ID: 1062623161

View in Genome Browser
Species Human (GRCh38)
Location 9:137431614-137431636
Sequence GGGCAATGGCCAAACTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 122}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623161_1062623166 -6 Left 1062623161 9:137431614-137431636 CCACCTCAGTTTGGCCATTGCCC 0: 1
1: 0
2: 1
3: 10
4: 122
Right 1062623166 9:137431631-137431653 TTGCCCCTCCCCTCCCACTGGGG No data
1062623161_1062623176 22 Left 1062623161 9:137431614-137431636 CCACCTCAGTTTGGCCATTGCCC 0: 1
1: 0
2: 1
3: 10
4: 122
Right 1062623176 9:137431659-137431681 GTGACCAGGAGTGACCCAGCTGG No data
1062623161_1062623180 29 Left 1062623161 9:137431614-137431636 CCACCTCAGTTTGGCCATTGCCC 0: 1
1: 0
2: 1
3: 10
4: 122
Right 1062623180 9:137431666-137431688 GGAGTGACCCAGCTGGGGACAGG No data
1062623161_1062623164 -8 Left 1062623161 9:137431614-137431636 CCACCTCAGTTTGGCCATTGCCC 0: 1
1: 0
2: 1
3: 10
4: 122
Right 1062623164 9:137431629-137431651 CATTGCCCCTCCCCTCCCACTGG No data
1062623161_1062623177 23 Left 1062623161 9:137431614-137431636 CCACCTCAGTTTGGCCATTGCCC 0: 1
1: 0
2: 1
3: 10
4: 122
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623161_1062623178 24 Left 1062623161 9:137431614-137431636 CCACCTCAGTTTGGCCATTGCCC 0: 1
1: 0
2: 1
3: 10
4: 122
Right 1062623178 9:137431661-137431683 GACCAGGAGTGACCCAGCTGGGG No data
1062623161_1062623165 -7 Left 1062623161 9:137431614-137431636 CCACCTCAGTTTGGCCATTGCCC 0: 1
1: 0
2: 1
3: 10
4: 122
Right 1062623165 9:137431630-137431652 ATTGCCCCTCCCCTCCCACTGGG No data
1062623161_1062623175 8 Left 1062623161 9:137431614-137431636 CCACCTCAGTTTGGCCATTGCCC 0: 1
1: 0
2: 1
3: 10
4: 122
Right 1062623175 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623161 Original CRISPR GGGCAATGGCCAAACTGAGG TGG (reversed) Intronic
900093055 1:928830-928852 GGGCACTGCCCAAACTAAGCTGG + Intronic
900148721 1:1169165-1169187 GGGCACAGGCCATAGTGAGGGGG - Intergenic
903947527 1:26973054-26973076 GGGCCTTGGCCAAACTCTGGGGG - Intergenic
912578734 1:110701054-110701076 GGGCAAGAGACAGACTGAGGAGG + Intergenic
912812272 1:112803297-112803319 TGGCAATGGCCAACCTCAGCTGG + Intergenic
915593569 1:156884023-156884045 GGGCAAGGGCCACAGCGAGGTGG - Intergenic
915860617 1:159440517-159440539 GGACAATGACCACAGTGAGGTGG - Exonic
915874594 1:159599023-159599045 GGACAATGACCACAGTGAGGTGG - Intergenic
915901263 1:159848186-159848208 GGGCAATGGCCACAGAGGGGTGG + Intronic
917494865 1:175531163-175531185 GAGCAACTGCCAAACTGAAGTGG + Intronic
918296737 1:183164287-183164309 AGGAAATGGGGAAACTGAGGAGG + Intergenic
919878446 1:201887420-201887442 TGGCAATGGGCACACTGAGTAGG + Intergenic
921729053 1:218556096-218556118 GGGCAAAAGCCTAACTGTGGTGG - Intergenic
924557749 1:245132120-245132142 GGGCGAAGGCAAAACAGAGGTGG + Intergenic
1070547186 10:77461797-77461819 GGGCAATGGGCAGACTCACGGGG - Intronic
1071563978 10:86662243-86662265 GGGCAATGGCCACCCTGCAGGGG - Exonic
1074988136 10:118675389-118675411 GGGCATTGGGATAACTGAGGAGG - Intronic
1076711563 10:132338548-132338570 GGGGAAGGGCCAGGCTGAGGAGG - Intronic
1077769522 11:5200310-5200332 GGTCAAAGGCCATAGTGAGGAGG + Exonic
1078495360 11:11811570-11811592 GGGGAGTGGCCAAACGGAGGCGG - Intergenic
1080032668 11:27678316-27678338 TGGCCATGGCCAAACATAGGAGG + Intronic
1080649402 11:34210168-34210190 GGCCAAAGGCCAAATTGATGGGG + Intronic
1081270411 11:41076681-41076703 GGGCCATGGGCAAAATGATGTGG - Intronic
1082990606 11:59204708-59204730 TGCCAATGGCAAAAATGAGGCGG - Exonic
1083209513 11:61174389-61174411 GGGCTATGTGCAAACTGAGGCGG + Intergenic
1084634862 11:70385010-70385032 GCTCAATGGCAACACTGAGGTGG - Intergenic
1087743574 11:101916537-101916559 GGGCAAAAGCCAAACTGAATGGG - Intronic
1088108323 11:106230111-106230133 GGGAACTGGACAAACTGAAGAGG - Intergenic
1089380358 11:118026339-118026361 GGTCAATGCCTATACTGAGGTGG + Intergenic
1091989285 12:4941582-4941604 AGGTAATGGCCAAACTGAGCTGG + Intergenic
1093078298 12:14780025-14780047 GGCCCATGGCCAAACTCTGGGGG - Intergenic
1098032106 12:66265605-66265627 GGGCAATGGCAGAACACAGGTGG - Intergenic
1098820392 12:75220609-75220631 AGGGAAAGGACAAACTGAGGAGG - Intergenic
1102512083 12:113422569-113422591 GGGCAAAGTCCAAGCTGAGCAGG + Intronic
1105707459 13:22977105-22977127 GGGCAATGCCCAACATGAGGAGG + Intergenic
1109163602 13:59006344-59006366 TGTCAATGGCAAAACTGAGATGG + Intergenic
1109508966 13:63343315-63343337 GGACAATGGCCAGCCTGTGGAGG + Intergenic
1112016682 13:95337020-95337042 TGTTAAAGGCCAAACTGAGGAGG - Intergenic
1112478874 13:99755752-99755774 TGGGAATGTCCAAACTGAGGGGG - Intronic
1113819112 13:113199221-113199243 GGGCAATGGCCAATCTGATGAGG + Intronic
1114566824 14:23639262-23639284 GGGCCATGGCCAAGCTGCAGGGG + Exonic
1118042299 14:61930499-61930521 TGGCAATGGCCAAAGGGAAGGGG - Intergenic
1118785095 14:69038972-69038994 GGGCAATGCCCAAACTCCTGAGG - Intergenic
1123494639 15:20813704-20813726 GGGCAATGTCCAGCCTGAGCTGG - Intergenic
1123551134 15:21382797-21382819 GGGCAATGTCCAGCCTGAGCTGG - Intergenic
1125255564 15:37759023-37759045 GAGTAATGTCCAAACGGAGGTGG + Intergenic
1125504984 15:40262543-40262565 AGGCAAAGGCCAAAAGGAGGAGG + Intronic
1125603193 15:40926563-40926585 GCGCAATGGCCAAGCGTAGGGGG + Intergenic
1126705708 15:51403014-51403036 GGGCTATTGCCACACGGAGGTGG + Intronic
1128864759 15:71106081-71106103 GGTCAAAGGCCAGACTTAGGTGG + Intronic
1129235103 15:74219063-74219085 GGGCAAAGGCCACACAGAGCAGG + Intergenic
1130435396 15:83893342-83893364 GGGAGATGGCCAAACAGAGATGG + Intronic
1131383166 15:91981142-91981164 GGGCAGTGGCCAGGCTGGGGTGG + Intronic
1202959477 15_KI270727v1_random:110040-110062 GGGCAATGTCCAGCCTGAGCTGG - Intergenic
1133024451 16:2981838-2981860 GGGCAATAGCAAAAATAAGGCGG - Intergenic
1139634317 16:68248711-68248733 GGGCCTTGGCCAAACTTTGGAGG + Intronic
1144929862 17:18850677-18850699 GGGAAAGGGGCTAACTGAGGAGG - Intronic
1147186947 17:38718052-38718074 GGGCAATGGCCAGAGGGAGGGGG - Intronic
1147780813 17:42940473-42940495 CTGCAATGCCCACACTGAGGTGG - Intergenic
1147869195 17:43575661-43575683 AGTCCATGGCCAATCTGAGGGGG - Intronic
1149431580 17:56598398-56598420 GCCCAATGACCAAACTGAGAGGG + Intergenic
1150244110 17:63660978-63661000 TGGCCTTGGCCAAAGTGAGGTGG - Intronic
1151203908 17:72490878-72490900 GGGCATTCCCCAAACTCAGGAGG - Intergenic
1155384366 18:25261139-25261161 TGACGTTGGCCAAACTGAGGAGG - Intronic
1157139110 18:45088074-45088096 GGGCAGTGGCCAAAACGTGGCGG - Intergenic
1160321191 18:77897294-77897316 GGGCAGTGTGCACACTGAGGCGG + Intergenic
1163239711 19:16053145-16053167 TGGCAAAGGCCATTCTGAGGAGG - Intergenic
1164801545 19:31080890-31080912 GTGCAATGACAACACTGAGGGGG + Intergenic
1168446562 19:56421915-56421937 CGGCAAAGGCCATACTGAAGAGG + Intronic
937257710 2:120566600-120566622 GTGCAGTGGGGAAACTGAGGTGG - Intergenic
938479540 2:131647960-131647982 GGGCAATGTCCAGCCTGAGCTGG + Intergenic
948377011 2:237527707-237527729 GGGGAATGGCCATACTAAGATGG - Intronic
1168732029 20:92774-92796 GGGCATGGGATAAACTGAGGGGG - Intronic
1170374682 20:15687591-15687613 GAGCACTGGCCAACCTGAGGAGG - Intronic
1170887830 20:20356158-20356180 GGGAAGTGGTCACACTGAGGGGG + Intronic
1171812507 20:29756824-29756846 GGGCAAAGGCCAGATAGAGGAGG + Intergenic
1174399759 20:50269755-50269777 GAGCAATGACCAGACAGAGGAGG - Intergenic
1179612763 21:42563148-42563170 GCTCACTGGCCAAAGTGAGGCGG - Intronic
1179901152 21:44395491-44395513 GGACAATGGCCCAAATGAGAAGG - Exonic
1181103533 22:20557734-20557756 GGGCCAAGGCCAGACTGGGGAGG - Intronic
1181756792 22:25029633-25029655 GGGCTATGGGTAAACTGAGGGGG - Intronic
1183112224 22:35658840-35658862 GGGCAAGGGCTAAACCCAGGAGG - Exonic
1183313099 22:37122168-37122190 GGGCACTGGCCACAGAGAGGAGG - Intergenic
949419825 3:3853885-3853907 GGGCAAAGGACAAGCTGAAGAGG - Intronic
950623903 3:14230363-14230385 GGGAAATGGTCAATATGAGGGGG - Intergenic
952848967 3:37712257-37712279 TGGAAATGTCCACACTGAGGTGG - Intronic
953659983 3:44884854-44884876 GGGGAGCGGGCAAACTGAGGAGG - Intronic
954290768 3:49648856-49648878 GGGCAGTGGCCCAGCTGTGGAGG - Intronic
955872247 3:63451553-63451575 GGGTAATGGCAAGACTGATGGGG - Intronic
957546341 3:81643311-81643333 GGGCAGTGGGCAAACAGAGCAGG - Intronic
961558532 3:127713077-127713099 GGGCAAGGGCCACACTGTGAGGG + Intronic
962334418 3:134513686-134513708 GGTCTTTAGCCAAACTGAGGAGG - Intronic
962993494 3:140602008-140602030 GGGCAATAGCCACACTGAGCTGG + Intergenic
964145210 3:153452823-153452845 GGGCATTGTCCAAACTGCAGAGG + Intergenic
964743498 3:159990201-159990223 GGTTTCTGGCCAAACTGAGGTGG - Exonic
965208418 3:165751603-165751625 GGGGGATGGCCAAACTGCAGGGG + Intergenic
968553213 4:1234771-1234793 GGGCACTGTCCAAACCGAGCTGG + Intronic
968658658 4:1789707-1789729 GGGCCATGGGCAACCTGCGGAGG + Intergenic
969073179 4:4556338-4556360 GGGCATTGACCACACTGTGGGGG + Intergenic
970268947 4:14322056-14322078 GGGCTATGGTCTGACTGAGGAGG - Intergenic
970324601 4:14910434-14910456 GAGAAATGGCAAAACTGGGGTGG - Intergenic
974451277 4:62064182-62064204 TGGCAATGGCAGAACTAAGGCGG - Intronic
977244754 4:94618170-94618192 TGGCAACGGCCAAACCAAGGAGG + Exonic
980168166 4:129253084-129253106 GGGCCAGGGCCAAAATGATGTGG + Intergenic
986501871 5:8409443-8409465 GGGCATGGGCCAAAGTCAGGCGG - Intergenic
992168770 5:74081378-74081400 GAACAATGGCCCAACTGAGAAGG + Intergenic
998520584 5:142796846-142796868 AGGCACTGGCCAAACAAAGGAGG - Intronic
999896426 5:156038931-156038953 GGTCAGAGGCCAAACTGAGCAGG - Intronic
1000667975 5:164022612-164022634 GGCCAGTGGCCAAATAGAGGTGG - Intergenic
1001955190 5:175843966-175843988 GGGCAAGGCCCCAAATGAGGAGG - Intronic
1002256401 5:177961382-177961404 TGGCCATGGTGAAACTGAGGAGG + Intergenic
1002640265 5:180627348-180627370 GGGCAGGGGCGGAACTGAGGTGG + Intronic
1003950043 6:11108515-11108537 AGGCAGTGCCCAAACTGATGGGG - Intronic
1008588583 6:52970772-52970794 CAGCAGTAGCCAAACTGAGGTGG + Intergenic
1009323556 6:62321377-62321399 TGGAAAAGGCAAAACTGAGGAGG + Intergenic
1011872068 6:91907861-91907883 GGGGAACGGCCATTCTGAGGAGG + Intergenic
1013287167 6:108691455-108691477 TGGGCATGGCCAAGCTGAGGAGG - Intergenic
1015579440 6:134707481-134707503 AGGTAATGCCCAAACTGAGGAGG + Intergenic
1017908711 6:158774299-158774321 GGGCAGGAGCCACACTGAGGAGG - Intronic
1018824772 6:167400874-167400896 GGGCTAGGGCCCAACTGAGCTGG - Intergenic
1019527829 7:1488698-1488720 GGGCAGTGGCCAAGGTGAAGGGG - Intronic
1029255267 7:99265407-99265429 GGGCATTGGCCAAATGGTGGGGG + Intergenic
1032447992 7:132001117-132001139 GGGCAAGGGGCAAACAGGGGTGG + Intergenic
1033563567 7:142557557-142557579 GGGCAATGGTCAAAATTAGAGGG + Intergenic
1036644972 8:10607305-10607327 AGGAGATGGCCAATCTGAGGAGG - Exonic
1046811983 8:118543210-118543232 GGGGAATGTCCACAGTGAGGCGG - Intronic
1055804403 9:80076593-80076615 GGGCAATGGCAGGACTGATGGGG + Intergenic
1061457935 9:130712803-130712825 GGCCAATGGCAATACAGAGGAGG + Intergenic
1062623161 9:137431614-137431636 GGGCAATGGCCAAACTGAGGTGG - Intronic
1190574309 X:51817581-51817603 GTACAATGGCAAAACTGTGGAGG - Intronic
1194788675 X:98118725-98118747 GGGCAATGGGCAGACTCATGAGG + Intergenic
1200040201 X:153359573-153359595 GGGCAATGTACAAAAGGAGGAGG - Intronic
1200046922 X:153408161-153408183 CGGCAGTGGCCACACTGAAGAGG + Intergenic
1201074820 Y:10178997-10179019 GGGCAAAGGCCAGCCAGAGGAGG - Intergenic