ID: 1062623162

View in Genome Browser
Species Human (GRCh38)
Location 9:137431617-137431639
Sequence GAGGGGCAATGGCCAAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 255}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623162_1062623176 19 Left 1062623162 9:137431617-137431639 CCTCAGTTTGGCCATTGCCCCTC 0: 1
1: 0
2: 0
3: 17
4: 255
Right 1062623176 9:137431659-137431681 GTGACCAGGAGTGACCCAGCTGG No data
1062623162_1062623182 30 Left 1062623162 9:137431617-137431639 CCTCAGTTTGGCCATTGCCCCTC 0: 1
1: 0
2: 0
3: 17
4: 255
Right 1062623182 9:137431670-137431692 TGACCCAGCTGGGGACAGGCGGG No data
1062623162_1062623165 -10 Left 1062623162 9:137431617-137431639 CCTCAGTTTGGCCATTGCCCCTC 0: 1
1: 0
2: 0
3: 17
4: 255
Right 1062623165 9:137431630-137431652 ATTGCCCCTCCCCTCCCACTGGG No data
1062623162_1062623181 29 Left 1062623162 9:137431617-137431639 CCTCAGTTTGGCCATTGCCCCTC 0: 1
1: 0
2: 0
3: 17
4: 255
Right 1062623181 9:137431669-137431691 GTGACCCAGCTGGGGACAGGCGG No data
1062623162_1062623178 21 Left 1062623162 9:137431617-137431639 CCTCAGTTTGGCCATTGCCCCTC 0: 1
1: 0
2: 0
3: 17
4: 255
Right 1062623178 9:137431661-137431683 GACCAGGAGTGACCCAGCTGGGG No data
1062623162_1062623166 -9 Left 1062623162 9:137431617-137431639 CCTCAGTTTGGCCATTGCCCCTC 0: 1
1: 0
2: 0
3: 17
4: 255
Right 1062623166 9:137431631-137431653 TTGCCCCTCCCCTCCCACTGGGG No data
1062623162_1062623177 20 Left 1062623162 9:137431617-137431639 CCTCAGTTTGGCCATTGCCCCTC 0: 1
1: 0
2: 0
3: 17
4: 255
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623162_1062623175 5 Left 1062623162 9:137431617-137431639 CCTCAGTTTGGCCATTGCCCCTC 0: 1
1: 0
2: 0
3: 17
4: 255
Right 1062623175 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG No data
1062623162_1062623180 26 Left 1062623162 9:137431617-137431639 CCTCAGTTTGGCCATTGCCCCTC 0: 1
1: 0
2: 0
3: 17
4: 255
Right 1062623180 9:137431666-137431688 GGAGTGACCCAGCTGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623162 Original CRISPR GAGGGGCAATGGCCAAACTG AGG (reversed) Intronic
900419044 1:2547666-2547688 CAGGGGCACTGGACAAACCGGGG - Intergenic
900722142 1:4183837-4183859 GAGGTGGGAGGGCCAAACTGAGG + Intergenic
901784038 1:11612787-11612809 CAGGGGCAATGGAAAAGCTGAGG + Intergenic
902051269 1:13565343-13565365 GAGGTGGGAAGGCCAAACTGAGG - Intergenic
902098804 1:13967976-13967998 GAGAGGCACTGCCCAATCTGTGG - Intergenic
902761763 1:18585668-18585690 GCAGGTGAATGGCCAAACTGTGG + Intergenic
903480873 1:23652419-23652441 GAGGGGGAAGGGCCAGAGTGGGG + Intergenic
904347174 1:29880366-29880388 GAGTGGCAAAGCCCAAGCTGTGG + Intergenic
906961477 1:50421731-50421753 GAGCAGCCATGGCCAGACTGGGG - Intronic
907273043 1:53301854-53301876 GAGAGTCTATAGCCAAACTGAGG + Intronic
907787838 1:57630702-57630724 GAGGGGTGATGACCAAATTGTGG + Intronic
909015125 1:70372320-70372342 GAGGTGGGAGGGCCAAACTGAGG - Intronic
909729882 1:78877589-78877611 GAGGTGGGAAGGCCAAACTGAGG - Intergenic
910049765 1:82960251-82960273 GAGGTGGGAAGGCCAAACTGAGG - Intergenic
911510278 1:98802392-98802414 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
912031198 1:105246722-105246744 AAGGAGCAATGGAGAAACTGAGG - Intergenic
913307577 1:117449120-117449142 AAGGGAGAATGGCCAATCTGTGG - Intronic
915541879 1:156572558-156572580 GAGGGGCGGTGGCCCAACGGCGG - Intronic
918043978 1:180930076-180930098 GAGAGGCAAGGCCCAAAATGTGG - Intronic
919047823 1:192475712-192475734 GAGGGGAAAAGGCCAAACCGTGG - Intergenic
921205534 1:212845468-212845490 GAGGTGGGAAGGCCAAACTGAGG - Intronic
921303200 1:213770137-213770159 GAGGGGAAATGGCCAGAATCAGG - Intergenic
924033823 1:239914960-239914982 GAAGGGCTTTGCCCAAACTGTGG - Exonic
1062923669 10:1298551-1298573 GACAGGCAGTAGCCAAACTGAGG + Intronic
1063501924 10:6563244-6563266 GAGAGGCACTGGGCAAAGTGAGG - Intronic
1063696400 10:8339503-8339525 GAGGGACAATGGCCACTATGGGG - Intergenic
1066135200 10:32438871-32438893 GAGGGGCCCTGGCGCAACTGTGG + Intergenic
1069733369 10:70634074-70634096 GAGGAGCAAGGGACAGACTGGGG + Intergenic
1070729354 10:78814554-78814576 ATGGGGCAATGGAGAAACTGGGG + Intergenic
1070829464 10:79409702-79409724 CAGGGACAATAGCCACACTGAGG - Intronic
1071762597 10:88625743-88625765 GAGGGGCAATGGCCTGAGTCAGG + Intergenic
1071822139 10:89289590-89289612 GAGGTGGAAAGGCCAAACAGAGG - Intronic
1073544509 10:104337419-104337441 GAGGGGCAAAAGGCAAAATGAGG + Intronic
1074019390 10:109566931-109566953 GAGGTGGGAAGGCCAAACTGAGG - Intergenic
1074185464 10:111096802-111096824 GAGGCGCAGTGGGCAAGCTGAGG - Intergenic
1074988137 10:118675392-118675414 GAGGGGCATTGGGATAACTGAGG - Intronic
1078610198 11:12813166-12813188 TAGAGGCAGTGGGCAAACTGGGG + Intronic
1078789448 11:14527755-14527777 GAGGTGGGAAGGCCAAACTGAGG - Intronic
1079230940 11:18648176-18648198 GAGGTGGGAAGGCCAAACTGAGG - Intergenic
1080994125 11:37579839-37579861 GAGGTGACAAGGCCAAACTGAGG + Intergenic
1083415207 11:62521126-62521148 GTGTGTCAATGTCCAAACTGGGG + Exonic
1084354627 11:68629499-68629521 GAGGTGGGAAGGCCAAACTGAGG - Intergenic
1084625351 11:70302153-70302175 GAGGGGGAATGGTTGAACTGAGG + Intronic
1084771204 11:71343867-71343889 GAGTGGCAATGCTCAAACTCAGG - Intergenic
1084828560 11:71750304-71750326 GAGGTGGGAGGGCCAAACTGAGG - Intergenic
1085275059 11:75293061-75293083 GAGGGGCAAGGGGCACAGTGAGG + Intronic
1085689843 11:78655958-78655980 CAGGGGCAATGGGCAACCAGTGG + Exonic
1088698695 11:112392455-112392477 GACTGGCAATGGCAGAACTGAGG - Intergenic
1089659081 11:119974255-119974277 GAGAGGCCATGGCCAACATGTGG + Intergenic
1089866649 11:121638712-121638734 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
1090920082 11:131199245-131199267 GAGGGGCAAGGGCCTGGCTGTGG + Intergenic
1092414688 12:8281396-8281418 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
1092719270 12:11424825-11424847 GAGGGGCACAGGCAGAACTGTGG + Intronic
1094315695 12:29136118-29136140 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
1095612571 12:44147343-44147365 AAGCAGCAATGGCAAAACTGGGG - Intronic
1095806339 12:46324521-46324543 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
1097067110 12:56328678-56328700 GAGGGGCAAGGGCCACCCTACGG + Intronic
1097592754 12:61591784-61591806 GAGGTGGGAAGGCCAAACTGAGG - Intergenic
1098523753 12:71462686-71462708 GAGGGGCAATGGGAAGAGTGAGG - Intronic
1099291779 12:80784428-80784450 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
1099835749 12:87908545-87908567 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
1100200072 12:92288749-92288771 GGGGGGCAATGCGCAGACTGGGG - Intergenic
1101352688 12:103946911-103946933 CAGGGTCAATGTTCAAACTGAGG - Exonic
1102604943 12:114061124-114061146 GAGGTGGGAAGGCCAAACTGAGG - Intergenic
1103637309 12:122318177-122318199 GGGAGGCAGTGGCCAAACTGAGG - Intronic
1104766461 12:131333335-131333357 GAGGGGCAGGGGCCACATTGGGG + Intergenic
1104812953 12:131629290-131629312 GAGGGGCAGGGGCCACACTGGGG - Intergenic
1107219939 13:37970318-37970340 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
1107702339 13:43060791-43060813 GAGGTGGGAAGGCCAAACTGAGG + Intronic
1110650137 13:77934466-77934488 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
1110925131 13:81141322-81141344 AAGGGTCACTGGTCAAACTGGGG + Intergenic
1111302363 13:86362775-86362797 GAGGTGGAAAGGCTAAACTGAGG - Intergenic
1112704695 13:102054424-102054446 TAGGGGAGATGGCCAAACAGTGG - Intronic
1113145927 13:107207485-107207507 GAGGACCACTGGCTAAACTGTGG - Intronic
1116490209 14:45496191-45496213 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
1117027512 14:51636669-51636691 GAGGGGAAAAGGCCAGAATGTGG + Intronic
1117174583 14:53133383-53133405 GAGGTGGAAAGGCCAAACCGAGG - Intronic
1119559879 14:75581557-75581579 GAGGTGGGAAGGCCAAACTGAGG + Intronic
1122352436 14:101103825-101103847 GAGGGCCATTGGCCGATCTGTGG + Intergenic
1125849470 15:42889382-42889404 GAGGTGGGAAGGCCAAACTGAGG - Intronic
1127933190 15:63611236-63611258 GTGGGGCAGAGGCCAGACTGTGG + Intronic
1128864758 15:71106078-71106100 GAGGGTCAAAGGCCAGACTTAGG + Intronic
1130304936 15:82707085-82707107 GAGGCGGGAAGGCCAAACTGAGG - Intronic
1131375967 15:91923526-91923548 CTGGGGCAATGGCCATACTCTGG - Intronic
1132420083 15:101658254-101658276 GCGGGTGAATGGCCAAACTGTGG + Intronic
1132948020 16:2543376-2543398 CAGCGGCAATGGCCAGAGTGAGG - Intronic
1132966427 16:2657966-2657988 CAGCGGCAATGGCCAGAGTGAGG + Intergenic
1133939147 16:10293932-10293954 GAGGTGGAAAGGCCAAACTGAGG - Intergenic
1135910219 16:26553580-26553602 GAGAGGCAATGTCAAAACTGCGG + Intergenic
1136052198 16:27659777-27659799 GAGGGAGTGTGGCCAAACTGAGG + Intronic
1136983949 16:35082960-35082982 GAGGGGCAGTGTTCAAACTGGGG + Intergenic
1137715186 16:50594265-50594287 GAAAGGCAATGGTCACACTGTGG - Intronic
1139943402 16:70622143-70622165 GAGGGGGGAAGGCTAAACTGAGG + Intronic
1144397634 17:14860593-14860615 GAGGGCAAATGGCAAACCTGTGG - Intergenic
1144830237 17:18127081-18127103 GAGCGGCTCTGGCAAAACTGAGG + Exonic
1146605272 17:34252447-34252469 GAGGGGCTATGGGGAAAATGAGG - Intergenic
1147258554 17:39196129-39196151 GAGGGGCCATGACCAGACTGGGG + Intronic
1148632104 17:49118939-49118961 GAGGGGCATTGTCCATTCTGAGG + Intergenic
1148806214 17:50265320-50265342 GAGAGGCAATGCCCAGCCTGAGG + Intergenic
1149717171 17:58803114-58803136 GAGTAGAAATGGCAAAACTGAGG + Intronic
1151438801 17:74115044-74115066 GAGGGGCACTGCACAAACTCCGG - Intergenic
1152134480 17:78495768-78495790 GAGGGGCAGAGGGCAAGCTGGGG - Intronic
1152720017 17:81918814-81918836 GAGGGGCCAAAGCCCAACTGGGG + Exonic
1152758117 17:82095552-82095574 GAGGGGCCATGGTGGAACTGAGG + Intronic
1154325845 18:13389783-13389805 GAAAGGGAAAGGCCAAACTGAGG + Intronic
1154975122 18:21450017-21450039 CAGGGGCACCAGCCAAACTGAGG - Intronic
1155892367 18:31285517-31285539 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
1156967432 18:43111889-43111911 TTTGGACAATGGCCAAACTGAGG - Intronic
1157562721 18:48660075-48660097 GAGAGGCCATGGCCCAGCTGGGG - Intronic
1157562764 18:48660327-48660349 GAGGGACCATGGCCCAGCTGGGG - Intronic
1161605122 19:5210634-5210656 GAAGGGCGAGGGCCAGACTGTGG - Intronic
1162076896 19:8194041-8194063 GAGGGGCAGTGTCCAAGCTCAGG - Intronic
1163008821 19:14412261-14412283 CTGGGGCAAGGGGCAAACTGTGG + Intronic
1163944062 19:20519841-20519863 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
1167902467 19:52632138-52632160 GAGGTGGGAAGGCCAAACTGAGG - Intronic
1168211718 19:54895619-54895641 GAGGTGGGAAGGCCAAACTGTGG + Intergenic
925763511 2:7209204-7209226 GAGGGGCCATGGCCCCACTGAGG - Intergenic
927040801 2:19228574-19228596 CAGGGGCACTGGCCAAAATGTGG - Intergenic
927134536 2:20087120-20087142 GAGGTGGGAAGGCCAAACTGAGG - Intergenic
930970161 2:57385699-57385721 CAGGGACTATGGCCAAAATGGGG - Intergenic
931379110 2:61735795-61735817 GAGGGGCCAAGGCCAAGCTGAGG - Intergenic
932296177 2:70625082-70625104 GAGGTGGGAAGGCCAAACTGAGG - Intronic
932780917 2:74557764-74557786 GAGGGGCACAGGGGAAACTGAGG - Intergenic
936793923 2:116185074-116185096 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
938106697 2:128536335-128536357 AAGTAGCAATGGCCAAATTGGGG + Intergenic
939460366 2:142490697-142490719 GAGGCGGGAAGGCCAAACTGAGG + Intergenic
942165465 2:173236566-173236588 GAGGGGCAGTCTCCAAAGTGTGG + Intronic
944251475 2:197583409-197583431 AAGGTGGAAAGGCCAAACTGAGG - Intronic
946886821 2:224229655-224229677 GAGGTGGGAAGGCCAAACTGAGG - Intergenic
947916484 2:233835438-233835460 GTGGGACATTGGGCAAACTGGGG + Intronic
1168883765 20:1228485-1228507 GAGGGCCATTGGCCAAAATATGG + Exonic
1170202031 20:13754667-13754689 GGGGGGCAAGGACCAAATTGGGG - Intronic
1170887827 20:20356155-20356177 GAGGGGAAGTGGTCACACTGAGG + Intronic
1170887858 20:20356314-20356336 GAGGGGAAGTGGTCACACTGAGG + Intronic
1170887867 20:20356354-20356376 GAGGGGAAGTGGTCACACTGAGG + Intronic
1170887901 20:20356493-20356515 GAGGGGAGATGGTCACACTGAGG + Intronic
1170887938 20:20356649-20356671 GAGGGGAAGTGGTCACACTGAGG + Intronic
1170887965 20:20356765-20356787 GAGGGGAAGTGGTCACACTGAGG + Intronic
1170887997 20:20356900-20356922 GAGGGGAAGTGGTCACACTGAGG + Intronic
1170888048 20:20357136-20357158 GAGGGGAAGTGGTCACACTGAGG + Intronic
1170888079 20:20357296-20357318 GAGGGGAAGTGGTCACACTGAGG + Intronic
1170888088 20:20357336-20357358 GAGGGGAAGTGGTCACACTGAGG + Intronic
1170888154 20:20357635-20357657 GAGGGGAAGTGGTCACACTGAGG + Intronic
1170888163 20:20357675-20357697 GAGGGGAAGTGGTCACACTGAGG + Intronic
1170888282 20:20358174-20358196 GAGGGGAAGTGGTCACACTGAGG + Intronic
1170888295 20:20358232-20358254 GAGGGGAAGTGGTCACACTGAGG + Intronic
1171236690 20:23532793-23532815 GATGGGGAATGGCCAGTCTGTGG + Intergenic
1172714099 20:36950637-36950659 CAGGGGATGTGGCCAAACTGTGG + Intronic
1173366665 20:42391980-42392002 GATGGGCAATGGCCAGAGAGGGG + Intronic
1173652497 20:44675668-44675690 GAGGTGGGAAGGCCAAACTGAGG - Intergenic
1174058996 20:47819233-47819255 GAGGGGCAGAGGCCACACTGGGG - Intergenic
1176303705 21:5112635-5112657 GAGGGTAAATGGATAAACTGTGG + Intergenic
1177030816 21:15980930-15980952 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
1179191551 21:39126538-39126560 AAGGGGGAATGGCCCAGCTGAGG - Intergenic
1179480301 21:41672536-41672558 AAGGGGAAATGGAGAAACTGAGG + Intergenic
1179853327 21:44149315-44149337 GAGGGTAAATGGATAAACTGTGG - Intergenic
1180045121 21:45301681-45301703 GGGGGGCTGTGGCCAACCTGTGG - Intergenic
1180921163 22:19522399-19522421 GAGGGGCTAGAGCCAAGCTGTGG + Intergenic
1181841553 22:25667060-25667082 GAAGGTCCATGGCTAAACTGGGG - Intronic
1183831638 22:40421208-40421230 GAGTGGAAATGGGCAAAGTGTGG - Intronic
1184633076 22:45801314-45801336 GAGGAGCACTGGCCAGACTTTGG + Intronic
951895009 3:27602056-27602078 GAGGTGGGAAGGCCAAACTGAGG - Intergenic
952273030 3:31851362-31851384 GAGGGGCCAGGGCTGAACTGGGG - Intronic
952297324 3:32072876-32072898 GAGGTGGGAAGGCCAAACTGAGG - Intronic
954161292 3:48724587-48724609 GAGATGGAAAGGCCAAACTGAGG + Intronic
954368993 3:50160563-50160585 GAGGGGCAGTGGCCATGCTGGGG + Intronic
956233125 3:67039570-67039592 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
957059565 3:75471212-75471234 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
957591201 3:82200811-82200833 GAGGGACAATGACAAATCTGTGG - Intergenic
957734503 3:84188745-84188767 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
957904411 3:86538792-86538814 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
958935082 3:100248102-100248124 AAGGGGCAATATCAAAACTGAGG - Intergenic
960947374 3:122975917-122975939 GAGGGGGAATGGCCAGAGAGGGG - Intronic
961293833 3:125868173-125868195 GAGGTGGGAAGGCCAAACTGAGG - Intergenic
961332112 3:126148477-126148499 GAGGGGACATGGCCAAAACGAGG - Intronic
961375746 3:126464693-126464715 GAGAGGGAACGGCCAAACAGGGG + Intronic
961712324 3:128837131-128837153 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
961718054 3:128872422-128872444 GAGGGGCAATGAGCAAGCTTAGG + Intergenic
961892233 3:130140012-130140034 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
963320193 3:143802587-143802609 GAGGTGGGAAGGCCAAACTGAGG - Intronic
963843521 3:150131885-150131907 GAGGGGTCATGGCCCATCTGTGG - Intergenic
963887848 3:150601427-150601449 GAGGTGGGAAGGCCAAACTGAGG - Intronic
964698145 3:159533348-159533370 GGGGAGCAATGGACAAAGTGAGG + Intronic
964902404 3:161675496-161675518 GAGGGGATAGGGCCAGACTGAGG + Intergenic
966259614 3:177960257-177960279 CAGGGCCAAGGGCCAAGCTGTGG - Intergenic
968412590 4:402877-402899 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
968658657 4:1789704-1789726 GCGGGGCCATGGGCAACCTGCGG + Intergenic
969003473 4:4001392-4001414 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
969366182 4:6695658-6695680 GAGAAGCAATGGCAAAGCTGGGG + Intronic
969653710 4:8483755-8483777 GAGGTGGGAAGGCCAAACTGAGG + Intronic
969708798 4:8831014-8831036 CAGGGGCAATGGTGAACCTGTGG - Intergenic
969810455 4:9643431-9643453 GAGGTGGGAAGGCCAAACTGAGG - Intergenic
970256032 4:14171311-14171333 GAGGTGGAAAGGCTAAACTGAGG + Intergenic
970401163 4:15719146-15719168 GTGGGGCCCTGGCCAAACTCAGG - Intronic
970494190 4:16609113-16609135 GCGGGGCAGTGGCCTACCTGAGG + Intronic
973639549 4:52889179-52889201 GATGGGGTATGGCCAAACTGCGG - Intronic
973723699 4:53751063-53751085 GAGAGGCAATGCCCAAAACGTGG + Intronic
976758011 4:88519014-88519036 GAGTGGCCATCGCCAAACAGAGG + Intergenic
980862957 4:138521590-138521612 GAGAGGCAATGGTGAAGCTGAGG + Intergenic
982083639 4:151813791-151813813 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
982319255 4:154061599-154061621 GAGGTGGGAAGGCCAAACTGAGG - Intergenic
982413852 4:155109631-155109653 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
985057044 4:186045333-186045355 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
985078601 4:186242944-186242966 GAGATGGAAAGGCCAAACTGAGG + Intronic
986501872 5:8409446-8409468 GAGGGGCATGGGCCAAAGTCAGG - Intergenic
987756142 5:22099208-22099230 GAGGTGGGAAGGCCAAACTGAGG - Intronic
994125706 5:96167672-96167694 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
994375381 5:99012158-99012180 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
994557230 5:101319272-101319294 GAGGTGGGAAGGCCAAACTGAGG - Intergenic
995296983 5:110534200-110534222 GAGGTGAGAAGGCCAAACTGAGG - Intronic
995874287 5:116774244-116774266 GAGGGGAAATGGCCACAATAGGG - Intergenic
997639499 5:135439481-135439503 GAGGGGAAGTAGCCAAGCTGGGG + Intergenic
998485210 5:142496218-142496240 GAAGGACCATGGCCAAAATGGGG + Intergenic
998626027 5:143846888-143846910 AAGGGGCAAGGGGCAAACAGGGG + Intergenic
999313739 5:150570466-150570488 GATGGGCCCTGGCCACACTGGGG - Intergenic
999914434 5:156242120-156242142 GTGGGGCAATGGTTAAACTGTGG + Intronic
1002463197 5:179387161-179387183 GAGAGGCAATGGCTCACCTGAGG - Intergenic
1002967064 6:1977628-1977650 GTGGGGCAATGGCCCACCTAGGG + Intronic
1003555980 6:7140926-7140948 GAGGGGCGAGGGGAAAACTGCGG + Intronic
1004768258 6:18755444-18755466 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
1005571624 6:27151054-27151076 GAGGGGGAAGGGCGGAACTGAGG - Intergenic
1009343644 6:62588427-62588449 GAGGTGGGAAGGCCAAACTGAGG - Intergenic
1009379507 6:63010092-63010114 GAGGTGGAAAGGCCAAACTGAGG - Intergenic
1010829327 6:80511102-80511124 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
1013892023 6:115036242-115036264 GAGGTGGGAAGGCCAAACTGAGG - Intergenic
1014114899 6:117660131-117660153 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
1016204872 6:141457393-141457415 GAGGTGGGAAGGCCAAACTGAGG - Intergenic
1019218904 6:170459578-170459600 GAGTGGGAATGCCCACACTGGGG + Intergenic
1021421771 7:20453725-20453747 GAGACACAAGGGCCAAACTGTGG + Intergenic
1022022685 7:26416084-26416106 GAAGGGTAATGGCCAAATTAAGG - Intergenic
1024336707 7:48215285-48215307 ATGGGGGAATGGCCAAACAGTGG + Intronic
1024548363 7:50540653-50540675 AAGGGGCAGTGGCCAGGCTGAGG - Intronic
1024924116 7:54594634-54594656 GAGGGACAGTGGCAAAGCTGTGG + Intergenic
1025235916 7:57234795-57234817 GAGGGGCAGAGGCCACAATGGGG + Intergenic
1033088170 7:138361420-138361442 CAGGTGCAATGGCCAAACTTTGG - Intergenic
1033308620 7:140242769-140242791 GGGGGACACTTGCCAAACTGGGG - Intergenic
1033715632 7:143998930-143998952 GAGTTGTAATGGCCAAAGTGTGG + Intergenic
1035373196 7:158392108-158392130 AAGGGACAATGGCCAGGCTGGGG + Intronic
1036373603 8:8181466-8181488 GAGGTGGGAAGGCCAAACTGAGG - Intergenic
1036877301 8:12484175-12484197 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
1037584068 8:20264566-20264588 GAGGGGCACTGGCAGAAATGAGG + Intronic
1040938567 8:52808328-52808350 GTGGGTGAATGGCCAAACAGTGG - Intergenic
1041917106 8:63148944-63148966 GAGGTGAGAAGGCCAAACTGAGG + Intergenic
1043439903 8:80267779-80267801 GGGTGGCAGTGTCCAAACTGAGG - Intergenic
1043597070 8:81899354-81899376 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
1043717522 8:83506006-83506028 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
1046075266 8:109305329-109305351 GAGGTGGGAAGGCCAAACTGAGG - Intronic
1046294440 8:112200190-112200212 GAGGTGGGAAGGCCAAACTGAGG - Intergenic
1048536470 8:135300732-135300754 GAGGGGCAGTGTCCATTCTGAGG + Intergenic
1048763884 8:137825953-137825975 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
1049024921 8:139981764-139981786 CACAGGCAATGGCCAACCTGGGG - Intronic
1049061249 8:140277845-140277867 GTGGGACTATGGGCAAACTGTGG + Intronic
1052653734 9:31331314-31331336 GAGGTGGGAAGGCCAAACTGAGG - Intergenic
1056324277 9:85463570-85463592 GAGGTGGGAAGGCCAAACTGAGG - Intergenic
1057619486 9:96621990-96622012 GAGTGGCAGTGGCCAGGCTGGGG + Intergenic
1060226527 9:121794690-121794712 GAGGTGGGAAGGCCAAACTGAGG - Intergenic
1060995136 9:127871604-127871626 GAGGGGCAGTTGCCAAACCTGGG - Intronic
1061890870 9:133618445-133618467 GGGGGAAAATGGGCAAACTGAGG - Intergenic
1061939512 9:133876512-133876534 GAGCGGCCATGGCCACACAGGGG + Intronic
1062460188 9:136659716-136659738 GAGAGACAATGGGGAAACTGAGG + Intronic
1062623162 9:137431617-137431639 GAGGGGCAATGGCCAAACTGAGG - Intronic
1062692415 9:137849404-137849426 GAGGTGGGAAGGCCAAACTGAGG - Intronic
1185957034 X:4502548-4502570 GAGGGCCAATGAGCAATCTGGGG - Intergenic
1191761732 X:64654261-64654283 GAGGTGGGAAGGCCAAACTGAGG - Intergenic
1194873384 X:99160032-99160054 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
1194930335 X:99880455-99880477 GTGAAGCAATGGCCCAACTGGGG + Intergenic
1195295178 X:103469536-103469558 GAGGGGCAGTTGTCACACTGAGG - Intergenic
1195570422 X:106393675-106393697 GAGGGGCAAGGACCAACCTCTGG - Intergenic
1196220663 X:113110063-113110085 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
1197933409 X:131716433-131716455 GAGGTGGGAAGGCCAAACTGAGG - Intergenic
1198334331 X:135652076-135652098 GAAGGTCACTGGCCCAACTGGGG - Intergenic
1199073397 X:143503870-143503892 GAGGTGGGAAGGCCAAACTGAGG + Intergenic
1199596916 X:149513318-149513340 GAGTAGCAATGCACAAACTGAGG + Intronic