ID: 1062623158

View in Genome Browser
Species Human (GRCh38)
Location 9:137431606-137431628
Sequence GCCAAACTGAGGTGGTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 134}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623158_1062623166 2 Left 1062623158 9:137431606-137431628 CCCCAGGACCACCTCAGTTTGGC 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1062623166 9:137431631-137431653 TTGCCCCTCCCCTCCCACTGGGG No data
1062623158_1062623175 16 Left 1062623158 9:137431606-137431628 CCCCAGGACCACCTCAGTTTGGC 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1062623175 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG No data
1062623158_1062623165 1 Left 1062623158 9:137431606-137431628 CCCCAGGACCACCTCAGTTTGGC 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1062623165 9:137431630-137431652 ATTGCCCCTCCCCTCCCACTGGG No data
1062623158_1062623176 30 Left 1062623158 9:137431606-137431628 CCCCAGGACCACCTCAGTTTGGC 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1062623176 9:137431659-137431681 GTGACCAGGAGTGACCCAGCTGG No data
1062623158_1062623164 0 Left 1062623158 9:137431606-137431628 CCCCAGGACCACCTCAGTTTGGC 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1062623164 9:137431629-137431651 CATTGCCCCTCCCCTCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623158 Original CRISPR GCCAAACTGAGGTGGTCCTG GGG (reversed) Intronic
903292177 1:22321230-22321252 GCCAAACTGTGTTGCTTCTGAGG - Intergenic
904649589 1:31994764-31994786 GCCACAGTGAGATGGTCATGAGG + Intergenic
907847901 1:58226199-58226221 GCCACACTGAGCTGGGTCTGAGG - Intronic
909848285 1:80426395-80426417 GCCACACAGAGGTTGTCCTTGGG - Intergenic
913469442 1:119174340-119174362 GGCAAGCTGAGGTCCTCCTGTGG - Intergenic
924740043 1:246789715-246789737 CCCAAAATCAGGCGGTCCTGGGG + Intergenic
1066452454 10:35543185-35543207 TCAAACCTGAGGTGGTCTTGGGG - Intronic
1068216918 10:53992872-53992894 GCAAAACTGAAGTGCTCCAGAGG - Intronic
1068920314 10:62476276-62476298 ATCAAACTTAGGTGGTTCTGAGG - Intronic
1072662017 10:97369065-97369087 GGCAAGATGAGGGGGTCCTGTGG + Intronic
1072822788 10:98574712-98574734 GGACAACTGAGGTTGTCCTGTGG - Intronic
1073662136 10:105488310-105488332 GCCAACCTGAGGTCATCTTGAGG + Intergenic
1073736176 10:106349457-106349479 GGCAAACTGAGGTTTTCATGGGG + Intergenic
1074356660 10:112791725-112791747 CCCAAAGTGAGGGGGTGCTGTGG - Intronic
1079364540 11:19797820-19797842 GCCCTCCTCAGGTGGTCCTGAGG + Intronic
1080385185 11:31806520-31806542 TCCCAACCGAGGTGGACCTGGGG + Intronic
1081567849 11:44270763-44270785 CCCAGGCTGGGGTGGTCCTGAGG - Intronic
1085416823 11:76324033-76324055 GGAAAACTGAGGTGGTCCCATGG - Intergenic
1089769190 11:120790633-120790655 GCCAGACTGTGGAGGGCCTGAGG + Intronic
1089867831 11:121647554-121647576 GCCAGACTGAAGTAGTCCTTTGG + Intergenic
1090734189 11:129597100-129597122 GCCAGACAGAGCTGGTCCTAAGG - Intergenic
1091312881 11:134586941-134586963 GCCATAGTGTGGGGGTCCTGCGG + Intergenic
1092887706 12:12939588-12939610 GCCCAATTGTGGTGATCCTGAGG + Intergenic
1094058299 12:26287924-26287946 GCCAAGCTGAGGCCGTCCTGGGG + Intronic
1095209654 12:39477353-39477375 ACCAGACTCAGGAGGTCCTGAGG - Intergenic
1100193327 12:92216594-92216616 GCCAAAACAAGGTGGTACTGGGG - Intergenic
1100929823 12:99594201-99594223 ATAAAACTGAAGTGGTCCTGAGG + Intronic
1106652766 13:31709518-31709540 GCCAAACGGAGGAAGTGCTGTGG + Intergenic
1106738666 13:32615068-32615090 GCACAACGGAGGTGGTTCTGTGG - Intronic
1107317955 13:39154010-39154032 CCCAAACTGAGGTGGTTTTGAGG - Intergenic
1108315788 13:49235894-49235916 GCATAACTCAGCTGGTCCTGTGG - Intergenic
1108423563 13:50274960-50274982 GCAATACTGATGTGGTCCAGTGG - Intronic
1111808317 13:93066032-93066054 GCAAAACTGAGGTTTCCCTGAGG - Intergenic
1113756888 13:112818586-112818608 GCCCACCTGAGGTGGGCATGAGG - Intronic
1114224038 14:20722629-20722651 GCCACACTGAGGTCCTCGTGGGG + Intergenic
1116100283 14:40425072-40425094 GCAAAACTGAGGTTTTCCTCAGG + Intergenic
1117306938 14:54487021-54487043 GACAAACTGAGGTGGCTTTGAGG + Intronic
1118918935 14:70132459-70132481 GCCAAACTGAGATAGTGCTGAGG + Intronic
1119483828 14:74975674-74975696 GCCAAGCACAGGTTGTCCTGAGG - Intergenic
1121811660 14:96896541-96896563 GGCACACAGAGGTGGTCATGGGG + Intronic
1122995708 14:105262662-105262684 GCCACACTGAGGTGGTCTCACGG + Intronic
1123001042 14:105294230-105294252 AACCAACTGTGGTGGTCCTGGGG - Intronic
1125363581 15:38889950-38889972 GTCAAACAGAGGTGGACCTACGG - Intergenic
1126140489 15:45433992-45434014 GCCATACTGTGATGTTCCTGTGG + Intronic
1128773290 15:70300083-70300105 GCAAAATTGAGGTTTTCCTGAGG - Intergenic
1135503219 16:23014926-23014948 GCAAAACTTGGGTGGTGCTGTGG - Intergenic
1136382329 16:29901352-29901374 GCCAAGCCCAGGGGGTCCTGGGG + Exonic
1137842741 16:51654826-51654848 GCAAAACTGAGGTTTCCCTGAGG + Intergenic
1138922481 16:61548840-61548862 GCCATACTGAGCTGGTGCAGTGG - Intergenic
1143146106 17:4776909-4776931 ACCAAACTGAGCTGGGCGTGGGG + Intronic
1146612828 17:34322845-34322867 GTGAAACTGAGGTGAGCCTGAGG - Intergenic
1147232147 17:39027337-39027359 GCCAACCTGAGGAGGTGCCGTGG - Intergenic
1147660945 17:42116805-42116827 GCCACACTTTGGTGGACCTGTGG - Intronic
1151533402 17:74722438-74722460 GCAAAACTGAGGTTTCCCTGAGG - Intronic
1151791043 17:76306269-76306291 GCAAAAGTGAGTTGGTGCTGCGG + Intronic
1152423450 17:80206175-80206197 GGCAAACTCAGCTGGGCCTGGGG + Intronic
1152586411 17:81191393-81191415 GCCAGCCTCAGGGGGTCCTGGGG + Intronic
1155623526 18:27808389-27808411 GCTACACTGAGGTGTTCCTTAGG - Intergenic
1157335835 18:46736832-46736854 GCCACACTGTGGGGGTTCTGGGG - Intronic
1158799624 18:60890856-60890878 GCAAAACTGAGGTTTCCCTGAGG - Intergenic
1160463831 18:79059249-79059271 TCAAGCCTGAGGTGGTCCTGGGG - Intergenic
1160543337 18:79637701-79637723 GCCTCACTGGGGTGGGCCTGAGG - Intergenic
1161557565 19:4952839-4952861 GCCAAACTCTGGTGATTCTGAGG - Intronic
1164408552 19:27976942-27976964 TCCAAACTGTGGTGGTTATGAGG + Intergenic
1164828526 19:31302097-31302119 GCCACATTAAGGTGGTGCTGGGG - Intronic
1165485013 19:36090276-36090298 CTCAAGCTGAGGTTGTCCTGGGG - Intronic
1166223848 19:41382835-41382857 GCCAAGCCGAGGTGGTCGTGGGG - Exonic
1166385643 19:42379048-42379070 GCCAAACTGGGGTTTCCCTGAGG - Intergenic
1166505035 19:43365658-43365680 GCCCACTTCAGGTGGTCCTGAGG - Intergenic
1166505504 19:43369256-43369278 GCCCACTTCAGGTGGTCCTGAGG + Intergenic
1167768217 19:51498176-51498198 GCCAGGCTGAGCTGGACCTGGGG - Exonic
1167769448 19:51505248-51505270 GCCAGGCTGAGCTGGACCTGGGG - Intergenic
924969104 2:108307-108329 GCCATAGTGAAGTTGTCCTGGGG + Intergenic
925658742 2:6180083-6180105 GCCAAAGTGAGGAGGTGCTGGGG + Intergenic
927398732 2:22686235-22686257 GCAAAACTGAGGTTTACCTGAGG + Intergenic
932720093 2:74132350-74132372 GCCAAACAGAGGCCGTCCTGGGG + Intronic
937064601 2:119008106-119008128 GCCAAATCCAGCTGGTCCTGTGG - Intergenic
940242137 2:151574869-151574891 GGCAAAGTGAGGTGCACCTGTGG - Intronic
942935377 2:181550064-181550086 GCCAAAATGAGGTGCCTCTGGGG + Intronic
946215683 2:218181771-218181793 GCCAAACTGGGGATGTCCGGTGG + Intergenic
1171517716 20:25750879-25750901 GCCAGACCGGGGTGCTCCTGGGG + Intergenic
1175551277 20:59819602-59819624 GGCAACCTGAGCTGGACCTGTGG - Intronic
1177577936 21:22982800-22982822 GACATACTGTGGTGGTTCTGGGG - Intergenic
1178398063 21:32259980-32260002 CCCAAACTGCAGTGGTGCTGTGG - Intergenic
1180127679 21:45803407-45803429 TGCACACTGGGGTGGTCCTGAGG + Intronic
1180869393 22:19137843-19137865 GTGAAACTCAGGTGGTCTTGTGG - Intronic
1183168459 22:36165940-36165962 GCTAAACTTAGGTGGGCCAGGGG - Intronic
1184246061 22:43236293-43236315 GGCTCCCTGAGGTGGTCCTGTGG + Intronic
1185137655 22:49081710-49081732 TGCAAACTGAGGTGGGGCTGAGG - Intergenic
956739233 3:72262054-72262076 GCCAAGCTGAGCGGGTCATGTGG + Intergenic
961754989 3:129122036-129122058 GGCGGGCTGAGGTGGTCCTGTGG - Intronic
964635209 3:158850857-158850879 ACCAAATTCAAGTGGTCCTGTGG - Intergenic
965272689 3:166638714-166638736 GTGAAGCTGAGGTGGTGCTGTGG + Intergenic
971495388 4:27258828-27258850 GCCAAACTGGGGTGTTCATGAGG - Intergenic
977140853 4:93369984-93370006 GCCAAACTGGGGAGATCTTGAGG - Intronic
980448682 4:132943832-132943854 TCCAAGCTGAGGTGGTCAGGTGG - Intergenic
980735221 4:136876571-136876593 GATAAACTGAAGTGGCCCTGGGG + Intergenic
981977450 4:150748030-150748052 GACAAACTGAGGTAGTGATGGGG - Intronic
983939139 4:173523188-173523210 GCCAAGCAGAGATGGTCTTGAGG - Intergenic
990313871 5:54566090-54566112 ACCAAACTCAGGTGGTCCAATGG + Intergenic
990382602 5:55231905-55231927 GTCATACTGGGGTGGGCCTGGGG - Intronic
991132628 5:63141952-63141974 GCAGAACTGAGGTTTTCCTGGGG + Intergenic
992995781 5:82331331-82331353 GCCCAAATGTCGTGGTCCTGAGG + Intronic
994213790 5:97114404-97114426 GCCAAAATGAGTTAGTCTTGGGG - Intronic
997226896 5:132215580-132215602 GCCAGACTGGGTTGGGCCTGGGG - Intronic
997231408 5:132246272-132246294 GCTATACAGAGGTGCTCCTGAGG + Intronic
999538521 5:152546292-152546314 GCAAAACAGAGGTGGTCCCAGGG - Intergenic
1001308933 5:170596802-170596824 GCCAAATGGAGGTTGTCCAGGGG + Intronic
1001311780 5:170616318-170616340 GGCACACTGAGGTGGGCCTTGGG + Intronic
1002457084 5:179351314-179351336 GCCCAACGGGGCTGGTCCTGTGG - Intergenic
1006424732 6:33956877-33956899 ACCAACCTGTGGCGGTCCTGAGG + Intergenic
1006644949 6:35509584-35509606 GACATCTTGAGGTGGTCCTGGGG - Intronic
1006905926 6:37533554-37533576 GCCAGACTCAGGTGGGGCTGGGG + Intergenic
1007765878 6:44159415-44159437 GCAGAACTGAGTTGTTCCTGTGG + Intronic
1008707690 6:54182534-54182556 GCTAAAATGTGGTGTTCCTGCGG + Intronic
1015044546 6:128761943-128761965 GCCCAACCAAGGTGCTCCTGAGG + Intergenic
1018432476 6:163733394-163733416 GTCATGCTGAGGTGGTCCAGAGG - Intergenic
1018698042 6:166405879-166405901 GTCAAGCTGAGGTGGTGATGGGG + Intergenic
1021036934 7:15810663-15810685 TCCAGACTGAGGTGGAGCTGAGG - Intergenic
1022679236 7:32528327-32528349 GACAACCTCAGGAGGTCCTGAGG - Intronic
1024422108 7:49180480-49180502 CCCAAATTAAGGTGGTTCTGAGG - Intergenic
1028732555 7:94168700-94168722 CCCAAAATGAGAGGGTCCTGTGG - Intergenic
1029102961 7:98149150-98149172 ACCTAACTGGGGTTGTCCTGAGG - Intronic
1032681734 7:134191666-134191688 TCCAAAGTAAGGTGGTCTTGTGG - Exonic
1034672753 7:152870552-152870574 TCAGAAGTGAGGTGGTCCTGAGG + Intergenic
1035007441 7:155677082-155677104 GCCAAACTGAGGTTTGTCTGTGG + Intronic
1035177009 7:157058731-157058753 GCCAAAGTGAGTTGATCCTCCGG - Intergenic
1039507411 8:38061859-38061881 GCCAAGCTCAGATGGTCTTGGGG + Intergenic
1048262570 8:132957436-132957458 CCCAAACTGATGTGCACCTGCGG + Intronic
1049125162 8:140779931-140779953 TCCAACCTGGGGTGGTCATGGGG + Intronic
1053274331 9:36771781-36771803 GACTCACTGAGGTGCTCCTGTGG + Intergenic
1053289619 9:36871367-36871389 CCCAAAGTGAGGGTGTCCTGAGG - Intronic
1060356808 9:122915784-122915806 TCCAAACTGAAGTGGCTCTGAGG - Exonic
1061225129 9:129276914-129276936 GCCCAACTTTGGTGGGCCTGGGG - Intergenic
1062623158 9:137431606-137431628 GCCAAACTGAGGTGGTCCTGGGG - Intronic
1187276471 X:17820368-17820390 GCTCAACTGAGGGGGCCCTGTGG + Intronic
1189269281 X:39739529-39739551 GCCAAAATGCTGTGGTCCTTAGG - Intergenic
1189338363 X:40185429-40185451 GCCAAAGAGAGGTGGTTGTGAGG - Intergenic
1190919734 X:54840461-54840483 GCCAGACTGTGGTGGTCCCCAGG + Intergenic
1195156165 X:102126133-102126155 GCAAAAATGAGGTGGCGCTGGGG + Intronic
1198257045 X:134932886-134932908 GCCAAACTGTGGTGCTGGTGTGG - Intergenic
1201575115 Y:15455027-15455049 GCAAAACTGAGGCGGTGTTGGGG + Intergenic