ID: 1062623159

View in Genome Browser
Species Human (GRCh38)
Location 9:137431607-137431629
Sequence GGCCAAACTGAGGTGGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 124}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623159_1062623164 -1 Left 1062623159 9:137431607-137431629 CCCAGGACCACCTCAGTTTGGCC 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1062623164 9:137431629-137431651 CATTGCCCCTCCCCTCCCACTGG No data
1062623159_1062623176 29 Left 1062623159 9:137431607-137431629 CCCAGGACCACCTCAGTTTGGCC 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1062623176 9:137431659-137431681 GTGACCAGGAGTGACCCAGCTGG No data
1062623159_1062623175 15 Left 1062623159 9:137431607-137431629 CCCAGGACCACCTCAGTTTGGCC 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1062623175 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG No data
1062623159_1062623177 30 Left 1062623159 9:137431607-137431629 CCCAGGACCACCTCAGTTTGGCC 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623159_1062623166 1 Left 1062623159 9:137431607-137431629 CCCAGGACCACCTCAGTTTGGCC 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1062623166 9:137431631-137431653 TTGCCCCTCCCCTCCCACTGGGG No data
1062623159_1062623165 0 Left 1062623159 9:137431607-137431629 CCCAGGACCACCTCAGTTTGGCC 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1062623165 9:137431630-137431652 ATTGCCCCTCCCCTCCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623159 Original CRISPR GGCCAAACTGAGGTGGTCCT GGG (reversed) Intronic
900129132 1:1080236-1080258 GGACACACTGAGCTGGGCCTAGG - Intergenic
900431212 1:2604059-2604081 GGCCAAGGTGAGGGGGTGCTGGG - Intronic
904515722 1:31053389-31053411 GGCCAAACTGAGGTCTTCGGAGG - Intronic
905274257 1:36806917-36806939 GGCAAAGCTGAGTGGGTCCTGGG + Intronic
906944766 1:50286329-50286351 CACCAGAGTGAGGTGGTCCTGGG - Intergenic
907577245 1:55537987-55538009 GGGTCAGCTGAGGTGGTCCTTGG + Intergenic
909848286 1:80426396-80426418 GGCCACACAGAGGTTGTCCTTGG - Intergenic
910327450 1:86026887-86026909 GTCCAAGCTGAGGTGGTCTCAGG + Intronic
912975251 1:114323876-114323898 GGCCAGACTTACGTGGTCATGGG + Intergenic
915102477 1:153510372-153510394 GGCAAAATTGAGGAGGGCCTTGG + Intergenic
915218487 1:154355682-154355704 GGCCAAACTCAGGCTGTGCTAGG - Intergenic
1064464725 10:15567712-15567734 GGCCCAACTGAGGTCAGCCTAGG - Intronic
1066292495 10:34027067-34027089 GGCAAAAATGAGGTGGCCCTGGG - Intergenic
1072435608 10:95412501-95412523 GGCCAAACTGAGGTCCTTCTGGG + Intronic
1074039639 10:109775470-109775492 GGCCAGATTGAGATGGCCCTGGG + Intergenic
1075617026 10:123897575-123897597 GGGCACACTGGGGTGGTCATGGG + Intronic
1076135669 10:128044379-128044401 GGCAGAACTGAGGTAGTCCCTGG + Intronic
1077366508 11:2163435-2163457 GGCCACACTGAGGTTCCCCTTGG + Intergenic
1080120586 11:28672865-28672887 ATTCAAACTTAGGTGGTCCTAGG + Intergenic
1082260138 11:50072109-50072131 GGCCAACTTGAGGAGGTTCTGGG + Intergenic
1082260657 11:50074359-50074381 GGCCGACTTGAGGTGGTTCTGGG + Intergenic
1084406841 11:68979185-68979207 GGGCAAAGTGAGGGGGCCCTGGG + Intergenic
1084447609 11:69212868-69212890 GGGCAAACTTGAGTGGTCCTCGG - Intergenic
1085042528 11:73334925-73334947 GGCTGAACGGTGGTGGTCCTGGG + Intronic
1085635317 11:78154697-78154719 GACCAAACTGAAGTCTTCCTTGG - Intergenic
1086983462 11:93223771-93223793 GTATAAACTGAGGTGGTCCTGGG + Intergenic
1089467701 11:118696114-118696136 GGTCAAAGTCAGGTGGTCCCAGG - Intergenic
1090842687 11:130506677-130506699 GTCCAGGCTGAGGTGGTCTTAGG + Intergenic
1091428815 12:414800-414822 GGCCAAAGTGAGGTGGGTGTGGG - Intronic
1091600971 12:1917549-1917571 GCCCTAGCTCAGGTGGTCCTAGG - Intronic
1091974770 12:4815501-4815523 GGAGAACCTGAGGTGGTCCAGGG - Intronic
1094058298 12:26287923-26287945 TGCCAAGCTGAGGCCGTCCTGGG + Intronic
1095042277 12:37455864-37455886 GGGGAAGCTGAGGTGGTCCGAGG + Intergenic
1096361106 12:50988035-50988057 GGATAAACTGAGCTGGCCCTTGG + Exonic
1115915823 14:38312868-38312890 GGAGAAAGTGAGGGGGTCCTGGG - Intergenic
1119874862 14:78050126-78050148 GTCCAATCTGTGGTGGTCTTGGG + Intergenic
1123127948 14:105962894-105962916 GTCCAAGCTGAGCTGGTCTTAGG + Intergenic
1132677760 16:1127682-1127704 GGGCAAAACGAGGGGGTCCTGGG - Intergenic
1133282315 16:4673708-4673730 GGCCACACCACGGTGGTCCTGGG + Intronic
1133921457 16:10156985-10157007 GGGCAGACTGAGGTGATTCTTGG + Intronic
1135588877 16:23691274-23691296 GGCCATACTCAGGTGGGCCTGGG - Intronic
1136382328 16:29901351-29901373 GGCCAAGCCCAGGGGGTCCTGGG + Exonic
1141949193 16:87329916-87329938 GACCAACCTGAGGATGTCCTGGG - Exonic
1142034248 16:87853995-87854017 TGCCACACTGACGTGGTGCTGGG + Intronic
1142156762 16:88535827-88535849 GGCCACACTGAGGGAGTACTTGG + Exonic
1143018377 17:3903864-3903886 GGCCAGACAGAGGGGGGCCTAGG - Intronic
1143146105 17:4776908-4776930 GACCAAACTGAGCTGGGCGTGGG + Intronic
1143635441 17:8161800-8161822 GCCCTCACTGAGGTGGGCCTTGG - Intronic
1149734517 17:58980040-58980062 GGCCAGAATGAGGTAGTCTTCGG - Exonic
1150220935 17:63495549-63495571 GGCCTATCTGAGGTGCTCCAGGG - Intronic
1152586410 17:81191392-81191414 GGCCAGCCTCAGGGGGTCCTGGG + Intronic
1152593844 17:81228786-81228808 GGGGAAACTGAGGTAGCCCTAGG + Exonic
1155041045 18:22065896-22065918 CCCCAAACTGAGGTGGTCCCTGG + Intergenic
1155384365 18:25261132-25261154 GGCCAAACTGAGGAGGACTCTGG - Intronic
1160944112 19:1633243-1633265 GGCCAAGCTGAGGAGGCCCAGGG - Intronic
1160974222 19:1784803-1784825 TGCCAAGGTGAGGTGGGCCTGGG - Exonic
1163366331 19:16877956-16877978 GCCCGACCTGAGGTGGTCCAGGG - Intronic
1163768799 19:19178437-19178459 GGCCAGACTAAGGTGGAGCTTGG + Intronic
1165061143 19:33205786-33205808 GGCCACAGTGAGGCGGCCCTGGG - Exonic
1165490305 19:36119519-36119541 GGCCTGACTCAGGTGGTCCCAGG - Intronic
1166223849 19:41382836-41382858 AGCCAAGCCGAGGTGGTCGTGGG - Exonic
925658741 2:6180082-6180104 TGCCAAAGTGAGGAGGTGCTGGG + Intergenic
926051052 2:9745039-9745061 GGCCCCACTGAGGTGGCCCAGGG - Intergenic
932720092 2:74132349-74132371 AGCCAAACAGAGGCCGTCCTGGG + Intronic
933947285 2:87297565-87297587 GTCCAGACTGAGGTGGTCTCAGG - Intergenic
934150813 2:89145968-89145990 CGCCAAACTGAGTTGCTCCATGG + Intergenic
934216464 2:90036057-90036079 CGCCAAACTGAGTTGCTCCATGG - Intergenic
934907523 2:98218194-98218216 GCCCTAGCTCAGGTGGTCCTTGG - Intronic
940763450 2:157764017-157764039 GGACAAATTGAGGTGGCTCTTGG - Intronic
943805639 2:192121493-192121515 GGCTAAACTGGAGTGGTCTTTGG + Intronic
1169311873 20:4549514-4549536 GGCCAAATTGTGGAGGTGCTGGG - Intergenic
1170681883 20:18533351-18533373 GGCCTCTCTAAGGTGGTCCTGGG + Intronic
1171310335 20:24140249-24140271 GGCCCAAAGGATGTGGTCCTTGG + Intergenic
1177264197 21:18762944-18762966 GGACACATTGAGGTGGTGCTGGG + Intergenic
1183168460 22:36165941-36165963 GGCTAAACTTAGGTGGGCCAGGG - Intronic
1184712600 22:46262092-46262114 GGCCAATCTGAAATGGCCCTGGG - Exonic
1184776803 22:46627451-46627473 GGCCTAGCTGAGGTGCTCCGTGG - Intronic
957471754 3:80667882-80667904 GTCCAAGCTGAGGTGGTCTCAGG + Intergenic
961737386 3:129010649-129010671 GGCCAAACTCAGCGGGTCCAGGG + Intronic
963729031 3:148953249-148953271 AGCCAAACAGAGGTGGGCCCTGG - Intergenic
966551976 3:181215502-181215524 GGCACAACAGAGGTGGCCCTGGG - Intergenic
966897463 3:184456528-184456550 GACCAAACTGGGCTGTTCCTTGG - Intronic
968646550 4:1744025-1744047 GCCCTAACTGAGGGGTTCCTGGG - Intronic
974981646 4:68964892-68964914 GGCCACACTGAGAAGGTCCCTGG + Intergenic
980201378 4:129659491-129659513 GGTCCAAATGAGGTGGTCCCAGG - Intergenic
981977451 4:150748031-150748053 GGACAAACTGAGGTAGTGATGGG - Intronic
983454988 4:167952584-167952606 GGCCAGTCTGAGGTGGTCTCAGG + Intergenic
988668999 5:33360940-33360962 GTCCAGGCTGAGGTGGTCCCAGG - Intergenic
991477903 5:67043103-67043125 GGTCAAAAAGAAGTGGTCCTTGG + Intronic
992532491 5:77665734-77665756 GGCAAGAGTGAGGTGGCCCTTGG - Intergenic
994213791 5:97114405-97114427 GGCCAAAATGAGTTAGTCTTGGG - Intronic
995085567 5:108105243-108105265 GGCGCAACTGAAGTGGACCTTGG + Intronic
997226897 5:132215581-132215603 GGCCAGACTGGGTTGGGCCTGGG - Intronic
997729523 5:136157296-136157318 GGGCCAACCTAGGTGGTCCTAGG + Intronic
998417084 5:141953886-141953908 GGCCAAACAGAAGTGTGCCTTGG + Intronic
999538522 5:152546293-152546315 GGCAAAACAGAGGTGGTCCCAGG - Intergenic
1000019669 5:157308331-157308353 GGGCAAGCTGAGGTGGTCCCTGG - Intronic
1000607685 5:163342110-163342132 GGTAAAACTGAGATGATCCTGGG - Intergenic
1001311779 5:170616317-170616339 AGGCACACTGAGGTGGGCCTTGG + Intronic
1005643293 6:27817080-27817102 GGCCAAACAGACTTTGTCCTAGG - Intergenic
1006205076 6:32333559-32333581 GGCCAAACAGAATAGGTCCTAGG + Intronic
1012418758 6:99038462-99038484 GGCCAAACTGAGTTGGTAGCTGG + Intergenic
1012967059 6:105686473-105686495 GTCCAGACTGAGGTGGTCTCAGG + Intergenic
1013634594 6:112017122-112017144 GGTAAAACTGAGATGGTCTTGGG - Intergenic
1013695734 6:112700723-112700745 AACCAAACAGACGTGGTCCTTGG + Intergenic
1018698041 6:166405878-166405900 GGTCAAGCTGAGGTGGTGATGGG + Intergenic
1019756800 7:2776668-2776690 GGCCAAGCTGAGGTGATGCAAGG - Intronic
1023033468 7:36110325-36110347 GGCCAAAGTAAGGTGGCCCCAGG - Intergenic
1023400883 7:39792559-39792581 GGCCAACTTGAGGAGGTTCTGGG - Intergenic
1024648750 7:51388218-51388240 GGCCAACTTGAGGAGGTTCTGGG + Intergenic
1026211773 7:68312299-68312321 GGGTAAAATGAGGTGGTACTTGG + Intergenic
1028622772 7:92843415-92843437 GGACATAATGGGGTGGTCCTTGG - Intergenic
1031588913 7:123566225-123566247 GGGCAATCTTTGGTGGTCCTTGG - Intergenic
1035883198 8:3265649-3265671 GGCCAACATGAGGTCGTGCTAGG + Intronic
1038807138 8:30804665-30804687 GCCAAAACTGAGGCAGTCCTGGG + Intronic
1039062273 8:33581299-33581321 GGCCAAAGTGCGGTGGGGCTGGG + Intergenic
1042196967 8:66238925-66238947 GGCCATTCTGATGTGGTCTTAGG - Intergenic
1048043409 8:130751844-130751866 GTCCAGGCTGAGGTGGTCTTAGG - Intergenic
1049708434 8:144053198-144053220 GGCCATATTCAGGTGGGCCTGGG - Exonic
1053218210 9:36290231-36290253 GCTAAAACTGAGGTAGTCCTGGG - Intronic
1057258579 9:93570141-93570163 GGGCAAACTGAGGCTATCCTGGG - Intergenic
1059427207 9:114228514-114228536 GGCCATTCTGAGGTGGTCTCTGG - Intronic
1061049948 9:128189354-128189376 GGCCACATGGATGTGGTCCTGGG - Intronic
1062182304 9:135196914-135196936 GACCAAACAGAGGGAGTCCTTGG + Intergenic
1062623159 9:137431607-137431629 GGCCAAACTGAGGTGGTCCTGGG - Intronic
1186940118 X:14497506-14497528 GTACAAAATGTGGTGGTCCTGGG + Intergenic
1190302494 X:49064863-49064885 AACCAAACTGGGGTGGTCTTGGG + Intronic
1194144455 X:90245496-90245518 GTCCAGACTGAGGTGGTTTTGGG - Intergenic
1198307991 X:135401472-135401494 AGCCAAAGTGATGTGGTCCATGG + Intergenic
1198463448 X:136884360-136884382 GGCCAAAGTGAGCTGGTCTACGG - Intergenic
1200096554 X:153667294-153667316 GGAGACACGGAGGTGGTCCTAGG - Intergenic
1200490214 Y:3814800-3814822 GTCCAGACTGAGGTGGTTTTGGG - Intergenic
1202585909 Y:26426885-26426907 CACCAAACAGAGGTGGTCTTGGG - Intergenic