ID: 1062617272

View in Genome Browser
Species Human (GRCh38)
Location 9:137403510-137403532
Sequence CTGGAGGGCTGAAACGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062617272_1062617279 1 Left 1062617272 9:137403510-137403532 CCAGGTCCGTTTCAGCCCTCCAG 0: 1
1: 0
2: 0
3: 3
4: 114
Right 1062617279 9:137403534-137403556 CGCCCGTACCCAGGAAACCTGGG No data
1062617272_1062617275 -8 Left 1062617272 9:137403510-137403532 CCAGGTCCGTTTCAGCCCTCCAG 0: 1
1: 0
2: 0
3: 3
4: 114
Right 1062617275 9:137403525-137403547 CCCTCCAGACGCCCGTACCCAGG No data
1062617272_1062617278 0 Left 1062617272 9:137403510-137403532 CCAGGTCCGTTTCAGCCCTCCAG 0: 1
1: 0
2: 0
3: 3
4: 114
Right 1062617278 9:137403533-137403555 ACGCCCGTACCCAGGAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062617272 Original CRISPR CTGGAGGGCTGAAACGGACC TGG (reversed) Intronic
902558345 1:17260362-17260384 TTCGAGGGCTGATAGGGACCAGG + Intronic
903228465 1:21907166-21907188 CTGGAGGGTCCAAGCGGACCAGG - Intronic
903578294 1:24352756-24352778 CGGGAGGTCGGAAACAGACCAGG - Intronic
905205549 1:36341027-36341049 CTGGTGGGCTGAAAGGGGACAGG + Exonic
906704496 1:47885069-47885091 CTGGAGAGGTGAATTGGACCAGG - Intronic
913116375 1:115701463-115701485 CATGAGGGCTGAACCAGACCAGG + Intronic
920246807 1:204593877-204593899 CTGGAGGCCTGCAGTGGACCAGG + Intergenic
921379294 1:214507309-214507331 ATGGAGGGCTGAAAAGGATGGGG - Intronic
923274806 1:232386686-232386708 TTGGAGGGGTGAAAAGAACCGGG + Intergenic
1072736684 10:97883849-97883871 CAGGAGGGCAGCAACAGACCTGG + Intronic
1076320660 10:129579043-129579065 CAGGAGGGCTGAAACTTACTGGG + Intronic
1078210220 11:9264788-9264810 CTGGAGGGGGGAAACGGATGAGG - Intronic
1078920843 11:15828882-15828904 CTGGTGGCCTGAAAAGAACCTGG + Intergenic
1082964069 11:58947832-58947854 AAGGAGGGATGAAAGGGACCAGG - Intronic
1086803424 11:91207158-91207180 CTGGAGGGCTGAACAGAAACTGG - Intergenic
1088581091 11:111317665-111317687 CTGGAATGCTAAAGCGGACCTGG + Intergenic
1089510602 11:118994504-118994526 ATGGAGGGGTGAAACAGCCCAGG + Intergenic
1096570839 12:52522260-52522282 CTGGAGGCCTGAGACATACCAGG + Intergenic
1096993355 12:55822713-55822735 CAGGAGGTTTGAAATGGACCGGG - Exonic
1102679563 12:114682344-114682366 CTGGAGGGCAGAAAGGGCCGGGG + Intronic
1107326591 13:39250194-39250216 CTGGAGGTCTGGAAAGGTCCTGG - Intergenic
1107822036 13:44295006-44295028 CTGGAGGGGTCAAGCGGATCTGG - Intergenic
1108975883 13:56442614-56442636 CTGGAGGGATGCAACGGTCAAGG + Intergenic
1118685812 14:68290027-68290049 ATTGAGGGCTGAGAGGGACCGGG - Intronic
1119259899 14:73231942-73231964 CTGGGGGGCTGTCACGGACAGGG - Intergenic
1121962760 14:98276309-98276331 CAGGAGGGCTGGGAAGGACCAGG + Intergenic
1124722056 15:32118874-32118896 CTAGAGGGCTGCAAAGGAACAGG + Intronic
1125895974 15:43301982-43302004 CTGGGGGGCTGAAATGGCCTTGG - Intronic
1128391793 15:67187301-67187323 CAGGAGGGGAGCAACGGACCTGG + Intronic
1129694141 15:77731104-77731126 CTGGGGGGCTGGAAGGTACCCGG - Intronic
1132457791 16:33680-33702 CTGCAGTGCTGAGACGGCCCAGG - Intergenic
1133292880 16:4734432-4734454 CTGGAGGGCGGGGACGGAGCAGG - Exonic
1136591620 16:31221217-31221239 CTGGAGGGATGAACAGGAGCTGG + Intronic
1137365608 16:47856806-47856828 CTGGAGTGCTGAAATGTCCCAGG + Intergenic
1138449422 16:57084575-57084597 CTGGAGGGCTGCAAAGGTCAAGG - Intergenic
1140564622 16:76027101-76027123 CTGGACGCCTGACAAGGACCCGG + Intergenic
1142690626 17:1604479-1604501 AAGGAGGGCTGAACCGGCCCAGG - Intronic
1147396622 17:40148345-40148367 CTGAAGGGATGAAGCTGACCTGG - Intronic
1151181064 17:72329048-72329070 CAGGAGGGGTGAACCGGCCCCGG + Intergenic
1151305378 17:73259778-73259800 CTGGGGGGCTGGAGGGGACCAGG - Intronic
1151475121 17:74340834-74340856 CTGGAGGGGTGAGGCGGAGCAGG + Intronic
1151956443 17:77382558-77382580 CTGGAGGGCTGGGAGGGACCAGG + Intronic
1152104927 17:78323280-78323302 CTGGAGGGAGGAAACAGACCAGG + Intergenic
1152678418 17:81653382-81653404 CAGGAGGGCTGACTGGGACCCGG - Intronic
1152941567 17:83175495-83175517 CTGAGGGGCTGAAACGGTGCTGG + Intergenic
1154961679 18:21315864-21315886 CTGCGGGGCTGAAACAGAGCTGG - Intronic
1155273822 18:24167010-24167032 CTGGAGGGCTGGTACTGACTAGG + Intronic
1157332999 18:46716896-46716918 CTGGAGGGAGGACAAGGACCTGG + Intronic
1158975485 18:62707816-62707838 CTTGAGATCTGAAACTGACCTGG + Intergenic
1159904399 18:74077063-74077085 CTGCAGTGCTGAAACTGACTCGG + Intronic
1160797445 19:952638-952660 CTGAAGGGCTGCAGCTGACCAGG + Intronic
1164157346 19:22604667-22604689 CCGGAAGGCTGGAACAGACCTGG + Intergenic
1166324117 19:42038623-42038645 CTGGAGGGCTGGAAAGGGCACGG + Intronic
1167117066 19:47494409-47494431 TTGGAGGGCTGAGACAGACAGGG + Intronic
1168201217 19:54817279-54817301 CTGGAGTGGAGATACGGACCTGG + Intronic
925412480 2:3647899-3647921 CTGTAGGGGAGAAACAGACCTGG + Intergenic
932886765 2:75555756-75555778 CTGGAGGGCAGAGATGGGCCTGG - Intronic
934612561 2:95751998-95752020 CAGGAGGGCTGGAGCTGACCTGG + Intergenic
934648353 2:96072425-96072447 CAGGAGGGCTGGAGCTGACCCGG - Intergenic
934841586 2:97627446-97627468 CAGGAGGGCTGGAGCTGACCTGG - Intergenic
937853515 2:126656409-126656431 CTGGAGGCCCGGCACGGACCGGG - Intronic
937944199 2:127316561-127316583 GTGGATGGCTGAAAAGGAACAGG + Intronic
942715336 2:178885109-178885131 CTGGAGGTCAGAAACTGACAGGG + Intronic
946180455 2:217945882-217945904 CTAGAGAGCTGAAACTGACCCGG - Intronic
1168878059 20:1184973-1184995 CCGGAAGGCCGAACCGGACCAGG + Intronic
1168908753 20:1428094-1428116 CTTGAGGCCTGAACCTGACCAGG + Intergenic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1177756588 21:25356083-25356105 CTGGATGACTGAGAAGGACCAGG + Intergenic
1178392712 21:32212484-32212506 CAGGAGGGCTGAAACTGAAGGGG + Intergenic
1184571124 22:45325684-45325706 GTGGATGGCTGAGATGGACCAGG + Intronic
1185244426 22:49765644-49765666 CTGGAGGTTGGAAACGGGCCTGG - Intergenic
953668733 3:44944974-44944996 CTAGAGGGCTCACAGGGACCAGG + Intronic
954627745 3:52031912-52031934 CTGGAGGGTAGACACGGACAGGG + Intergenic
965511744 3:169575386-169575408 CTGGGGGACTGAAAAAGACCAGG + Intronic
968137619 3:196230356-196230378 CTGCAGGGCTCAAAGGGAGCAGG - Intronic
968149858 3:196328910-196328932 CTGGAGCTCAGAAACAGACCCGG + Intronic
968150489 3:196334421-196334443 CTGGAGCTCAGAAACAGACCCGG + Intronic
968578472 4:1378829-1378851 CTGGTGGGCTGAAGAGCACCTGG - Intronic
968772190 4:2514538-2514560 CTGGTGGGCAGAAACGGGCTGGG - Exonic
972380725 4:38517604-38517626 CTGCAGGGATGAAACTGCCCAGG - Intergenic
978386747 4:108183492-108183514 CAGGAGGGATGAAACGCACAGGG - Intergenic
981487228 4:145300345-145300367 CTGGAGGGCAGAAACTGAGATGG + Intergenic
986242507 5:5973612-5973634 CTGGAGTGCTGAAATCCACCTGG - Intergenic
987758636 5:22129649-22129671 CTGGAGCACTGAAAAGCACCAGG - Intronic
988976507 5:36521642-36521664 CAGTAGGGCTGAAACACACCTGG - Intergenic
991749391 5:69783788-69783810 CTGGAGCACTGAAAAGCACCAGG - Intergenic
991800971 5:70363596-70363618 CTGGAGCACTGAAAAGCACCAGG - Intergenic
991827629 5:70646445-70646467 CTGGAGCACTGAAAAGCACCAGG + Intergenic
991893336 5:71363087-71363109 CTGGAGCACTGAAAAGCACCAGG - Intergenic
992505273 5:77381083-77381105 CTGGAGAGCTGGCAGGGACCAGG + Intronic
996083878 5:119284276-119284298 CTGGAGGGCAGTAACAGAGCTGG + Intronic
996149319 5:120016135-120016157 CTGGGGGGCTACAATGGACCTGG + Intergenic
998611415 5:143693339-143693361 CTGGAGGCATGAAAAAGACCTGG - Intergenic
999467834 5:151823725-151823747 CTGGAGGGCTGCAAAGTATCTGG - Intronic
1005783229 6:29215778-29215800 CTGGAGAGCTGAATCAGAGCTGG - Intergenic
1007231446 6:40350016-40350038 ATGGAGGGCTGAACCACACCGGG + Intergenic
1013866911 6:114709567-114709589 CTGGTGTGCTGAAACGCACTTGG - Intergenic
1014157988 6:118134413-118134435 CTGGAGTGCTGAATCAGAGCTGG - Intronic
1017705601 6:157119820-157119842 CTGGAGTTCTGAAACTGACAAGG - Intronic
1018883599 6:167911486-167911508 CTGGCCGGCTGGAACGTACCTGG - Exonic
1022973455 7:35537186-35537208 CTGGAGGACTGAGACACACCTGG + Intergenic
1030172378 7:106616408-106616430 CCTGAGGGCAGAAAAGGACCTGG + Intergenic
1036665422 8:10734160-10734182 CCGGAGCTCTGAACCGGACCAGG + Intronic
1038840509 8:31180558-31180580 CTGGAGGGCTGGAAAGCCCCAGG + Intergenic
1045313951 8:101027360-101027382 CTGGATGGCTGAATCAGAACTGG + Intergenic
1048844458 8:138593956-138593978 CTGGAGGGCGGAGAAGGAACAGG - Intronic
1049064797 8:140304627-140304649 CTGCAGGCCTGCCACGGACCAGG + Intronic
1050254836 9:3783381-3783403 CTGGGAGGCTGAAACAGGCCAGG + Intergenic
1053593222 9:39534013-39534035 CCGGAGGGCAGACACGGACAGGG + Intergenic
1053850958 9:42288721-42288743 CCGGAGGGCAGACACGGACAGGG + Intergenic
1054573084 9:66831264-66831286 CCGGAGGGCAGACACGGACGGGG - Intergenic
1057008289 9:91580375-91580397 CTGCAGGGCTGAGAAGGGCCAGG - Intronic
1058911426 9:109523508-109523530 CTGGAGGGCTGAAACTTATTAGG - Intergenic
1061164845 9:128916344-128916366 GTGGAGGGCTGACAAGGAGCAGG + Exonic
1062617272 9:137403510-137403532 CTGGAGGGCTGAAACGGACCTGG - Intronic
1062736352 9:138139699-138139721 CTGCAGTGCTGAGACGGCCCAGG + Intergenic
1188643871 X:32539903-32539925 CTGGAGGGAAAAAACAGACCAGG + Intronic
1189211382 X:39286949-39286971 CTGGAGGGGTGGAAGGGAACAGG - Intergenic