ID: 1062622990

View in Genome Browser
Species Human (GRCh38)
Location 9:137430971-137430993
Sequence CCATCCCTGTGTAAGACCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062622976_1062622990 23 Left 1062622976 9:137430925-137430947 CCTGGGGCTGCGAAGTTCCTCTG 0: 1
1: 0
2: 0
3: 13
4: 111
Right 1062622990 9:137430971-137430993 CCATCCCTGTGTAAGACCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 116
1062622983_1062622990 6 Left 1062622983 9:137430942-137430964 CCTCTGATGGGAGGTGTGGGGTG 0: 1
1: 1
2: 2
3: 39
4: 335
Right 1062622990 9:137430971-137430993 CCATCCCTGTGTAAGACCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 116
1062622974_1062622990 27 Left 1062622974 9:137430921-137430943 CCCTCCTGGGGCTGCGAAGTTCC 0: 1
1: 0
2: 1
3: 12
4: 127
Right 1062622990 9:137430971-137430993 CCATCCCTGTGTAAGACCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 116
1062622975_1062622990 26 Left 1062622975 9:137430922-137430944 CCTCCTGGGGCTGCGAAGTTCCT 0: 1
1: 0
2: 0
3: 19
4: 141
Right 1062622990 9:137430971-137430993 CCATCCCTGTGTAAGACCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062622990 Original CRISPR CCATCCCTGTGTAAGACCTG GGG Intronic
900861845 1:5239339-5239361 CCATGCCTGGGCAAGACCAGAGG - Intergenic
910976264 1:92909432-92909454 CCATCCCTGAGTCATATCTGGGG + Intronic
913461751 1:119093903-119093925 CCAAGACTGTGCAAGACCTGGGG + Intronic
923666642 1:236004076-236004098 CCCTCCCTTTGTTAGATCTGAGG - Intronic
1065588725 10:27243935-27243957 CCATACCTATCTAAGTCCTGTGG + Intergenic
1065688214 10:28307059-28307081 CCATCCCTGTTTATGAGCAGAGG + Intronic
1065788806 10:29241456-29241478 CAATCCCTGTGAAAGCCCTGTGG - Intergenic
1069322880 10:67194784-67194806 CCATCCATGTGTAGGAGCAGGGG + Intronic
1070675996 10:78411707-78411729 ACAACCCTGTGTGACACCTGAGG + Intergenic
1072663689 10:97379259-97379281 CCTTGCCTGTGTGTGACCTGAGG - Intronic
1072742481 10:97917738-97917760 CCAACCCTGTGAAAGAGCTATGG - Intronic
1074817372 10:117152577-117152599 CCAGCCCTGTTTCAGTCCTGTGG + Intergenic
1075467263 10:122661097-122661119 CCATGTCACTGTAAGACCTGAGG - Intergenic
1076528167 10:131125870-131125892 TCATCTCTGTGTAAGAGCAGAGG - Intronic
1079086019 11:17445520-17445542 CCATTCCCGTGTAAGCCCTGAGG - Intronic
1079814604 11:25039601-25039623 CCATCTCTGTCTAATACCTGGGG + Intronic
1079834577 11:25317333-25317355 ACATTCCTATGGAAGACCTGGGG + Intergenic
1080173717 11:29337415-29337437 CCAGCCCTGTGGCAAACCTGAGG + Intergenic
1089103539 11:115983602-115983624 CCTTCCCTTTGCAGGACCTGAGG + Intergenic
1090934518 11:131329712-131329734 CCACCCCTGTGTCAGAGGTGAGG + Intergenic
1103329015 12:120140934-120140956 CCATCCTTGAGGAAGGCCTGAGG - Exonic
1103362762 12:120363398-120363420 CCTTCCCTGTGTTAGTCCTTAGG - Intronic
1105468209 13:20667354-20667376 CCATGCCTGTGCTAGATCTGAGG + Intronic
1106142754 13:27025105-27025127 CCCTCCTTCTGTAAGTCCTGGGG + Intergenic
1113449262 13:110395060-110395082 CCAACCCTGTGGAGGACCCGTGG - Intronic
1114182506 14:20378228-20378250 ACCTCCCTGTGTAGGACCTGGGG - Exonic
1115696994 14:35909961-35909983 CCATCCCTGTGGGAGTACTGAGG + Intronic
1119331704 14:73799862-73799884 CCATCCCTGTGCAGGACCTTGGG - Intergenic
1122362050 14:101173350-101173372 TCAGCCCTGTGTCAGACCTTTGG - Intergenic
1122955736 14:105070065-105070087 CCTTCCCTGGCTGAGACCTGGGG - Intergenic
1124411125 15:29438175-29438197 CCATCCCAGTCTCAGAACTGTGG - Intronic
1126840964 15:52717252-52717274 CCACCCCTGTTTGAGACCTTGGG - Intergenic
1126920453 15:53516397-53516419 GCATCCCAGCATAAGACCTGAGG + Exonic
1128688487 15:69705362-69705384 CCATTCCCCTGTAAGACCTTAGG - Intergenic
1133720318 16:8488694-8488716 CTATTCCCTTGTAAGACCTGTGG - Intergenic
1134093006 16:11401535-11401557 CCATCCCTGTGCAAGGCCCTCGG + Intronic
1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG + Intergenic
1136143276 16:28300932-28300954 CCATCCCGGTGTAGGAGCTCAGG + Intronic
1141640463 16:85338051-85338073 CCTTCCCTGTGCTGGACCTGTGG + Intergenic
1143104175 17:4520140-4520162 CCATCCCTATCTAACAGCTGAGG - Intronic
1144261986 17:13530635-13530657 ACCTCCCTTTGTAAGACTTGGGG + Intronic
1144337156 17:14281612-14281634 CCATCCCACTCAAAGACCTGTGG - Intergenic
1146581680 17:34044178-34044200 CAATCCCTTTGGAAGAACTGAGG + Intronic
1147664085 17:42134724-42134746 CCTTTCCTGTGGAAGACATGAGG - Intronic
1151713838 17:75821504-75821526 CCATCCCAGAGGAAGACCTCAGG - Intronic
1152041560 17:77906895-77906917 TCCTCCCTCTGTAAGACATGGGG - Intergenic
1152451268 17:80381971-80381993 CCCTGCCTGGCTAAGACCTGCGG + Intronic
1155141198 18:23046299-23046321 TCATCTCTTTGTAAGAACTGTGG + Intergenic
1158549270 18:58421052-58421074 CCATCTCTGTTTAAGAGCTCTGG + Intergenic
1159300726 18:66562889-66562911 CCATCACTGAGTAAAACCTGAGG + Intronic
1159657524 18:71050185-71050207 CAATCTCTATGAAAGACCTGAGG - Intergenic
1167111902 19:47467501-47467523 GCTTCCCTGTGTCTGACCTGAGG + Intronic
1168125731 19:54281558-54281580 CCAGACCAGGGTAAGACCTGAGG + Intergenic
1168176245 19:54630019-54630041 CCAGACCAGGGTAAGACCTGAGG - Intronic
925242020 2:2339689-2339711 CCATTCCTTTCTAAGAACTGGGG + Intergenic
928883834 2:36126567-36126589 CCATCACTGAATAAGATCTGGGG - Intergenic
929554478 2:42916879-42916901 CTAGCCTTGTGTAAGATCTGTGG + Intergenic
934564226 2:95329604-95329626 CCAGCACTGTGTGAGACCAGCGG - Intronic
937100015 2:119261428-119261450 CCATCCCTGTGTAATAGACGTGG + Intronic
937254871 2:120547959-120547981 CCCTCCCTGCGTAAGCCCTAAGG - Intergenic
937936288 2:127248201-127248223 CCATACATGTGCAAGACTTGAGG - Intergenic
942215666 2:173716928-173716950 CAGTGCCTGAGTAAGACCTGGGG - Intergenic
948678213 2:239611596-239611618 CCAGCCCTGAGGAAAACCTGGGG + Intergenic
948777385 2:240296795-240296817 CCATCCCTGTGTCAGTGCAGAGG + Intergenic
1174463888 20:50702392-50702414 CCATCCCTGAGAAACATCTGCGG + Intergenic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1182092686 22:27606790-27606812 CCAGCCCTTGGAAAGACCTGAGG + Intergenic
1184098365 22:42328824-42328846 CCTTCCCTGGCTAAGACCTGGGG - Intronic
949435476 3:4024603-4024625 CAATAGCTGTGTGAGACCTGTGG - Intronic
953705459 3:45226578-45226600 CCATCCTTTTGTCAGGCCTGAGG + Intergenic
954063336 3:48087631-48087653 CCATCCCTGGGAAAGAGCAGAGG + Intronic
955880606 3:63540626-63540648 CCAACTCTGTGTATGTCCTGAGG - Intronic
957344166 3:78940770-78940792 CCACCCTTCTGTAAGATCTGTGG + Intronic
959777176 3:110180620-110180642 CCATCACTTTGTAATAACTGCGG + Intergenic
960421491 3:117451374-117451396 CAATCTCTGGTTAAGACCTGAGG - Intergenic
963086916 3:141445497-141445519 CCATACCAGTGCAAGACCTGCGG + Exonic
964620853 3:158718761-158718783 GCATCCCTGGGCAAGACCAGAGG - Intronic
966021175 3:175212986-175213008 CCAGTCCTGTGTATCACCTGAGG - Intronic
966250808 3:177863396-177863418 CCTTCCCTGTGTAGGCTCTGGGG + Intergenic
972423900 4:38914850-38914872 CGTTTCCTGTGTAAGACATGGGG - Intronic
973175816 4:47203660-47203682 CCATCCCTGTGTCACAAATGAGG - Intronic
975442478 4:74427553-74427575 TCATCCCTGTGTAACAAATGAGG - Intergenic
985674828 5:1225610-1225632 CCATACCTGTGCCAGACCTATGG + Exonic
986012147 5:3725896-3725918 CACTCCCTGTGTAAGAATTGGGG - Intergenic
986733565 5:10652342-10652364 CAATCACTGTGTTAGAGCTGCGG - Intergenic
988404549 5:30807322-30807344 CCATCCCTGTGTAAACCTTCAGG + Intergenic
990522375 5:56592524-56592546 CCTTCCATGTGTCAGACATGAGG - Intronic
1003106124 6:3217376-3217398 CCATCCCTGAATCAGTCCTGTGG - Intergenic
1007972215 6:46063685-46063707 CCAGCCCTGTGTAAGATCCTGGG - Intronic
1013191788 6:107809963-107809985 CGATCCCTCTGAAAAACCTGTGG + Intronic
1013698250 6:112730140-112730162 CCATACCTGTGTAATCTCTGGGG - Intergenic
1019411979 7:910757-910779 CCCTCCCTGTGGAAGGCCAGAGG - Intronic
1022023427 7:26423375-26423397 ACATACCTGTGTAGGAACTGAGG - Intergenic
1023806348 7:43875584-43875606 CCATCCAGGTGTAAGCTCTGGGG + Intronic
1025105606 7:56169647-56169669 CCTGCCCTATGTGAGACCTGTGG - Intergenic
1026314696 7:69218153-69218175 CCTGCCCTATGTGAGACCTGCGG - Intergenic
1027231759 7:76276754-76276776 CCATCCCTCTGGAAGTCCTCAGG - Intronic
1027579865 7:79978843-79978865 CAATTCCTGTATAAGACCTGAGG - Intergenic
1029202142 7:98846293-98846315 GCATCCCTGTCTGAGACCTCAGG - Intergenic
1029442688 7:100595855-100595877 CCAACCCTGGGTAAGACATGGGG - Intronic
1030209223 7:106979931-106979953 CCAGCCCTGTGTTAGTCCTTGGG + Intergenic
1030214043 7:107025140-107025162 CCATCTCTGTGTAACACCAAGGG + Intergenic
1031992480 7:128207324-128207346 CCATCCCTGGTTGAGACCTTGGG - Intergenic
1032470418 7:132174610-132174632 CCATCCCTCTGGAAGAGGTGGGG - Intronic
1034126458 7:148675904-148675926 CCACCCCTGTCTGAGGCCTGTGG - Intergenic
1034882578 7:154773833-154773855 CCATCCCCGAGCTAGACCTGAGG - Intronic
1040954537 8:52966091-52966113 CCATTTCTGAGTAAAACCTGGGG - Intergenic
1042316238 8:67429136-67429158 CAGTACCTGTGTAAGATCTGTGG - Intronic
1043166244 8:76906409-76906431 CCACCCCTGTGGACAACCTGTGG - Intergenic
1047019790 8:120762692-120762714 CCATACCTCTGTAAAACCTAAGG + Intronic
1049043331 8:140129350-140129372 ACATCCGTGTGTGAGACCTCAGG + Intronic
1049654571 8:143791983-143792005 CCACCCCTGTGGAAGGTCTGTGG - Exonic
1051848865 9:21485773-21485795 CCAGCCCTGTGTTAGCACTGGGG + Intergenic
1053456043 9:38233773-38233795 CCATCTCTGTGTATGACCCTGGG + Intergenic
1056939155 9:90940474-90940496 CCAGCCCTGTGGGTGACCTGGGG + Intergenic
1058079555 9:100687700-100687722 CCATCCCTGGGCTAGACCAGTGG - Intergenic
1060182528 9:121544402-121544424 GCATCCCTTTGAAAGGCCTGTGG + Intergenic
1060522456 9:124301407-124301429 CCTTCCCTGTGTCACACGTGTGG + Intronic
1061048969 9:128182984-128183006 CCATTCCTGTCCAAGACCTCAGG + Intronic
1061073858 9:128328791-128328813 CCCTCCCTGTGTAGCACTTGAGG - Intronic
1062338332 9:136082275-136082297 CCAAGCCTGTGTGGGACCTGAGG - Intronic
1062622990 9:137430971-137430993 CCATCCCTGTGTAAGACCTGGGG + Intronic
1189561897 X:42199611-42199633 CCATGCCTGAGGAAGAGCTGAGG + Intergenic
1190703389 X:53005150-53005172 CCATCCCTTTGTGAGTTCTGGGG - Intergenic
1192356333 X:70407553-70407575 CCATCTTTGTGTAGAACCTGGGG + Intronic
1192386152 X:70672924-70672946 CCAACCCTGATTTAGACCTGTGG - Intronic
1193574339 X:83181199-83181221 CCATCCATCTGTAATTCCTGGGG + Intergenic