ID: 1062618630

View in Genome Browser
Species Human (GRCh38)
Location 9:137409249-137409271
Sequence GACTCCGAAGGGTCCTGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 6, 3: 41, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062618630 Original CRISPR GACTCCGAAGGGTCCTGAGG CGG (reversed) Intronic
900401998 1:2476434-2476456 GGCTTCGGAGGGCCCTGAGGAGG + Exonic
904031461 1:27536070-27536092 GGCTCCTAAGGAACCTGAGGAGG - Intronic
906617730 1:47246047-47246069 GACTCTGCAGAATCCTGAGGTGG + Intergenic
908303927 1:62791554-62791576 GATTCTGCAGAGTCCTGAGGTGG + Intronic
910581162 1:88826583-88826605 GACTCAGAAGGGTGAGGAGGTGG - Intronic
911674807 1:100647174-100647196 GAGTCCGAATGGTCCTGATGAGG + Intergenic
913202448 1:116506185-116506207 AACTCTGTAGAGTCCTGAGGTGG + Intergenic
915981868 1:160425404-160425426 AACTCTGGGGGGTCCTGAGGGGG + Exonic
916625767 1:166553466-166553488 GTCTACCAAGGGTCCTGAGTTGG - Intergenic
918545906 1:185683660-185683682 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
919510483 1:198457294-198457316 GATTCTGGAGAGTCCTGAGGTGG + Intergenic
920228197 1:204453100-204453122 GACTGAGGAGGGTCCTGGGGAGG - Intronic
920554222 1:206892291-206892313 GACTCTGCAGAGTCCCGAGGTGG + Intergenic
921183959 1:212654430-212654452 GACACTGAAGGTTCTTGAGGAGG + Intergenic
1064060834 10:12135613-12135635 GTCTCCGAAGGGTACAGGGGTGG - Intronic
1066010991 10:31193220-31193242 GTCTCTGCAGAGTCCTGAGGTGG + Intergenic
1066509884 10:36083922-36083944 GACTCCAAATGGTCCCGATGAGG - Intergenic
1070785848 10:79161924-79161946 GACTCTGAAGGGACATGATGGGG - Intronic
1072025583 10:91452663-91452685 GACTCTGCAAAGTCCTGAGGGGG - Intronic
1073930200 10:108566664-108566686 GACTCCGCAGGGTCCAGCCGTGG + Intergenic
1074288011 10:112116486-112116508 CACTGCGCTGGGTCCTGAGGAGG + Intergenic
1074411716 10:113234441-113234463 GAGTCCAAAAGGTCCAGAGGAGG + Intergenic
1074434055 10:113418662-113418684 GACTGGGAAGGGTGCTGATGGGG + Intergenic
1076451032 10:130557114-130557136 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
1076803267 10:132842772-132842794 GCCTCTGCAGAGTCCTGAGGTGG + Intronic
1077114647 11:878034-878056 GACTCCGAAGAGTCCGGAGGTGG - Intronic
1077743917 11:4879753-4879775 GAATCGGAAGGGTTCTTAGGAGG + Intronic
1078073161 11:8132369-8132391 GACTCTGAAGGCTTTTGAGGAGG - Intronic
1078130592 11:8611100-8611122 GTCTCCCAAGACTCCTGAGGTGG + Intergenic
1080888773 11:36390292-36390314 CACATGGAAGGGTCCTGAGGTGG + Intronic
1081734562 11:45393988-45394010 GACTCCGAAGGGCGCTGCCGGGG + Intergenic
1083281149 11:61628071-61628093 GGCTCCCCAGGGGCCTGAGGAGG + Intergenic
1083818366 11:65150908-65150930 GCCTGCCAAGGGGCCTGAGGTGG - Intergenic
1085800035 11:79580813-79580835 CTCTCTGCAGGGTCCTGAGGTGG - Intergenic
1089067226 11:115670960-115670982 GACTTCACAGGGTCCTTAGGTGG + Intergenic
1089904822 11:122027820-122027842 GACCCTGCAGAGTCCTGAGGTGG + Intergenic
1091303876 11:134524294-134524316 GCCGCCGCAGGGTCCTGAGGCGG - Intergenic
1093885148 12:24450946-24450968 GACTGGGAAGGGTAGTGAGGGGG - Intergenic
1094738416 12:33260745-33260767 GACTTTGAAGGGTCCAGGGGTGG + Intergenic
1095051080 12:37554769-37554791 GACCCTGAGGGGGCCTGAGGAGG + Intergenic
1095054397 12:37582356-37582378 GACCCTGAAGGGACCTGAAGGGG + Intergenic
1097097786 12:56563498-56563520 AACTCCGAAGGGTCTTCATGGGG - Intronic
1100267451 12:92991029-92991051 GACTCCAAAGGGTCACTAGGAGG - Intergenic
1101621958 12:106397388-106397410 GACTAGGAAGGGGCATGAGGGGG - Intronic
1102046285 12:109832286-109832308 GACTCCCCGGGCTCCTGAGGAGG - Intronic
1102905582 12:116672418-116672440 GACTCAGAAGGGTGGGGAGGGGG - Intergenic
1104291745 12:127475576-127475598 GACTCAGAAAGGAGCTGAGGTGG - Intergenic
1104648951 12:130517277-130517299 GACTCTGTAGGGTCCCAAGGTGG - Intronic
1106514148 13:30438560-30438582 GACTACAAAGGGTCATAAGGAGG - Intergenic
1108230262 13:48331541-48331563 GAGTCCTCAGAGTCCTGAGGTGG - Intronic
1109444400 13:62414194-62414216 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
1111583102 13:90250028-90250050 GGCTCTAAAGGGTACTGAGGAGG - Intergenic
1113285225 13:108839110-108839132 GACTCTGCAGAGTCCTGAGGTGG + Intronic
1119180460 14:72601372-72601394 CACCACGAAGGGTCCTGAGCAGG - Intergenic
1121528067 14:94633253-94633275 AAGTCCGGAGGGTGCTGAGGCGG + Intergenic
1121753118 14:96375815-96375837 GACTCTGCAGAGTCCTGAGGTGG + Intronic
1122996260 14:105266678-105266700 GACTCAGCATGGTCCTGGGGAGG - Intronic
1127012166 15:54642687-54642709 GAATCCGAAGGGTCCAGATGAGG + Intergenic
1127788761 15:62379712-62379734 GCCTCCGAAGGAGGCTGAGGTGG + Intergenic
1130098991 15:80877665-80877687 GACCCAGCAGTGTCCTGAGGTGG - Intronic
1130895344 15:88166163-88166185 GATTCCAAAGGATCCTGAGCAGG - Intronic
1131572092 15:93548785-93548807 GACTCAGAAGGGTACAGGGGTGG + Intergenic
1132959462 16:2613867-2613889 GCCTCTGAAGCCTCCTGAGGTGG + Intergenic
1132972523 16:2695842-2695864 GCCTCTGAAGCCTCCTGAGGTGG + Intronic
1135204808 16:20474434-20474456 GACTCCGCAGAGTCCCAAGGAGG - Intronic
1138323652 16:56142049-56142071 GACTCTGAAGCGTCCAAAGGTGG + Intergenic
1139516402 16:67454870-67454892 GACGGGGAAGGGCCCTGAGGTGG - Intronic
1145374936 17:22338419-22338441 GACCCTGAAGGGACCTGAGGGGG + Intergenic
1146958852 17:36955162-36955184 GAGTTGGAAGGGACCTGAGGAGG + Intronic
1149206643 17:54255113-54255135 CTCTCTGAAGAGTCCTGAGGAGG - Intergenic
1149632650 17:58139654-58139676 GACTCTGAGGAGTCCTGAGGTGG + Intergenic
1157023722 18:43817432-43817454 GACTCTGAAGAGTCCTGAGGTGG - Intergenic
1160196053 18:76756548-76756570 GACTCCTTAGGGGCCTGAGGTGG + Intergenic
1160537833 18:79604377-79604399 GCCTCCGAAGGCTCCAGGGGAGG + Intergenic
1161809172 19:6461741-6461763 GTCACCCAAGGGTCCTCAGGAGG + Intronic
1162427172 19:10603470-10603492 GACACTGAAGGGCCCTGGGGAGG + Intronic
1163086008 19:14979951-14979973 GCCTCCGAGGGCTCCGGAGGCGG - Intronic
1165572972 19:36791188-36791210 GACCCTGAAGGGACCTGAGCGGG - Intergenic
1165632290 19:37312194-37312216 GACCCAGAAGGGGCCTGATGGGG - Intergenic
1165912126 19:39236086-39236108 GACTCTGCAGGGCCCTAAGGTGG - Intergenic
1166323094 19:42031502-42031524 AACTCAGAAGGGGCCTGATGGGG - Intronic
1167712297 19:51119894-51119916 GACCCAGAGGGGTCCTGAGCGGG + Intergenic
927356726 2:22182023-22182045 GACTCCTCAGAGTCTTGAGGTGG + Intergenic
929181358 2:39043663-39043685 GACTCTGCAGAGTCCTGACGCGG + Intronic
931413864 2:62062177-62062199 AACTCCTAAGGATACTGAGGTGG + Intronic
932637733 2:73407132-73407154 GACTCTGCAGAATCCTGAGGTGG + Intronic
932781690 2:74562506-74562528 GACTTCCAGGGGTGCTGAGGAGG + Intronic
936444542 2:112585536-112585558 GAATCTGAAGGATCCTGAGATGG - Intronic
938222580 2:129582888-129582910 GACTCAGAAGGGTGGGGAGGTGG - Intergenic
938679166 2:133671587-133671609 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
938909873 2:135876208-135876230 GACGCCGCAGGCTCCGGAGGCGG + Intronic
939656847 2:144836731-144836753 GACTCGGAAGAGTCTTGAGAAGG - Intergenic
942308785 2:174634814-174634836 GACTCCAAAGGAACCTGAAGGGG + Intronic
946095793 2:217273258-217273280 GATTCCTGAAGGTCCTGAGGTGG - Intergenic
946715887 2:222554983-222555005 GACTCCGAAGGGATGGGAGGAGG - Intronic
948654488 2:239468418-239468440 CCCTGGGAAGGGTCCTGAGGTGG + Intergenic
1169309296 20:4521577-4521599 GAGGCGGAAGGGTGCTGAGGTGG - Intergenic
1169395070 20:5221825-5221847 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
1171471716 20:25377492-25377514 GACTCCGAAGAGTCCCAAGGTGG + Intronic
1171527860 20:25829992-25830014 GACCCTGAAGGGACCTGAGGGGG - Intronic
1171548966 20:26025888-26025910 GACCCTGAAGGGACCTGAGGGGG + Intergenic
1172081570 20:32345214-32345236 GACTCTGAAGGCTTCTGAGCTGG + Intergenic
1172942635 20:38664945-38664967 GACTCCAAAGGGTTCCAAGGGGG + Intergenic
1173110062 20:40178519-40178541 GACTCAGAAGGGTGAGGAGGTGG + Intergenic
1173516407 20:43667822-43667844 GACTGAGAAGGGTGCTGAGTTGG + Intronic
1177533619 21:22396709-22396731 GACTACTAAGGGTCCTGGGTTGG - Intergenic
1179156716 21:38857495-38857517 CACTCCGCAGGGTCCCGAGTAGG + Intergenic
1179370235 21:40800123-40800145 GACTCTGTAAAGTCCTGAGGTGG - Intronic
1179925384 21:44531327-44531349 TTCTCCGAAGGCTCCAGAGGAGG + Intronic
1180112839 21:45672202-45672224 GACTCTGCAGAGTCCTGAGGTGG - Intronic
1182118096 22:27769203-27769225 GACTCTGAAGGTTCCCTAGGAGG - Intronic
1184517439 22:44971381-44971403 TACCCCGAATGGCCCTGAGGAGG - Intronic
949374953 3:3378982-3379004 GACTCTGCAGAGTGCTGAGGTGG + Intergenic
949739031 3:7208642-7208664 GACTCTGTTGGGTCCTGTGGGGG + Intronic
949865144 3:8541247-8541269 AACTCAGAAAGGTCCTCAGGGGG + Intronic
952407508 3:33017855-33017877 GACCCCGAAGGCTTCTGAGAGGG + Intronic
952413064 3:33066436-33066458 GACTCTGCAGAGTCCTGAGGGGG - Intronic
953147925 3:40295773-40295795 CTCTCTGAAGGGTCCTGAGGTGG - Intergenic
953833675 3:46324968-46324990 TACTCTGAAGAGTCTTGAGGTGG + Intergenic
954405766 3:50344234-50344256 CACTGTGAAGGGTCCTGAGTAGG - Intronic
957997656 3:87710732-87710754 GACTCTGTAGAGTCCTGAAGGGG - Intergenic
959596208 3:108131574-108131596 ATCTCCCAAGTGTCCTGAGGAGG + Intergenic
961313570 3:126019133-126019155 GACTCTGCAGAGTCCGGAGGTGG + Intronic
961388519 3:126538015-126538037 GAGTCCCAAGGGGCCTGAGTTGG + Intronic
963055816 3:141185617-141185639 GACTCCCAAGGGCCCGGAGAGGG + Intergenic
963344283 3:144075287-144075309 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
966816747 3:183896034-183896056 GGAACCGAAAGGTCCTGAGGAGG + Intergenic
968498030 4:929203-929225 GACCCCCAAGGCTCCTGAGCGGG + Intronic
970669054 4:18375151-18375173 GACTCTGCAGGGTCCTGAGATGG - Intergenic
971266586 4:25101233-25101255 GACTCGGAAGGGTGAGGAGGTGG - Intergenic
978323999 4:107530608-107530630 GACTCAGAAGGGTGAGGAGGTGG + Intergenic
979018902 4:115469089-115469111 GACTCCGCAGAGTCCAGAGGTGG - Intergenic
979567628 4:122173347-122173369 GACTCTGCAGAGTCTTGAGGTGG + Intronic
981361021 4:143845743-143845765 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
981371759 4:143966745-143966767 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
981380849 4:144069943-144069965 GATTCTGTAGAGTCCTGAGGTGG + Intergenic
981718942 4:147779456-147779478 GATGGGGAAGGGTCCTGAGGGGG + Intronic
982436030 4:155383941-155383963 GGCTCCACAGGGTCCTGTGGGGG + Intergenic
983217444 4:165015406-165015428 GACTGCGATGGGATCTGAGGTGG + Intergenic
983824985 4:172248652-172248674 AATTCCCAAGGGTCCTGAGAGGG + Intronic
983895118 4:173072964-173072986 GACTCTGAAGAGTCCCGAAGTGG - Intergenic
988573324 5:32393682-32393704 GACTCCAAAGAGTCCTTATGTGG - Intronic
995345641 5:111113748-111113770 GACTCTGAAGAGTCCCAAGGTGG + Intronic
997365746 5:133324239-133324261 GACTCCGAAGAGTCAAGGGGAGG + Intronic
997392023 5:133524903-133524925 GACTCCAAAGGGCTGTGAGGAGG - Intronic
997669961 5:135662700-135662722 TGCTCCCAAGGGACCTGAGGGGG - Intergenic
999323952 5:150631588-150631610 GCCTGCGAAGGGGCTTGAGGCGG + Intronic
999589428 5:153128542-153128564 TACTCAGAAGGGTCCTGGGGAGG + Intergenic
999617777 5:153443326-153443348 GACTCTGCAGAGTCCTGAGGAGG + Intergenic
1001121272 5:168982375-168982397 CTCTCTGAAGGGTCCTTAGGTGG - Intronic
1001568691 5:172716463-172716485 GGCTGGGAGGGGTCCTGAGGAGG + Intergenic
1001931552 5:175676726-175676748 GACTCTGAAGGGTGAGGAGGTGG - Intronic
1002001080 5:176196571-176196593 GGCTCAGATGGGCCCTGAGGTGG - Intergenic
1002253255 5:177942401-177942423 GGCTCAGATGGGCCCTGAGGTGG + Intergenic
1003232715 6:4269209-4269231 GACTCTGCAGAGCCCTGAGGTGG - Intergenic
1003613795 6:7636913-7636935 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
1003863546 6:10343495-10343517 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
1004173525 6:13318114-13318136 CTCTCTGCAGGGTCCTGAGGTGG - Intronic
1004246052 6:13977132-13977154 GACTCCGCAGTGTCTTCAGGAGG - Exonic
1005006469 6:21292275-21292297 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
1006381100 6:33697667-33697689 TGCCCCCAAGGGTCCTGAGGAGG - Exonic
1006843921 6:37049920-37049942 CACTCAGCAGGGTCCTGAGGAGG + Intergenic
1010066956 6:71693805-71693827 GACTCCCAAGGGTTATGAAGAGG + Intergenic
1010583133 6:77623910-77623932 TTCTCAGAAGAGTCCTGAGGTGG + Intergenic
1017484226 6:154888344-154888366 GACTCTGCAGAGTCCTGAGGTGG + Intronic
1018246048 6:161825424-161825446 GAGGCCAAGGGGTCCTGAGGAGG - Intronic
1022498879 7:30870303-30870325 ACCTCAAAAGGGTCCTGAGGGGG - Intronic
1023729419 7:43176522-43176544 GACTCTGCAGAGGCCTGAGGTGG + Intronic
1028534094 7:91872028-91872050 GACTCTGAAGAGTCCTGAGGCGG - Intronic
1028987802 7:97021683-97021705 GCCACCGAAGGGTCGCGAGGTGG - Intronic
1029376162 7:100177987-100178009 GACACCCGAGGGACCTGAGGTGG + Intronic
1031226125 7:119040468-119040490 GACTCTGCAGAGTCCAGAGGTGG - Intergenic
1032850984 7:135795193-135795215 GACTCTGAAGAGTCCTGAGGTGG + Intergenic
1032892638 7:136215784-136215806 TACTCTGCAGAGTCCTGAGGTGG + Intergenic
1033152986 7:138932768-138932790 GACTCCGTAGGGTCTTGAGTGGG - Intronic
1035167953 7:157002804-157002826 GACCCCGGAGGGAGCTGAGGCGG - Intronic
1035197218 7:157231690-157231712 GACTCTGCAGAGTCCGGAGGCGG - Intronic
1036470847 8:9051274-9051296 GACTCTGTGGAGTCCTGAGGTGG + Intronic
1038158829 8:25017226-25017248 GACTCTGAAGAGTCCTGAGGTGG + Intergenic
1039449804 8:37663315-37663337 TTCTCTGCAGGGTCCTGAGGAGG + Intergenic
1040788311 8:51193825-51193847 GACTCAGAGGTGTCCTGAGGAGG + Intergenic
1041153969 8:54964487-54964509 GACTCTGCAGAGTCCTCAGGTGG - Intergenic
1041732942 8:61081130-61081152 GACACTGAAGGTTTCTGAGGAGG + Intronic
1045518132 8:102879144-102879166 GACTCTGCAGTGTCCTGAGGTGG - Intronic
1046880598 8:119302977-119302999 GACTCTGAAGAGTCCTGAAGTGG + Intergenic
1048835608 8:138516061-138516083 GTCTCTGAGGGGTCCTCAGGAGG + Intergenic
1049303408 8:141883802-141883824 GGCTTGGGAGGGTCCTGAGGTGG - Intergenic
1053240458 9:36490316-36490338 GACTCTGCACAGTCCTGAGGTGG - Intergenic
1054149356 9:61588734-61588756 GACCCTGAAGGGACCTGAGGGGG + Intergenic
1054469116 9:65519845-65519867 GACCCTGAAGGGACCTGAGGGGG + Intergenic
1055020627 9:71665593-71665615 GACTCTGAAGAGTCGTGTGGCGG - Intergenic
1055843898 9:80537699-80537721 GACTCTGCAGGGTTCTGAGGTGG - Intergenic
1056783803 9:89573482-89573504 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
1058562973 9:106249359-106249381 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
1058639946 9:107073902-107073924 GACTCTGAAGGTTTCTGAGCAGG - Intergenic
1062618630 9:137409249-137409271 GACTCCGAAGGGTCCTGAGGCGG - Intronic
1185557781 X:1034955-1034977 GGCTCCGAAGCGTTCCGAGGAGG + Intergenic
1186809564 X:13174909-13174931 GACTCTGCAGAGTTCTGAGGTGG + Intergenic
1190144821 X:47880921-47880943 GACTCTGCAGGGTCCTGAGGTGG + Intronic
1190803508 X:53813860-53813882 GAGTCCAAATGGTCCAGAGGAGG - Intergenic
1192229580 X:69255904-69255926 GGCTCTGAAGAGCCCTGAGGGGG - Intergenic
1192330055 X:70167999-70168021 GACTGGGAAGGGTACTGGGGTGG + Intergenic
1192363902 X:70455416-70455438 CGCTCCGAGGGGCCCTGAGGAGG - Intronic
1196317891 X:114250745-114250767 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
1199754591 X:150852386-150852408 GACCCCTGAGGGCCCTGAGGTGG - Intronic