ID: 1062623162

View in Genome Browser
Species Human (GRCh38)
Location 9:137431617-137431639
Sequence GAGGGGCAATGGCCAAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623162_1062623176 19 Left 1062623162 9:137431617-137431639 CCTCAGTTTGGCCATTGCCCCTC No data
Right 1062623176 9:137431659-137431681 GTGACCAGGAGTGACCCAGCTGG No data
1062623162_1062623180 26 Left 1062623162 9:137431617-137431639 CCTCAGTTTGGCCATTGCCCCTC No data
Right 1062623180 9:137431666-137431688 GGAGTGACCCAGCTGGGGACAGG No data
1062623162_1062623166 -9 Left 1062623162 9:137431617-137431639 CCTCAGTTTGGCCATTGCCCCTC No data
Right 1062623166 9:137431631-137431653 TTGCCCCTCCCCTCCCACTGGGG No data
1062623162_1062623178 21 Left 1062623162 9:137431617-137431639 CCTCAGTTTGGCCATTGCCCCTC No data
Right 1062623178 9:137431661-137431683 GACCAGGAGTGACCCAGCTGGGG No data
1062623162_1062623177 20 Left 1062623162 9:137431617-137431639 CCTCAGTTTGGCCATTGCCCCTC No data
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623162_1062623182 30 Left 1062623162 9:137431617-137431639 CCTCAGTTTGGCCATTGCCCCTC No data
Right 1062623182 9:137431670-137431692 TGACCCAGCTGGGGACAGGCGGG No data
1062623162_1062623165 -10 Left 1062623162 9:137431617-137431639 CCTCAGTTTGGCCATTGCCCCTC No data
Right 1062623165 9:137431630-137431652 ATTGCCCCTCCCCTCCCACTGGG No data
1062623162_1062623181 29 Left 1062623162 9:137431617-137431639 CCTCAGTTTGGCCATTGCCCCTC No data
Right 1062623181 9:137431669-137431691 GTGACCCAGCTGGGGACAGGCGG No data
1062623162_1062623175 5 Left 1062623162 9:137431617-137431639 CCTCAGTTTGGCCATTGCCCCTC No data
Right 1062623175 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623162 Original CRISPR GAGGGGCAATGGCCAAACTG AGG (reversed) Intronic