic
906714157 1:47954665-47954687 ATGTGTGTGCCTGTGTGTTGCGG + Intronic
907519863 1:55016029-55016051 ACGTGGGTGAGTGAGTGACTGGG + Intergenic
911433148 1:97818864-97818886 ATGTGTGTGCCTGTGTATATAGG + Intronic
913118615 1:115719239-115719261 ATGTGTGTGCCTGTGTGTGCCGG + Intronic
916945491 1:169722145-169722167 GCGTGTGTGCGTGTGTGTGTTGG + Intronic
917081566 1:171261308-171261330 GTGTGTGTGCCTGTGTGTGTTGG - Intronic
918307990 1:183264676-183264698 GCGTGTGTGCATGTGTGTGTGGG + Intronic
919780140 1:201216229-201216251 CCCTGGGTGCATGTGTGTGTTGG + Intronic
920032057 1:203043532-203043554 ACGTGTGTGTGTGTGTGTATGGG + Intronic
921348224 1:214208886-214208908 ACTTGGGTGCCTTTGTCTTTTGG + Intergenic
922614205 1:226951504-226951526 ACCTGGGGGCCTGTGGGTGTTGG + Intronic
1062775321 10:140096-140118 ATGTGTGTGTGTGTGTGTCTGGG - Intronic
1062850629 10:739695-739717 ATGTATGTGTCTGTGTGTCTGGG + Intergenic
1062931571 10:1356350-1356372 AGCTGGCTGCCTGTGTCTCTGGG - Intronic
1063033376 10:2258945-2258967 GCATGTGTGCCTGTGTGTGTTGG - Intergenic
1063859690 10:10294111-10294133 AGGTGCATGTCTGTGTGTCTGGG + Intergenic
1067844625 10:49710005-49710027 GTGTGTGTGTCTGTGTGTCTTGG + Exonic
1068629414 10:59284461-59284483 GTGTGTGTGCCTGTGTGTGTTGG - Intronic
1074868021 10:117556100-117556122 CAGTGGGTGAGTGTGTGTCTGGG - Intergenic
1075519140 10:123133702-123133724 GCGTGTATGCCTGTGTGTTTTGG - Intergenic
1076746364 10:132516861-132516883 ACTTGGGTGCCTGTGTACCTGGG - Intergenic
1076778802 10:132712606-132712628 GTGTGGGTGCATGTGTGTGTGGG + Intronic
1081789221 11:45771230-45771252 ATCTGTGTGCCTGTGTGTGTTGG - Intergenic
1082717131 11:56627893-56627915 ACGTAGGTCCTTGTGTGTCCTGG + Intergenic
1083141973 11:60729609-60729631 TCGTGGTTCCCTGTGTGTATTGG - Exonic
1083475599 11:62913048-62913070 CAGTGTGTGCTTGTGTGTCTGGG + Intronic
1085765583 11:79279075-79279097 CAGTGTGTGCCTGTTTGTCTGGG - Intronic
1085986299 11:81792342-81792364 ATGTAAGTGCCTGTATGTCTAGG - Intergenic
1088946453 11:114517995-114518017 GCGTAGGTGCCTGGATGTCTTGG + Intergenic
1089333543 11:117706989-117707011 TCCTGGGTGCTTGTGTGTCTGGG - Intronic
1090477040 11:127032468-127032490 AACTGAGTGCATGTGTGTCTGGG + Intergenic
1090645149 11:128761165-128761187 ACGAGGGTGCCTGGGGGTCTAGG - Intronic
1091196836 11:133738751-133738773 ATGTGGGTGCATGTGGGTGTGGG + Intergenic
1091604008 12:1935204-1935226 ACATGTGTGCGTGTGTGTATGGG - Intergenic
1092239737 12:6829275-6829297 GCGTGGGTGTGTGTGTGTGTCGG + Intronic
1092261175 12:6954001-6954023 ACGTGGTTTCCTGTGGGGCTGGG + Intronic
1092482068 12:8868456-8868478 ACGTGTGTGTGTGTGTGTGTTGG + Intronic
1094123864 12:27002041-27002063 ACGTGTGTGCGTGTGTGTTGTGG - Intronic
1096503484 12:52079520-52079542 ATGGGGGTGCCTGTGGGCCTTGG + Intergenic
1096715357 12:53487812-53487834 CTGTGTGTGCCTGTGAGTCTCGG - Intronic
1098098162 12:66982761-66982783 AGCTGGGTGCCTGTGTCTCAAGG - Intergenic
1101397577 12:104362170-104362192 ACGTGTGTGCCTGTGAGCCCAGG - Intergenic
1101769887 12:107739603-107739625 ATATGTGTGCCTGTGTGTCTTGG - Intronic
1101785643 12:107881018-107881040 ACATGGGTGCCGCTGTGTCATGG + Intergenic
1102044081 12:109818797-109818819 ACGTGTGTGCATGTGTGTTTTGG - Intronic
1102204312 12:111079753-111079775 ACCTGTGTGCATGTGTGTCCAGG + Intronic
1102504492 12:113375010-113375032 AGGTGGGTGTGGGTGTGTCTGGG + Intronic
1102537673 12:113593309-113593331 ACCTGGGTGTCAGTGGGTCTGGG - Intergenic
1104424679 12:128666120-128666142 GTGTGTGTGCCTGTGTGTGTGGG - Intronic
1104424688 12:128666216-128666238 GTGTGTGTGCCTGTGTGTGTGGG - Intronic
1108054080 13:46468428-46468450 ACGTGTGTGTGTGTGTGTGTAGG - Intergenic
1113439535 13:110317214-110317236 ATGTGTGTGTCTGTGTGTGTGGG - Intronic
1113677599 13:112217544-112217566 ATGTGGGTGCATGTGTGTGTTGG + Intergenic
1113681962 13:112250778-112250800 ATGTGTGTGCCTGTGTGTGTGGG - Intergenic
1113734297 13:112666480-112666502 ATGTGTGTCCCTGTGTGTCTGGG + Intronic
1118036938 14:61877946-61877968 CAGTGTGTGCCTGTGTGCCTGGG - Intergenic
1120266862 14:82261910-82261932 ACTTGGCTCTCTGTGTGTCTTGG + Intergenic
1121491237 14:94362776-94362798 GCATGTGTGTCTGTGTGTCTAGG - Intergenic
1122088224 14:99321444-99321466 GCATGGGTGCGTGGGTGTCTGGG - Intergenic
1122888430 14:104721920-104721942 CTGTGGGTGTCTGTGTGTCCTGG + Intronic
1124250794 15:28105453-28105475 GTGTGTGTGCATGTGTGTCTGGG + Intergenic
1124250845 15:28105729-28105751 GTGTGTGTGCATGTGTGTCTGGG + Intergenic
1124250865 15:28105866-28105888 GTGTGTGTGCATGTGTGTCTGGG + Intergenic
1124250884 15:28106002-28106024 GTGTGTGTGCATGTGTGTCTGGG + Intergenic
1124661691 15:31555066-31555088 ACGGGGCTGCCTATGTGGCTCGG + Intronic
1125884468 15:43218406-43218428 AGGTGGGTGCCTTTGGATCTTGG - Intronic
1126860737 15:52880195-52880217 ACGTGGGTGCCTGTTCTTCACGG + Intergenic
1127806336 15:62524378-62524400 AGGTGTGTGCTTGTGTGTGTAGG + Intronic
1128228351 15:66018182-66018204 CCTTGGGTGCCTGACTGTCTCGG + Intronic
1129478348 15:75803040-75803062 ACGTGGGGCCTTGTGTGTCCTGG + Intergenic
1130748866 15:86687861-86687883 ACCTGGCTGCCAGTGTGTATGGG - Intronic
1132342929 15:101089442-101089464 ATGTGTGTGCATGTGTGTGTAGG + Intergenic
1134060581 16:11197346-11197368 GCCTAGGTGTCTGTGTGTCTTGG + Intergenic
1134665940 16:16018697-16018719 ATGTGCCTGCTTGTGTGTCTCGG + Intronic
1134879245 16:17730002-17730024 AAGTGTGTGCATGTGTGTCTCGG + Intergenic
1134880197 16:17739567-17739589 GGGTGTGTGCCTGTGTGTATAGG - Intergenic
1135150673 16:20002578-20002600 ATGTGAATGACTGTGTGTCTTGG + Intergenic
1135156911 16:20060473-20060495 GTGTGTGTGTCTGTGTGTCTGGG + Intronic
1136282088 16:29219829-29219851 ATGTGTGTGTCTGTGGGTCTGGG - Intergenic
1136282095 16:29219977-29219999 ATGTGTGTGTCTGTGGGTCTGGG - Intergenic
1138351995 16:56350892-56350914 GTGTGTGTGCCTGTGTGTGTGGG - Intronic
1139956236 16:70694332-70694354 GTGTGGGTGCCTGTGTCCCTGGG + Intronic
1141239916 16:82256293-82256315 AAGTGAGTTCCTGTGTCTCTGGG - Intergenic
1142214804 16:88825193-88825215 TCTAGGGTGCCTGGGTGTCTGGG + Intronic
1142214853 16:88825321-88825343 TCTGGGGTGCCTGGGTGTCTGGG + Intronic
1142214888 16:88825415-88825437 TCTGGGGTGCCTGGGTGTCTAGG + Intronic
1142214952 16:88825584-88825606 GCTGGGGTGCCTGGGTGTCTGGG + Intronic
1142234663 16:88915988-88916010 CCATGGGTGCCTGTGTGCATGGG + Intronic
1142373164 16:89694151-89694173 AGGTGGGTGCTTCTGTGTGTAGG + Exonic
1142410595 16:89914133-89914155 GTGTGTGTGCCTGTGTGTGTGGG + Intronic
1142410599 16:89914223-89914245 GCATGTGTGCCTGTGTGTGTGGG + Intronic
1142410602 16:89914257-89914279 GTGTGTGTGCCTGTGTGTGTGGG + Intronic
1142410611 16:89914357-89914379 GTGTGTGTGCCTGTGTGTGTGGG + Intronic
1142410614 16:89914373-89914395 GTGTGGGTGCCTGTGTGTGTGGG + Intronic
1142410656 16:89914723-89914745 GTGTGTGTGCCTGTGTGTGTGGG + Intronic
1142410659 16:89914759-89914781 GTGTGTGTGCCTGTGTGTGTGGG + Intronic
1142410662 16:89914793-89914815 GTGTGTGTGCCTGTGTGTGTGGG + Intronic
1142410665 16:89914829-89914851 GTGTGTGTGCCTGTGTGTGTGGG + Intronic
1142410672 16:89914907-89914929 GTGTGTGTGCCTGTGTGTGTGGG + Intronic
1142410675 16:89914943-89914965 GTGTGTGTGCCTGTGTGTGTGGG + Intronic
1142783215 17:2198466-2198488 ACTTGTGTGCGTGTGTGTGTGGG - Intronic
1142960224 17:3547909-3547931 ACATGGGTGCCTGTGTTTGTGGG - Intronic
1144211206 17:13017307-13017329 GAGTGGGGGCCTGTGTGTGTGGG + Intronic
1147214053 17:38888955-38888977 ATCTGGATCCCTGTGTGTCTTGG + Intronic
1147636581 17:41967713-41967735 AGGTGGGGGTCTCTGTGTCTGGG - Intronic
1148584794 17:48769707-48769729 ACGTGAGTGCCAGTGTGTACAGG - Exonic
1148942660 17:51228324-51228346 ACGTGGGTAAATGTGTGTCATGG - Intronic
1149066182 17:52482253-52482275 TCGTGGTTGCCAGTGTTTCTGGG - Intergenic
1149447940 17:56728324-56728346 ACAGTGGTTCCTGTGTGTCTTGG + Intergenic
1149552513 17:57550802-57550824 ACGTGTGTGCCTATGCGTGTTGG - Intronic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1151090398 17:71433006-71433028 ACTTGTGTGTCTGTGTGTGTAGG - Intergenic
1151889032 17:76941332-76941354 ACGTGGGTGCTGGTGTGTGTAGG + Intronic
1151916976 17:77125669-77125691 AGGTAGGTGCCTGTGTGTCCTGG - Intronic
1152243736 17:79174238-79174260 GTGTGTGTGCCTGTGTGTGTGGG - Intronic
1152466659 17:80470464-80470486 ACGTGTGTGCGTGCGTGGCTGGG - Exonic
1152480439 17:80548225-80548247 AAGTGTGCGCCAGTGTGTCTGGG + Intronic
1152791306 17:82281844-82281866 ATGTGTGTGCGTGTGTGTGTTGG + Intergenic
1152857061 17:82671146-82671168 ATGTGTGTGACTGTGTGTGTTGG - Intronic
1156341433 18:36213535-36213557 CTGTTGCTGCCTGTGTGTCTGGG + Intronic
1156355151 18:36334287-36334309 ACTTGGGTGCCTTTGCTTCTTGG - Intronic
1156781601 18:40857217-40857239 TGGTGTGTGCCTGTGTGTCAGGG - Intergenic
1156898723 18:42276103-42276125 ACGTGTGTGTGTGTGTGTGTAGG - Intergenic
1158490118 18:57902492-57902514 AATTGGGTGCCTCTGTTTCTCGG + Intergenic
1158498016 18:57974162-57974184 ACTTGAGTCCCTGTGTGCCTCGG + Intergenic
1158662528 18:59401388-59401410 GCGTGTGTGTCTGTGTGTGTAGG + Intergenic
1159582236 18:70246222-70246244 ACGTGGCTGTCTGTGTGTTTGGG - Intergenic
1159798367 18:72868740-72868762 ACGGGGGTCCGTGTGTGCCTTGG - Intergenic
1159943676 18:74427833-74427855 ACGTGAGTGTGTGTGTGTGTTGG + Intergenic
1160523188 18:79520630-79520652 ATGTGTGTGTCTGTGTGTCGGGG + Intronic
1160523211 18:79520734-79520756 ATGTGTGTGTCTGTGTGTGTAGG + Intronic
1160523260 18:79520981-79521003 ATGTGTGTGTCTGTGTGTGTGGG + Intronic
1160523312 18:79521277-79521299 ATGTGTGTGTCTGTGTGTGTGGG + Intronic
1160523359 18:79521565-79521587 ATGTGTGTGTCTGTGTGTGTGGG + Intronic
1160523376 18:79521642-79521664 ATGTGTGTGTCTGTGTGTGTGGG + Intronic
1160523409 18:79521821-79521843 ATGTGTGTGTCTGTGTGTGTGGG + Intronic
1160523419 18:79521861-79521883 ATGTGTGTGTCTGTGTGTGTGGG + Intronic
1160568918 18:79803554-79803576 ACGAGGGGGCCTGTGATTCTGGG + Intergenic
1160796767 19:949250-949272 GCGTGGGTGCCTGTGTGGAGGGG + Intronic
1161086270 19:2337018-2337040 GTGTGTGTGCGTGTGTGTCTTGG + Intronic
1162073194 19:8167291-8167313 AGATGTGTGCCAGTGTGTCTTGG + Intronic
1162315394 19:9935790-9935812 ACGTGTGTGTCTTTGTGTCGTGG - Intronic
1162581673 19:11535194-11535216 ACGTGTTTGTCTGTGTGTTTTGG - Intergenic
1162926179 19:13931577-13931599 AGCTGTGTGCCTCTGTGTCTCGG + Intronic
1163795272 19:19334334-19334356 GTGTGGGTGCATGTGTGTCAGGG + Intronic
1163798256 19:19349462-19349484 GCTTGGGTGCCTGTGGGGCTTGG + Intronic
1164220124 19:23185921-23185943 TCGTAGGTGCCTTTGTGTCTTGG - Intergenic
1164620933 19:29695679-29695701 GTCTGGGTGTCTGTGTGTCTGGG - Intergenic
1164620983 19:29695943-29695965 ATCTGGGTGTCTGGGTGTCTGGG - Intergenic
1164621443 19:29697993-29698015 GTTTGGGTGTCTGTGTGTCTGGG - Intergenic
1164621490 19:29698177-29698199 AGCTGGGTGGCTGTGTGTCCGGG - Intergenic
1164871102 19:31644119-31644141 GTGTGCGTGCCTGTGTGTGTGGG - Intergenic
1165444819 19:35850998-35851020 ACGTGGTCAACTGTGTGTCTGGG - Exonic
1165984612 19:39757195-39757217 ATGTGTGTGCCTGTGTGTGTTGG + Intergenic
1166300781 19:41911111-41911133 ATGTGGGTGCCTCTGTGTGCAGG - Intronic
1167050300 19:47073975-47073997 GGGTGGGTGTCTGGGTGTCTAGG + Intronic
1167196935 19:48035821-48035843 ACGTAGGGGCTTGTGTGTCATGG + Intronic
1167371005 19:49081972-49081994 ACTTGGGACCCTGTGTGTCATGG - Intergenic
1167590817 19:50403324-50403346 GGGTGGGTGTCTGTGGGTCTGGG + Intronic
1168309901 19:55455160-55455182 ACCAGGGTGCCTGCGTGTCTGGG - Intronic
1168452427 19:56476990-56477012 CCGTGTGTGCCTGTGTGTGAGGG - Intronic
924999052 2:390557-390579 ACGTGTGTGTATGTGTGTGTGGG + Intergenic
925758603 2:7160864-7160886 TCCTGGCTGCCTGTGTTTCTTGG + Intergenic
926476865 2:13333569-13333591 GCGTGTGTGTTTGTGTGTCTGGG + Intergenic
926806232 2:16714459-16714481 ATGTATGTGCTTGTGTGTCTAGG + Intergenic
927060624 2:19416112-19416134 ACTTGGGTCAATGTGTGTCTTGG + Intergenic
927400264 2:22703279-22703301 ACATGGGTGTGTGTGTGTGTAGG - Intergenic
927495361 2:23548266-23548288 GTGTGTGCGCCTGTGTGTCTGGG - Intronic
930753786 2:54956017-54956039 ACGTGTGTGTGTGTGTGTGTAGG + Intronic
931146074 2:59520202-59520224 ATGTGTGTGCATGTGTGTATCGG - Intergenic
931463622 2:62468563-62468585 ATGTGGGTGCATGTGGGTGTTGG + Intergenic
932099193 2:68881041-68881063 GTGTGTGTGCCTGTGTGTGTTGG - Intergenic
932453304 2:71829918-71829940 ACATGGCTGCTTTTGTGTCTGGG + Intergenic
932507704 2:72252291-72252313 ACGTGTGTGTGTGTGTGTTTGGG + Intronic
932738371 2:74272174-74272196 GCATGTGTGTCTGTGTGTCTGGG + Intronic
933249196 2:80009518-80009540 ATGTGCATGCCTGTGTGTTTTGG - Intronic
935403252 2:102682307-102682329 ACATGGGTTCCTCTCTGTCTAGG - Intronic
936131296 2:109845296-109845318 ACTTGGGTGCATGTGTGTGGAGG - Intronic
936213401 2:110526189-110526211 ACTTGGGTGCATGTGTGTGGAGG + Intronic
937645742 2:124264361-124264383 GTGTGTGTGCCTGTGTGTGTGGG - Intronic
937666504 2:124494088-124494110 GTGTGTGTGCCTGTGTGTGTGGG + Intronic
938188715 2:129255497-129255519 AGGTGGGTGAGTGGGTGTCTAGG - Intergenic
940977924 2:159967138-159967160 GCCTGCATGCCTGTGTGTCTAGG - Intronic
946620600 2:221558302-221558324 ATGTGGGTGTGTGTGTGTGTGGG + Intronic
946925929 2:224626821-224626843 ATGTGTGTGTCTGTGTGTGTTGG - Intergenic
948666306 2:239536647-239536669 TCGTAGGTGCCCGTGTGTGTTGG + Intergenic
948897036 2:240932428-240932450 ACGGGGGTGGCTGTGTGGCAGGG + Intronic
1170300332 20:14876773-14876795 AGGTGTGTGGCTGTGTTTCTGGG + Intronic
1171350913 20:24502382-24502404 ACGTGGGAGGCAGTGTCTCTTGG + Intronic
1171482487 20:25464576-25464598 ATGTGTGCGCCTGTGTGTGTAGG - Intronic
1171779814 20:29408799-29408821 CCGTGTGTGTCTGTGTGTTTGGG + Intergenic
1172099736 20:32477963-32477985 ACGTGGGTGCCTGTGTTATGGGG - Intronic
1172485530 20:35295855-35295877 CTGTGTGTGCATGTGTGTCTGGG + Intergenic
1173381431 20:42546590-42546612 AGCTTGGTGCCTGTCTGTCTTGG + Intronic
1173453648 20:43187624-43187646 AAGTGGGTGCCTTTGTGCCAGGG - Intronic
1173976536 20:47190939-47190961 AAGTGGGTTCCTGTGTGGCAAGG - Intergenic
1174996049 20:55569527-55569549 ACCAGGGTGCCTTTGTGTTTTGG + Intergenic
1175643392 20:60650340-60650362 ACGTGTGTGTGTGTGTGTGTGGG + Intergenic
1175673516 20:60927373-60927395 CAGTGGGTGCCTGTGCCTCTTGG + Intergenic
1176266770 20:64213458-64213480 TCCTGGGTGTCTGTGTGTGTGGG - Intronic
1177576198 21:22959594-22959616 ATGTGGATGCCTATGTTTCTGGG - Intergenic
1178312322 21:31539725-31539747 ACTTGGGTGCTTATGTGGCTGGG - Intronic
1178926414 21:36779028-36779050 AAATGTGTGCATGTGTGTCTAGG + Intronic
1179605472 21:42513221-42513243 ACGTGGGAGCCTGTGTGCCAGGG + Intronic
1179707932 21:43193140-43193162 GCGTGTGTGTGTGTGTGTCTGGG - Intergenic
1179707945 21:43193384-43193406 GCGTGTGTGTGTGTGTGTCTGGG - Intergenic
1179772400 21:43631996-43632018 ATGTGGGAGCCTGTGTGTGTGGG - Intronic
1180172801 21:46068558-46068580 ATGTGTGTGCATGTGTGCCTGGG + Intergenic
1180172804 21:46068594-46068616 ATGTGTGTGCATGTGTGCCTGGG + Intergenic
1180172820 21:46068782-46068804 AGGTGTGTGCATGTGTGCCTGGG + Intergenic
1180172846 21:46069078-46069100 ATGTGTGTGCATGTGTGCCTGGG + Intergenic
1180172869 21:46069464-46069486 GTGTGTGTGCATGTGTGTCTGGG + Intergenic
1180228846 21:46414359-46414381 GGGTGGGTGGCTGTGTGTCCAGG - Intronic
1180324865 22:11361271-11361293 CCGTGTGTGTCTGTGTGTTTGGG + Intergenic
1180553335 22:16558366-16558388 GCTTGGCTGCCTGGGTGTCTTGG - Intergenic
1180554388 22:16563396-16563418 GCCTGGCTGCCTGTGTGGCTTGG - Intergenic
1181746310 22:24957177-24957199 TGGTGTGTGCCTGTGTGTGTTGG + Intronic
1183096740 22:35556629-35556651 ACCTGGGTGCCTGAGTGACCAGG - Intergenic
1183545919 22:38454908-38454930 GCGTGCGTGTCTGTGTGTCCCGG - Intronic
1183730957 22:39618161-39618183 AGGTGTGTGACTGTGTGTGTGGG + Intronic
1184400202 22:44269380-44269402 GTGTGGGTGTCTGTGTGTCATGG - Intronic
1184491932 22:44814860-44814882 TCCAGGGTGCCTGTGTATCTGGG + Intronic
1184839818 22:47046124-47046146 CTGTGGGTGTCTGTGTGTGTGGG + Intronic
1185192766 22:49449160-49449182 ATGCGTGTGTCTGTGTGTCTGGG - Intronic
949242347 3:1888005-1888027 CCATGGGTGCCTGTGTTTGTGGG - Intergenic
949627181 3:5880067-5880089 ATGTGGGTGCCTGTGCTACTGGG + Intergenic
951038961 3:17967182-17967204 ACATGGGTGCCAATGTGCCTTGG - Intronic
952512050 3:34067856-34067878 TGGTGTGTGCCTGTGTGTGTGGG - Intergenic
954042537 3:47899855-47899877 GCATGGATTCCTGTGTGTCTGGG + Intronic
955329479 3:58035084-58035106 ACGTGGCTTCCTGTGTCACTAGG + Intronic
956728216 3:72174111-72174133 ACGTCTGTGCCTGTGTATGTTGG + Intergenic
956780178 3:72597413-72597435 GTGTGGGTGCATGTGTGTGTTGG - Intergenic
957027544 3:75200315-75200337 GTGTGTGTGTCTGTGTGTCTGGG + Intergenic
959732356 3:109618952-109618974 ATGTGTGTGCATGTGTGTGTTGG + Intergenic
961044032 3:123696545-123696567 GTGTGGGTGCCTGAGTGGCTGGG - Intronic
961546693 3:127639251-127639273 TCCTGGGTGCCTGTGTGGCTGGG + Exonic
962841760 3:139238871-139238893 CTGTGGGTGCCTGTGAGTCCCGG - Intronic
962956215 3:140269402-140269424 ACGATGGTGCCTGAGTGTTTTGG + Intronic
964563046 3:158019506-158019528 ACATTGGTGTCTGAGTGTCTGGG + Intergenic
965109528 3:164402569-164402591 ACGTGTGTGTCTGTGTGTGTTGG + Intergenic
965443430 3:168745391-168745413 ACGTGTGTGCATGTGTGTGTGGG - Intergenic
966362432 3:179145214-179145236 ACGTGTGTGTATGTGTGTGTGGG + Intergenic
966924533 3:184635850-184635872 ATGTGCGTGCCTGTGTTTATGGG - Intronic
967415267 3:189210113-189210135 ATGTGTGTGTCTGTGTGTGTTGG + Intronic
967748726 3:193088934-193088956 ACGTGTGTGCATGTGTGTGTGGG - Intergenic
968132178 3:196198236-196198258 GCGTGGGTGTCTGTGCGTGTCGG - Intronic
968518731 4:1025862-1025884 ACGTGTGTGTGTGTGTGTCCAGG - Exonic
968750233 4:2385114-2385136 AGGTGGGTCCCTGAGTGACTTGG - Intronic
968890986 4:3368377-3368399 GTGTGGGTGCCTGTGTGTGTGGG + Intronic
968891042 4:3368669-3368691 GGGGGGGTGCCTGTGTGTGTGGG + Intronic
968891046 4:3368687-3368709 GTGGGGGTGCCTGTGTGTGTTGG + Intronic
968891051 4:3368706-3368728 TTGGGGGTGCCTGTGTGTGTTGG + Intronic
968891057 4:3368726-3368748 TGGGGGGTGCCTGTGTGTGTTGG + Intronic
969680422 4:8640158-8640180 AGCTGGGTGCAGGTGTGTCTAGG - Intergenic
970717622 4:18945039-18945061 GCGTGAGTGCCCGTGTGTGTTGG - Intergenic
974659541 4:64868153-64868175 ATGTGTGTGTCTGTGTGTGTGGG + Intergenic
974987471 4:69045886-69045908 AGGTGTGTGTCTGTGTGTATGGG + Intronic
976615704 4:87073983-87074005 GCGTGTGTGCATGTGTGTGTAGG + Intronic
977689716 4:99893470-99893492 ACGTGTGTGTGTGTGTGTGTAGG - Intronic
981497056 4:145405717-145405739 ACTTGAGTGCCAGTGTGTGTTGG + Intergenic
981728776 4:147875526-147875548 ATGTGTGTGCCTGTGTGCATTGG - Intronic
984374990 4:178918390-178918412 ACGTTGGTGAGTGTGTGTGTGGG - Intergenic
984518052 4:180766746-180766768 ATGTGTGTGCGTGTGTGTGTAGG - Intergenic
985445647 4:190019887-190019909 CCGTGTGTGTCTGTGTGTTTGGG + Intergenic
985656833 5:1136331-1136353 ACGTGTGTGCCTGCGTGTCCTGG - Intergenic
985656848 5:1136483-1136505 ACGTGTGTGCCTGCGTGTCCTGG - Intergenic
985656863 5:1136632-1136654 ACATGTGTGCCTGCGTGTCCTGG - Intergenic
985656867 5:1136670-1136692 ACGTGTGTGCCTGCGTGTCCTGG - Intergenic
985656879 5:1136784-1136806 ACGTGTGTGCCTGCGTGTCCTGG - Intergenic
986516628 5:8571375-8571397 ACGTTTGTGCTTCTGTGTCTGGG + Intergenic
989127444 5:38070391-38070413 ATGTGTGTGCGTGTGTGTGTGGG - Intergenic
993856215 5:93078840-93078862 GCCTGTGTCCCTGTGTGTCTGGG - Intergenic
996300266 5:121973596-121973618 ATGTGTGTGCATGTGTGTGTGGG + Intronic
996790131 5:127283626-127283648 ACGTGGATGCTTCTGTTTCTTGG - Intergenic
996884530 5:128339812-128339834 TCGTGGCTGCCTGTCTCTCTGGG - Intronic
997070370 5:130615595-130615617 ACGTGTGTGTGTGTGTGTGTGGG - Intergenic
997403258 5:133619218-133619240 AAGTTGGTGGCTGTGGGTCTAGG - Intergenic
997793308 5:136782503-136782525 ACGTGTGTGTGTGTGTGTGTCGG - Intergenic
998151344 5:139759193-139759215 AGCTGGGTGCCTGTGTGTGTTGG + Intergenic
999135803 5:149317959-149317981 ACGTGGGTGGCTCTTGGTCTGGG + Intronic
1001120422 5:168975460-168975482 ATGTGGATGTCTGTGTGTGTGGG - Intronic
1001381847 5:171310719-171310741 GTGTGTGTGCCTGTGTGTTTGGG - Intronic
1001487948 5:172133198-172133220 GCGTGTGTGCGTGTGTGTCTGGG + Intronic
1002176691 5:177404793-177404815 ACGTGGGTGAGTGAGGGTCTGGG - Exonic
1005148472 6:22720571-22720593 GCGTGTGTGTCTGTGTGTGTGGG + Intergenic
1006174003 6:32110836-32110858 CCGTGTGTGTCCGTGTGTCTGGG + Intronic
1006740166 6:36302327-36302349 AAGTGGGTGCCTGAGAGTGTAGG - Exonic
1007836403 6:44677263-44677285 CCCTGGGTGCCAGTCTGTCTTGG - Intergenic
1007944270 6:45811371-45811393 GGGTGGGTGCCTCTGTGTCTAGG + Intergenic
1008480372 6:51979582-51979604 AGGTGGGTGACTGTATGTGTGGG - Intronic
1011762570 6:90584489-90584511 ATGTGGGTGTGTGTGTGTTTAGG - Intronic
1012928986 6:105297176-105297198 ACATGGGTGCCTGGGTGTAGGGG - Intronic
1013486912 6:110606077-110606099 ATGTGTGTGTATGTGTGTCTGGG - Intergenic
1014725628 6:124968345-124968367 GTGTGCGTGCGTGTGTGTCTGGG + Intronic
1015075610 6:129152981-129153003 ACGTGTGTGTGTGTGTGTGTAGG - Intronic
1017905055 6:158752291-158752313 ACCTGGCTGCCTCTTTGTCTCGG + Intronic
1018116331 6:160589510-160589532 AAGTGGGTGGCTGTTTCTCTTGG + Intronic
1018745560 6:166759087-166759109 ATGTGTGTGCCTGTGTGTGCAGG + Intronic
1019433694 7:1011219-1011241 ATGTGGGTGTCTGTGGGTGTGGG - Intronic
1019748977 7:2717059-2717081 GCGTGGGTGCCGGTGTGTGGGGG - Intronic
1020953910 7:14715519-14715541 GCATGTGTGCCTGTGTGTGTTGG - Intronic
1021007757 7:15421233-15421255 ACGTGTGAGCCTGTGTGCGTGGG + Intronic
1022297091 7:29066462-29066484 ATGTGTGTGCATGTGTGTATGGG + Intronic
1022329722 7:29366221-29366243 ATGTGGGAGCCTTTGTGTGTAGG + Intronic
1024121456 7:46245418-46245440 ACGGGACTGCCTGTGTGCCTCGG + Intergenic
1024392771 7:48834462-48834484 GTGTGTGTGCATGTGTGTCTGGG + Intergenic
1025122949 7:56321247-56321269 AGGTGGGTGGCTGTGTTTGTTGG - Intergenic
1026272188 7:68846071-68846093 GTGTGTGTGCGTGTGTGTCTTGG - Intergenic
1032034221 7:128509725-128509747 ATGTGCGTGTGTGTGTGTCTAGG + Intergenic
1032648325 7:133850639-133850661 ACATGGGTGTGTGTGTGTGTGGG - Intronic
1032995864 7:137445835-137445857 ATATGGGTGCCTGTGTTTCTGGG - Intronic
1033510796 7:142058366-142058388 ACCCAGGTGCCTCTGTGTCTGGG + Intronic
1033994505 7:147329143-147329165 GCGTGGGTGTGTGTGTGTGTGGG - Intronic
1034393743 7:150804484-150804506 AGGTGTGTGCCTGTGTATTTGGG + Intronic
1034518937 7:151603994-151604016 AGGTGGGTGCCTGACTGGCTGGG - Intronic
1035202882 7:157278329-157278351 ACCTGTGGGCCTGTCTGTCTGGG - Intergenic
1035298301 7:157879352-157879374 ACGTGCATGCGTGTGTGTTTGGG - Intronic
1035848853 8:2894058-2894080 ACGTGGGGTCCTGGATGTCTTGG - Intergenic
1037431855 8:18821840-18821862 ATGTGTGTGCATGTGTGTGTGGG - Intronic
1038680253 8:29660279-29660301 AAGTGTGTGCGTGTGTGTATGGG - Intergenic
1039465982 8:37785584-37785606 ATATGGGTGTCTGTGTGTGTAGG - Intronic
1039665588 8:39523012-39523034 ACGTGGGAGCCTGCATTTCTGGG + Intergenic
1039846239 8:41327590-41327612 ATGTGTGTGCATGTGTGTATGGG - Intergenic
1040023428 8:42760971-42760993 TGGAGGGTGCCTGGGTGTCTTGG - Intronic
1040290114 8:46119906-46119928 ACCAGGGTGTCTGTGTCTCTCGG - Intergenic
1040291841 8:46129573-46129595 AGCAGGGTGCCTGTGTCTCTAGG - Intergenic
1040334658 8:46409919-46409941 AGCAGGGTGCCTGTGTCTCTGGG + Intergenic
1040336353 8:46418057-46418079 AGTAGGGTGCCTGTGTCTCTTGG + Intergenic
1042319499 8:67460088-67460110 ACCTGGGTGCCTCTATTTCTTGG + Intronic
1042704606 8:71652790-71652812 ACGTGCGTGTATGTGTGGCTTGG + Intergenic
1044821119 8:96156619-96156641 AGGTGTGTGCCTGTGTGTTTAGG - Intronic
1045300194 8:100904118-100904140 ACGTGAGTGCCTGTGTTTGCTGG - Intergenic
1046493378 8:114982392-114982414 ACGTGTGTGCATGTGTGTAGCGG - Intergenic
1047364983 8:124203464-124203486 CCGTGGGTGTGTGTGTGTGTTGG - Intergenic
1047764433 8:127978912-127978934 ACGTGTGTGTCTGTGTTTGTAGG + Intergenic
1048522454 8:135169435-135169457 ATGTGTGTGTGTGTGTGTCTTGG + Intergenic
1048856646 8:138692425-138692447 ACGTGTGTGCATGTGTGTGGAGG + Intronic
1049234836 8:141507339-141507361 GCGTGTGTGCCTGTGTTTGTGGG + Intergenic
1049316084 8:141969023-141969045 ATGTGGGTGCATGTGTGTGTGGG + Intergenic
1049525512 8:143124421-143124443 ACGTGTGTGAGTGTGTGTGTGGG - Intergenic
1050880260 9:10690509-10690531 GTGTGGGTGCGTGTGTGTGTGGG + Intergenic
1051027600 9:12631855-12631877 ACGTGTGTGTGTGTGTGTCTTGG - Intergenic
1052466059 9:28830753-28830775 ACGTGTGTGTGTGTGTGTATAGG - Intergenic
1053222988 9:36327056-36327078 ATGTGGGGCCCAGTGTGTCTCGG + Intergenic
1053389686 9:37725402-37725424 GTGTGTGTGCATGTGTGTCTTGG - Intronic
1053812128 9:41862985-41863007 ATGTGTGTGCTTGTGTGTGTAGG - Intergenic
1054254357 9:62799422-62799444 CCGTGTGTGTCTGTGTGTTTGGG - Intergenic
1054336941 9:63816173-63816195 CCGTGTGTGTCTGTGTGTTTGGG + Intergenic
1054618467 9:67324454-67324476 ATGTGTGTGCTTGTGTGTGTAGG + Intergenic
1056460281 9:86802932-86802954 ATGTGTGTGCATGTGTGTGTGGG + Intergenic
1056754281 9:89372391-89372413 TCGGGGGTGTGTGTGTGTCTGGG + Intronic
1056886585 9:90449036-90449058 ACATGGATGCCTGTGTCACTAGG - Intergenic
1057721778 9:97537310-97537332 TCGTGCGTGCCTGTGTGTGCGGG + Intronic
1057799452 9:98181229-98181251 ACGTGGGTGCCCGTGGGTTCTGG - Intronic
1061323846 9:129850066-129850088 ATGTGATCGCCTGTGTGTCTGGG + Intronic
1061779300 9:132986367-132986389 CCCTGGGTGTCTGTGTCTCTGGG + Intronic
1061936831 9:133862578-133862600 ATGTGTGTACGTGTGTGTCTGGG + Intronic
1062123578 9:134847709-134847731 GTGTGTGTGCCTGTGTGTATGGG + Intergenic
1062171300 9:135136321-135136343 AGGTGGGAGTCTGTGTGGCTTGG - Intergenic
1062205895 9:135336950-135336972 ACGTGTGTGCATGTGTGTGAGGG + Intergenic
1062207537 9:135345609-135345631 ATGTGTGTGCCTGTGTGCCCGGG + Exonic
1062285016 9:135768953-135768975 ACGTGGGTGATGGTGTATCTGGG + Intronic
1062285037 9:135769071-135769093 ACGTGGGTGACGGTGCGTCTGGG + Intronic
1062285044 9:135769111-135769133 ACGTGGGTGTCGGTGCGTCTGGG + Intronic
1062285052 9:135769151-135769173 ACGTGGGTGACGGTGCGTCTGGG + Intronic
1062285059 9:135769191-135769213 ACGTGGGTGACAGTGCATCTGGG + Intronic
1062285065 9:135769229-135769251 ACGTGTGTGTCGGTGTGTCTGGG + Intronic
1062285081 9:135769311-135769333 ACGTGGGTGACGGTGTGTCTGGG + Intronic
1062616408 9:137398523-137398545 ACGCGGTTGCCTGTGTGTCTTGG - Intronic
1062616413 9:137398548-137398570 ACGCGGTTGCCTGTGTGTCTTGG - Intronic
1062616418 9:137398573-137398595 ACGCGGTTGCCTGTGTGTCTTGG - Intronic
1062616423 9:137398598-137398620 ACGCGGGTGCCAGTGTGTCTTGG - Intronic
1062616429 9:137398623-137398645 ACGCGGGTGCCTGTGTGTCTTGG - Intronic
1062616435 9:137398648-137398670 ACGCGGTCGCCTGTGTGTCTTGG - Intronic
1062616440 9:137398673-137398695 ACGTGGGTGCCTGTGTGTCTTGG - Intronic
1062616451 9:137398723-137398745 ACGCGGGTGCCTGTGTGTCTTGG - Intronic
1062616457 9:137398748-137398770 ACGCGGGTGCCTGTGTGTCTCGG - Intronic
1062616463 9:137398773-137398795 ACGCGGGTGCCTGTGTGTCACGG - Intronic
1062616469 9:137398798-137398820 ACGCGGGTGCCTGTGTGTCACGG - Intronic
1062616480 9:137398848-137398870 ACGCGGGTGCCTGTGTGTCTTGG - Intronic
1062616485 9:137398873-137398895 ACGCGGGTGCATGTGTGTCACGG - Intronic
1062616491 9:137398898-137398920 ACGCGGTTGCCTGTGTGTCTTGG - Intronic
1062616502 9:137398961-137398983 ACATGGTTGCCTGTGTGTCTTGG - Intronic
1203372515 Un_KI270442v1:321838-321860 CCGTGTGTGTCTGTGTGTTTGGG + Intergenic
1185845823 X:3436500-3436522 GTGTGGGTGTCTGTGTGCCTCGG + Intergenic
1186250004 X:7655752-7655774 ATGTGGGTTCCAGTTTGTCTTGG - Intergenic
1189212576 X:39296395-39296417 ATGTGGGTGTGTGTGTGTGTTGG - Intergenic
1189737732 X:44088570-44088592 GCGTGTGTGCATGTGTGTTTCGG - Intergenic
1191824479 X:65349771-65349793 ACTTGGGAGGGTGTGTGTCTAGG - Intergenic
1192798470 X:74443989-74444011 ATGTGTGTGCATGTGTGTCTGGG + Intronic
1199891025 X:152082164-152082186 AGGTGTGTGCCTGTATTTCTGGG - Intergenic
1200174596 X:154104608-154104630 GTGTGTGTGTCTGTGTGTCTGGG - Intergenic
1200225276 X:154413546-154413568 AAGTGTGTGCCTGTGTGCCGAGG + Exonic
1200701073 Y:6403060-6403082 ATTTGGATGCTTGTGTGTCTCGG + Intergenic
1200818606 Y:7559791-7559813 GTGTGGGTGTCTGTGTGCCTCGG - Intergenic
1201033039 Y:9761638-9761660 ATTTGGATGCTTGTGTGTCTCGG - Intergenic
1201064869 Y:10088331-10088353 CCGTGTGTGTCTGTGTGTTTGGG - Intergenic
1201728249 Y:17178698-17178720 ATGTGTGTGCCTGTGTGTATTGG - Intergenic