ID: 1062623160

View in Genome Browser
Species Human (GRCh38)
Location 9:137431608-137431630
Sequence TGGCCAAACTGAGGTGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 2, 1: 0, 2: 0, 3: 13, 4: 128}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623160_1062623178 30 Left 1062623160 9:137431608-137431630 CCAGGACCACCTCAGTTTGGCCA 0: 2
1: 0
2: 0
3: 13
4: 128
Right 1062623178 9:137431661-137431683 GACCAGGAGTGACCCAGCTGGGG No data
1062623160_1062623176 28 Left 1062623160 9:137431608-137431630 CCAGGACCACCTCAGTTTGGCCA 0: 2
1: 0
2: 0
3: 13
4: 128
Right 1062623176 9:137431659-137431681 GTGACCAGGAGTGACCCAGCTGG No data
1062623160_1062623165 -1 Left 1062623160 9:137431608-137431630 CCAGGACCACCTCAGTTTGGCCA 0: 2
1: 0
2: 0
3: 13
4: 128
Right 1062623165 9:137431630-137431652 ATTGCCCCTCCCCTCCCACTGGG No data
1062623160_1062623164 -2 Left 1062623160 9:137431608-137431630 CCAGGACCACCTCAGTTTGGCCA 0: 2
1: 0
2: 0
3: 13
4: 128
Right 1062623164 9:137431629-137431651 CATTGCCCCTCCCCTCCCACTGG No data
1062623160_1062623175 14 Left 1062623160 9:137431608-137431630 CCAGGACCACCTCAGTTTGGCCA 0: 2
1: 0
2: 0
3: 13
4: 128
Right 1062623175 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG No data
1062623160_1062623177 29 Left 1062623160 9:137431608-137431630 CCAGGACCACCTCAGTTTGGCCA 0: 2
1: 0
2: 0
3: 13
4: 128
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623160_1062623166 0 Left 1062623160 9:137431608-137431630 CCAGGACCACCTCAGTTTGGCCA 0: 2
1: 0
2: 0
3: 13
4: 128
Right 1062623166 9:137431631-137431653 TTGCCCCTCCCCTCCCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623160 Original CRISPR TGGCCAAACTGAGGTGGTCC TGG (reversed) Intronic
900431213 1:2604060-2604082 TGGCCAAGGTGAGGGGGTGCTGG - Intronic
904009609 1:27382367-27382389 GGCCCAATCTGAGGTGGTCAAGG - Exonic
905403748 1:37720006-37720028 TGGCCAAACTGAAGTGTCTCGGG + Exonic
905675901 1:39824904-39824926 TGGGCATACTTAGGGGGTCCTGG - Intergenic
908362987 1:63388214-63388236 TGGCCTAAGTGAGGTGATCTTGG + Intronic
914784147 1:150813171-150813193 TGGCCAGCCTGAGGTCTTCCAGG - Exonic
916491898 1:165309371-165309393 TGGCAAAACTGAGGAAGTCCTGG + Intronic
920881194 1:209881950-209881972 TGGACATGCTGAGTTGGTCCTGG - Intergenic
922571268 1:226635872-226635894 TGGCCCCACTGAGGTGATGCAGG - Intronic
923238205 1:232055566-232055588 TGGCCAAACAGAAATGGCCCAGG + Intergenic
923490001 1:234476069-234476091 AAGCCAAACTTAGATGGTCCAGG + Intronic
1063185821 10:3650357-3650379 TGGCCAAATGGAGGTGGTGTAGG + Intergenic
1066292496 10:34027068-34027090 TGGCAAAAATGAGGTGGCCCTGG - Intergenic
1067048676 10:42999976-42999998 TGGCCAGTCTGAGGTGGGCTGGG - Intergenic
1072435607 10:95412500-95412522 AGGCCAAACTGAGGTCCTTCTGG + Intronic
1075617025 10:123897574-123897596 TGGGCACACTGGGGTGGTCATGG + Intronic
1075841465 10:125508355-125508377 TGGCCACACTGTGGTGACCCCGG + Intergenic
1078132247 11:8622508-8622530 TGGCCATGCAGAGGTGGGCCAGG - Intronic
1078573949 11:12483060-12483082 TGGCCACACAGAGGTGAGCCAGG - Intronic
1079521081 11:21327773-21327795 AGTCCATACTGAGGTGGTCTCGG + Intronic
1081504798 11:43704898-43704920 TGGGCAAACTGAGTGGGTCAGGG - Intronic
1083477256 11:62922536-62922558 GGGCCAAACAGAGGCGGTGCAGG - Intergenic
1084406840 11:68979184-68979206 TGGGCAAAGTGAGGGGGCCCTGG + Intergenic
1085535237 11:77213579-77213601 TGGCCTGAATGAGATGGTCCAGG - Intronic
1086983461 11:93223770-93223792 GGTATAAACTGAGGTGGTCCTGG + Intergenic
1088228092 11:107643830-107643852 TGGCAATGCTGAGGTGGACCAGG - Intronic
1091408347 12:222902-222924 TGGCCCACCTGAGGTGGTCTAGG + Intronic
1091428816 12:414801-414823 TGGCCAAAGTGAGGTGGGTGTGG - Intronic
1091974771 12:4815502-4815524 TGGAGAACCTGAGGTGGTCCAGG - Intronic
1092159271 12:6307123-6307145 AGGTCAAACTGCGGAGGTCCTGG + Intergenic
1092675639 12:10915853-10915875 GCTCCAAACTGAGGTGGTTCCGG - Intronic
1092936389 12:13367945-13367967 TGGCCAAATTGTGGGGGTGCAGG + Intergenic
1092979969 12:13784765-13784787 TGTCCCAACTGAGGTTATCCTGG + Intronic
1096925531 12:55140455-55140477 TGGGCAAACTGAGATTTTCCAGG - Intergenic
1097088616 12:56487989-56488011 CGGCCTCACTGAGGTGGTGCCGG + Exonic
1098513382 12:71345581-71345603 TGCCCAAACTGACAAGGTCCAGG - Intronic
1102724073 12:115043265-115043287 TGGCCACAGTGAGGTCGGCCAGG + Intergenic
1103739828 12:123083711-123083733 TGGCCAAATTCTGGTGTTCCAGG - Intronic
1106898736 13:34333066-34333088 TGGCCAAACAAAGGTGCTACAGG + Intergenic
1112016680 13:95337014-95337036 AGGCCAAACTGAGGAGGGCCTGG - Intergenic
1113325749 13:109279530-109279552 TGACCAAACTGAGGTGCACATGG - Intergenic
1114707112 14:24738307-24738329 GGTCCAGGCTGAGGTGGTCCAGG - Intergenic
1119222218 14:72918197-72918219 TGGGAAAACTGAGGCTGTCCTGG + Intergenic
1119874861 14:78050125-78050147 TGTCCAATCTGTGGTGGTCTTGG + Intergenic
1120688147 14:87562967-87562989 GGTCCAAGCTGAGGTGGTCTCGG + Intergenic
1122413271 14:101536742-101536764 TGGGGAAACAGAGGTGGACCAGG + Intergenic
1130774255 15:86961617-86961639 TTGCCAAATGGAGGTGGTCAGGG - Intronic
1132677761 16:1127683-1127705 TGGGCAAAACGAGGGGGTCCTGG - Intergenic
1133282314 16:4673707-4673729 TGGCCACACCACGGTGGTCCTGG + Intronic
1135588878 16:23691275-23691297 AGGCCATACTCAGGTGGGCCTGG - Intronic
1139634319 16:68248717-68248739 TGGCCAAACTTTGGAGGTTCTGG + Intronic
1141173179 16:81703983-81704005 AGGCCAAACTGAGGTTCTCCAGG - Exonic
1142206642 16:88785906-88785928 AGGCCAAACTGACGTGGCCTGGG - Intergenic
1142855910 17:2730224-2730246 TCACCCAACTGAGGTGGTGCAGG + Intergenic
1145101415 17:20080835-20080857 TGGCCATCCTGAGGAGGGCCAGG + Intronic
1148983815 17:51602849-51602871 TGGCCAACCTGGGCTGGCCCAGG - Intergenic
1148988389 17:51644295-51644317 TCAGCAAACTGAGGTGGTGCAGG - Intronic
1150013791 17:61532761-61532783 AGGCCAAACTGTGGTGTTTCAGG - Intergenic
1150220936 17:63495550-63495572 AGGCCTATCTGAGGTGCTCCAGG - Intronic
1150244107 17:63660972-63660994 TGGCCAAAGTGAGGTGGGAGAGG - Intronic
1150583915 17:66500362-66500384 TGGCCAAACTGTGCTGCACCAGG + Intronic
1152748095 17:82050428-82050450 TGGCCTCAATGGGGTGGTCCAGG + Exonic
1152776316 17:82204203-82204225 GAGCCAGGCTGAGGTGGTCCAGG - Intronic
1156370322 18:36467030-36467052 TGTCCAAACTGAGATGGGGCAGG - Intronic
1160944113 19:1633244-1633266 TGGCCAAGCTGAGGAGGCCCAGG - Intronic
1161394378 19:4037541-4037563 TGGGGAAACTGAGGCGGCCCTGG - Intronic
1161440930 19:4291308-4291330 TGGAGAAACTGAGGGGGGCCAGG + Intergenic
1161915240 19:7223452-7223474 TGGGCACACTGTGATGGTCCTGG + Intronic
1163366332 19:16877957-16877979 AGCCCGACCTGAGGTGGTCCAGG - Intronic
1163645717 19:18487977-18487999 TGGCCAGAGTGAGGTGGGGCCGG - Intronic
1166015792 19:39978398-39978420 TGGCCAAAGTCAGGTGGTCAAGG + Intronic
1167483237 19:49745741-49745763 TGGTGAAACTGAGGTGGGCGGGG - Intronic
926051053 2:9745040-9745062 AGGCCCCACTGAGGTGGCCCAGG - Intergenic
938206296 2:129427123-129427145 TGGTCACACTGGGGTGGGCCGGG + Intergenic
943124690 2:183782070-183782092 AGTCCAAGCTGAGGTGGTCTTGG + Intergenic
948859441 2:240745817-240745839 TGCCCAGGCGGAGGTGGTCCAGG + Exonic
1171982705 20:31638689-31638711 TGGCCAGACTGAGCTGGGGCTGG + Intronic
1172743251 20:37185880-37185902 TGGCCAAACTGGGCTCCTCCCGG + Intronic
1175312108 20:58019319-58019341 TGGGCAAAGAGAGGAGGTCCAGG - Intergenic
1179290402 21:40013323-40013345 TTGTTAAACCGAGGTGGTCCAGG - Exonic
1182090260 22:27589979-27590001 AGACCAGACTGAGGTGGCCCAGG + Intergenic
1182457852 22:30463346-30463368 TGGCCAAAGTGAGGGGGTTGGGG - Intronic
1183168461 22:36165942-36165964 GGGCTAAACTTAGGTGGGCCAGG - Intronic
1183432246 22:37772830-37772852 TGGCCTGGCTGGGGTGGTCCAGG - Intronic
954624550 3:52015492-52015514 TGGCCTGACTAAAGTGGTCCTGG - Intergenic
954874536 3:53793034-53793056 TGGCCACACTGGAGTGTTCCTGG - Intronic
955091464 3:55755526-55755548 TGGCCAAATTGGGGTGTTCGGGG - Intronic
956670671 3:71686439-71686461 TGGCCAACCTGAGGTGACCTGGG - Intronic
956765606 3:72481970-72481992 TGGCAGATGTGAGGTGGTCCAGG - Intergenic
961155266 3:124674447-124674469 GAGCCAAGGTGAGGTGGTCCAGG + Intronic
961737385 3:129010648-129010670 GGGCCAAACTCAGCGGGTCCAGG + Intronic
964482327 3:157153527-157153549 TGGCCAAAGTAATGTGCTCCAGG + Intronic
964743497 3:159990195-159990217 TGGCCAAACTGAGGTGGTCCAGG - Exonic
965252471 3:166359959-166359981 TGGGCAAACTGAGGAGGTCTAGG + Intergenic
966712719 3:182986004-182986026 TGGCCAAGCTGGGGTGGGCAGGG - Intergenic
972080077 4:35139568-35139590 TGGACACACTGGGGTGATCCAGG + Intergenic
972180678 4:36461497-36461519 TGGCCAAGCTGAGGTGTTCAGGG - Intergenic
979276927 4:118824656-118824678 TGACCAAACTGATGGGGTCCAGG + Exonic
979373328 4:119915104-119915126 AGTCCAGACTGAGGTGGTCTCGG - Intergenic
985893323 5:2733314-2733336 TGGCAAAACTGGGGTTTTCCAGG + Intergenic
986171461 5:5318063-5318085 TGGGCACACTGAGGTTGACCAGG + Intronic
987744009 5:21947417-21947439 AGTCCAAGCTGAGGTGGTCTTGG + Intronic
987941517 5:24544677-24544699 TGTCCAATCTGGGATGGTCCTGG + Intronic
991764210 5:69957556-69957578 AGTCCAAGCTGAGGTGGTCTTGG + Intergenic
991783116 5:70160591-70160613 AGTCCAAGCTGAGGTGGTCTTGG - Intergenic
991843442 5:70832628-70832650 AGTCCAAGCTGAGGTGGTCTTGG + Intergenic
991875558 5:71160918-71160940 AGTCCAAGCTGAGGTGGTCTTGG - Intergenic
997226898 5:132215582-132215604 TGGCCAGACTGGGTTGGGCCTGG - Intronic
999262627 5:150247125-150247147 TGGCCAAACTGGGCTGGTTAAGG - Intronic
999279011 5:150352543-150352565 TGGCCAAAATGACTTGGCCCAGG + Intergenic
1000215529 5:159152243-159152265 TTGCCAAACTGGGGAGGTCAAGG - Intergenic
1000607686 5:163342111-163342133 TGGTAAAACTGAGATGATCCTGG - Intergenic
1000768254 5:165318691-165318713 TGGCCAAAATGAGGGGGACAAGG + Intergenic
1002449524 5:179310866-179310888 TGGCCAAACTGCAGGGGTCAGGG + Intronic
1006568624 6:34981731-34981753 TGGCCACACAGAGGTGGTGAAGG + Exonic
1006614006 6:35312472-35312494 TGGCCATGCTGAGGGTGTCCCGG - Exonic
1006647261 6:35523192-35523214 TGAAGAAACTGAGGTGGTGCTGG + Intergenic
1006952558 6:37835780-37835802 TGAAAAAACTGAGGTGGTTCCGG - Intronic
1007833500 6:44656390-44656412 TGGAAAGACTGAGATGGTCCCGG - Intergenic
1011452290 6:87506676-87506698 TGGCCGGACTGAGATGGTCAAGG - Intronic
1013634595 6:112017123-112017145 TGGTAAAACTGAGATGGTCTTGG - Intergenic
1013992014 6:116264947-116264969 TGGGGGAACTGAGGTGCTCCCGG + Intronic
1018971854 6:168535724-168535746 TGGCAAAACTGAGGTTGAGCTGG + Intronic
1023102731 7:36735609-36735631 TGGCCAAACTAGGGTGGTCGTGG + Intergenic
1023467633 7:40474622-40474644 TGACCAACCTGAGCTGGTCTGGG - Intronic
1024438495 7:49387774-49387796 TGGCCAAACAAAGGTGCTACAGG + Intergenic
1027789780 7:82624919-82624941 TGGCCAGACTGTGGGGGTCCAGG - Intergenic
1031637634 7:124120469-124120491 TGGCCAAAATGAAGGGCTCCAGG - Intergenic
1038807137 8:30804664-30804686 TGCCAAAACTGAGGCAGTCCTGG + Intronic
1045066777 8:98454454-98454476 CTGCCAAACTGGGGTGGGCCTGG + Intronic
1045124860 8:99078625-99078647 GGGCCAAACTTTGGTTGTCCAGG + Intronic
1046036426 8:108847628-108847650 TGGCCCAACTGAGGAGCTCAAGG - Intergenic
1047538703 8:125743359-125743381 TGGCCACAATGAGGTGCCCCAGG - Intergenic
1048867567 8:138772010-138772032 TGGCTCAGGTGAGGTGGTCCAGG + Intronic
1049527632 8:143136412-143136434 TGGCCAATCTGAGCTCGCCCTGG + Intergenic
1049688363 8:143948255-143948277 TGGGCCAACTGTGCTGGTCCAGG - Intronic
1053218211 9:36290232-36290254 TGCTAAAACTGAGGTAGTCCTGG - Intronic
1054948719 9:70825114-70825136 TGCCCAGACTGAGGGGGCCCAGG + Intronic
1062623160 9:137431608-137431630 TGGCCAAACTGAGGTGGTCCTGG - Intronic
1186473282 X:9837670-9837692 TGGCCAGACTGTGTTGGGCCTGG + Intronic
1188115066 X:26232502-26232524 AGTCCACACTGAGGTGGTCTCGG - Intergenic
1194521568 X:94925003-94925025 TAACCAAACTGATGTGGTGCTGG + Intergenic
1202585910 Y:26426886-26426908 TCACCAAACAGAGGTGGTCTTGG - Intergenic