ID: 1062623163

View in Genome Browser
Species Human (GRCh38)
Location 9:137431628-137431650
Sequence CAGTGGGAGGGGAGGGGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1421
Summary {0: 1, 1: 2, 2: 8, 3: 139, 4: 1271}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623163_1062623182 19 Left 1062623163 9:137431628-137431650 CCATTGCCCCTCCCCTCCCACTG 0: 1
1: 2
2: 8
3: 139
4: 1271
Right 1062623182 9:137431670-137431692 TGACCCAGCTGGGGACAGGCGGG No data
1062623163_1062623180 15 Left 1062623163 9:137431628-137431650 CCATTGCCCCTCCCCTCCCACTG 0: 1
1: 2
2: 8
3: 139
4: 1271
Right 1062623180 9:137431666-137431688 GGAGTGACCCAGCTGGGGACAGG No data
1062623163_1062623177 9 Left 1062623163 9:137431628-137431650 CCATTGCCCCTCCCCTCCCACTG 0: 1
1: 2
2: 8
3: 139
4: 1271
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623163_1062623184 22 Left 1062623163 9:137431628-137431650 CCATTGCCCCTCCCCTCCCACTG 0: 1
1: 2
2: 8
3: 139
4: 1271
Right 1062623184 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG No data
1062623163_1062623181 18 Left 1062623163 9:137431628-137431650 CCATTGCCCCTCCCCTCCCACTG 0: 1
1: 2
2: 8
3: 139
4: 1271
Right 1062623181 9:137431669-137431691 GTGACCCAGCTGGGGACAGGCGG No data
1062623163_1062623175 -6 Left 1062623163 9:137431628-137431650 CCATTGCCCCTCCCCTCCCACTG 0: 1
1: 2
2: 8
3: 139
4: 1271
Right 1062623175 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG No data
1062623163_1062623176 8 Left 1062623163 9:137431628-137431650 CCATTGCCCCTCCCCTCCCACTG 0: 1
1: 2
2: 8
3: 139
4: 1271
Right 1062623176 9:137431659-137431681 GTGACCAGGAGTGACCCAGCTGG No data
1062623163_1062623178 10 Left 1062623163 9:137431628-137431650 CCATTGCCCCTCCCCTCCCACTG 0: 1
1: 2
2: 8
3: 139
4: 1271
Right 1062623178 9:137431661-137431683 GACCAGGAGTGACCCAGCTGGGG No data
1062623163_1062623186 26 Left 1062623163 9:137431628-137431650 CCATTGCCCCTCCCCTCCCACTG 0: 1
1: 2
2: 8
3: 139
4: 1271
Right 1062623186 9:137431677-137431699 GCTGGGGACAGGCGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623163 Original CRISPR CAGTGGGAGGGGAGGGGCAA TGG (reversed) Intronic
900132571 1:1093684-1093706 CACTGGCAGGTGATGGGCAAAGG - Intronic
900324885 1:2103859-2103881 CAGTGGGAGGAGAGGGGTGAAGG + Intronic
900344722 1:2205229-2205251 CACTGGGAGGGGCGGGGCAAGGG - Intronic
900400143 1:2469646-2469668 CAGGGGGAGGGGTTGGGGAAGGG + Intronic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900433242 1:2612675-2612697 CAGTGAGGGTGGAGGGGCTAGGG - Intronic
900490732 1:2947937-2947959 CAGTGGGAGGGAAGGGGGTGGGG - Intergenic
900510121 1:3054937-3054959 CAGGGGCTGGGGAGGGGCTATGG + Intergenic
900556933 1:3285261-3285283 CAGCTGGAGGGGAGAGGCAGGGG - Intronic
900658269 1:3770792-3770814 CTGGGGGAGGGGAGGAGGAAGGG + Intronic
900894743 1:5475240-5475262 CAGTGGGAGCAGAAGGGCACAGG - Intergenic
900940408 1:5795047-5795069 GGGAGGGAGAGGAGGGGCAAAGG + Intergenic
900976811 1:6022643-6022665 CAGGGGCAGGGGAGGGGGAATGG - Intronic
901216654 1:7559003-7559025 CTTTGGGAGAGGAGGGACAAAGG + Intronic
901380940 1:8873708-8873730 GAGGGGGAGGGGAGGTGCAAGGG + Intronic
901410235 1:9077812-9077834 CAGGAGGGAGGGAGGGGCAATGG + Intronic
901930708 1:12595084-12595106 CAGAGGGAGGGGAGGGGAGGCGG + Intronic
902248560 1:15138198-15138220 CTGTGGGAGGAGATGGGCAAAGG - Intergenic
902328978 1:15721250-15721272 TGGAGGGAGGGGAGGGGAAATGG - Intronic
902518017 1:17000232-17000254 CAGGGGGAGGTGAGGAGCTAGGG - Exonic
902521611 1:17021074-17021096 CAGTGGGCAGGGAAGGGCTAGGG - Intronic
902529685 1:17082781-17082803 CAGTGTGAGGGGAGGAGGATGGG - Intronic
902732520 1:18378566-18378588 CACTGAGAGGGGAATGGCAAGGG + Intergenic
902762590 1:18592665-18592687 TAGAGGGAGGGAAGGGGGAAGGG - Intergenic
903182918 1:21614093-21614115 CAGTGGGAGGTGGGGGCCAGGGG + Intronic
903576823 1:24344532-24344554 CAGTTGGAGCTGAGGGCCAAGGG - Intronic
903594544 1:24484258-24484280 CAGTGGGAGGTGAGCAGCAGGGG - Intergenic
903625973 1:24730347-24730369 GAGGGGGAGGGGAGGGGGAGGGG + Intergenic
903625980 1:24730358-24730380 GAGGGGGAGGGGAGGGGGAGGGG + Intergenic
903726831 1:25453796-25453818 CATAGGGAGGGTATGGGCAAAGG - Intronic
903789997 1:25886243-25886265 CAGTGGGAGGGAAGGGCAGAGGG + Intronic
904306313 1:29592454-29592476 CAGTGGAGGGGTAGGGGCAGAGG + Intergenic
904352408 1:29917326-29917348 GAGAGGAAGGGGAGGGGGAAGGG - Intergenic
904354179 1:29927794-29927816 CAGAGGGTGGGGAGGGGAAGTGG - Intergenic
904383850 1:30129061-30129083 AGGTGGGAGGGGGTGGGCAATGG + Intergenic
904437948 1:30511471-30511493 CAGGGGGAGGGGATGAGCATAGG + Intergenic
904533125 1:31182064-31182086 CATGAGGAGGGGAGGGGCGAGGG + Intronic
904539932 1:31225905-31225927 CACTGGGTGGGGAGGAGCAAGGG + Intronic
904561106 1:31397817-31397839 AAGTGGGAGGGGTGGGGCCATGG - Intergenic
905037015 1:34925131-34925153 CAGTGGGAGGGGCAGGGGAGAGG - Intronic
905052090 1:35060616-35060638 CAGCAGGAGAGGAGGGGCGAAGG - Intronic
905114235 1:35623624-35623646 CAGTGGGAGGACACTGGCAAAGG - Intronic
905241781 1:36586282-36586304 TCGTGGGAGGGGAGGGGAGAAGG + Intergenic
905393059 1:37650521-37650543 CAGTGGGAGGGAGGGGGCTGGGG + Intergenic
905617644 1:39412640-39412662 CAGAGGGAGGGGAGATGGAAAGG + Exonic
905789428 1:40782595-40782617 GAGCGGGAGGGGCGGGGGAAGGG - Intergenic
905791542 1:40792198-40792220 CCCTGGGAGGGGAGGGGGCAGGG + Intronic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
905921508 1:41722468-41722490 GAGAGGGAGGGGAGAGGGAAGGG - Intronic
906400303 1:45499613-45499635 CTGTGGCAGGGGAGCGGCAGGGG + Exonic
906495228 1:46301006-46301028 CAGTGGTAGGGGAGGGAGAAGGG + Intronic
906553767 1:46690223-46690245 CAGTGGGAAGGGAATGGGAAAGG - Intronic
906676753 1:47698772-47698794 CAGTGGGTGGAGGGGGGCGAGGG - Intergenic
907030332 1:51164698-51164720 CAGTGGCAGGGGTGGGTCATGGG + Intergenic
907092578 1:51741508-51741530 GAGAGGGAAGGGAAGGGCAAGGG - Intronic
907246361 1:53111525-53111547 GAGTGGCAGGGGAGGTGGAAGGG + Intronic
907255131 1:53173408-53173430 GAGAGGGAGGGGAGGGGAGAGGG - Intergenic
907267257 1:53270366-53270388 GAGGAGGAGGGGAAGGGCAAAGG + Intronic
907276481 1:53319658-53319680 GAGTGGCAGGGGAGGGGCTGAGG - Intronic
907309277 1:53530045-53530067 CAGCAGGATGGGAGGGGCAGGGG - Intronic
907696075 1:56730413-56730435 GAGAGGGAGGGGAGGGGGAGAGG + Intronic
907990371 1:59576393-59576415 CAGTCGGGGGGTAGGGGGAAAGG + Intronic
908089909 1:60675039-60675061 GAGAGGTAGGGGAGGGGTAAAGG - Intergenic
908235151 1:62141129-62141151 CATGGGAAGGGGAGGGGCAGAGG - Intronic
908544514 1:65149366-65149388 GAGTGGGAGGAGAGGGGGAAAGG - Intronic
910598146 1:89001920-89001942 CAGAGGAAGGGTAGGGGCCAGGG + Intergenic
910745965 1:90575283-90575305 CAGGGGGTGGGGAGGGGGAAGGG + Intergenic
911405397 1:97431849-97431871 TAGTGGGAGGGGAAGGGGAAGGG - Intronic
911475525 1:98367683-98367705 CAGTGGGGGAGGAGTGGCCAGGG - Intergenic
912449777 1:109761679-109761701 CAGTGGGAGGGCACGGGAGAGGG + Intronic
912451456 1:109770104-109770126 CTGTGGGAGGGCAGGGGAGAAGG + Intronic
912487598 1:110041487-110041509 GAGTGGGATGGGGGGGTCAAAGG - Intronic
912726560 1:112063926-112063948 CAGAAGGAGGGGAGGGCCAAGGG - Intergenic
912865780 1:113255057-113255079 CAGTGGTAGGTGAGGTGAAATGG - Intergenic
912909907 1:113747761-113747783 CAGTGGAAGGTGAGGGACAATGG - Intronic
913056000 1:115160052-115160074 GAGGGGTAGGGGAGGGGGAAAGG + Intergenic
913073824 1:115324447-115324469 TAGAGGGAAGGGAGGGGCCAGGG - Intronic
913162510 1:116157073-116157095 AGGTGGGAGTGGAGGGGCAAGGG - Intergenic
913534662 1:119759694-119759716 CAGAGGGAGGAGAGGAGAAATGG - Intronic
914226278 1:145721606-145721628 CAGCGGGATGGGAGGGGCGCAGG - Intronic
914760681 1:150595764-150595786 GAGGGGGAGGGGAGGGGGAGGGG + Intergenic
914858035 1:151366241-151366263 TACTGGGAGGGGAGGGCCAGAGG + Intronic
914980508 1:152410695-152410717 AAGTGGGAAGGGCGGGGAAAGGG - Exonic
915141957 1:153773445-153773467 CAGGAGGAGGGAAGGGGCTAGGG - Exonic
915309121 1:154998521-154998543 CAGTTGGAGGAGAGGGGTCACGG + Intergenic
915380378 1:155434290-155434312 CAGGGGGAGGGGAGGAGCTAGGG + Intronic
915495412 1:156279212-156279234 CGGGGGGTGGGGAGGGGCAGGGG - Intronic
915520556 1:156439970-156439992 CAGCGGGAGGGAGGGGGAAATGG - Intergenic
915558127 1:156671079-156671101 CAGTGTGAAGGGAGGGGCTGAGG - Exonic
915625455 1:157111606-157111628 CAGAGGGAGGGGAGGGAACAGGG + Intergenic
915735013 1:158078949-158078971 GAGTGGGTGAGGGGGGGCAAGGG - Intronic
915878791 1:159643408-159643430 GAGGGGGAGGGGAGGGGGAGGGG + Intergenic
915878805 1:159643431-159643453 AAGGGGGAGGGGAGGGGGGAGGG + Intergenic
915908045 1:159893603-159893625 GAGAGGAAGGGGAGGGGCATGGG + Intronic
915954752 1:160212539-160212561 CAGTCAGAGGGGAGGAGCCAGGG + Intronic
916131809 1:161617384-161617406 GAGGGGGAGGGGAGGGGGAGGGG + Intronic
916484921 1:165250075-165250097 CAGGGGGTGGGGTGGGGGAAGGG + Intronic
916575009 1:166059358-166059380 ATCTGGGTGGGGAGGGGCAAGGG + Intronic
917120136 1:171638453-171638475 CAGAGGGAGGGGAGGAGAAGAGG - Intronic
917746301 1:178011247-178011269 CAGTGGGAAATGAGGGGAAAGGG + Intergenic
918074383 1:181159344-181159366 CAGTGGGATGGGATGGGGCAGGG + Intergenic
918077064 1:181178482-181178504 CAGTGGGAGGGGGTGGTGAAGGG + Intergenic
918515563 1:185359039-185359061 CAGAGGGAGGGTATGGGCATGGG - Intergenic
919764540 1:201117815-201117837 CAGTCGGAAGGCAGGGGCTAGGG + Intronic
919888047 1:201949480-201949502 CAGGGGGAGGGGATGGGCATAGG - Intergenic
919977992 1:202625451-202625473 CAGTGTGCGGGGAGGGGGAAGGG + Intronic
919982497 1:202650991-202651013 GAGTGGGGTGGGAGGGGCATTGG + Intronic
919991070 1:202709163-202709185 CAGTGGGGAGGGAAGGGCAGAGG - Intronic
920129422 1:203720294-203720316 GAGTAGGAGGGGAGGGTGAAAGG + Intronic
920184548 1:204151924-204151946 GAGTGGTAGAGGAGGGGCCAGGG + Exonic
920199715 1:204252093-204252115 CCGAGGGTGGGGAGGGGCAGGGG - Intronic
920387401 1:205578722-205578744 CTGAGAGAGGGGAGGGGGAAAGG - Intronic
920743801 1:208606622-208606644 CAGTGTGTGTTGAGGGGCAAGGG - Intergenic
921371545 1:214428114-214428136 CACTGGACTGGGAGGGGCAAGGG + Intronic
921599177 1:217089126-217089148 CGCTGGGAGGGGAGGGGTTAGGG - Intronic
922043035 1:221915763-221915785 AAGTGGGTGGGGAGTGTCAATGG - Intergenic
922301219 1:224302760-224302782 CACTGGGAGGGCAGGTGCAGTGG + Intronic
922880064 1:228974165-228974187 CAGGGAGAGGGGTGGGGAAATGG - Intergenic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
922905012 1:229167657-229167679 GAGGGAGAGGGGAGAGGCAAGGG + Intergenic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923079575 1:230640968-230640990 CGGTGGGTGGGGAAGGGCAGAGG + Intergenic
923235821 1:232031670-232031692 CAGTGGGTGGGGGAGGGCAAGGG + Intronic
923290502 1:232540476-232540498 CATTCAGAGGGGATGGGCAATGG - Intronic
923419934 1:233802819-233802841 CAGTGGGAGAGGAGGAGAAGGGG + Intergenic
923534449 1:234838213-234838235 GAGGGGGAGGGGAGGGGAATGGG + Intergenic
923602083 1:235412177-235412199 GAGGGGGAGGGGAGGGGGAGGGG - Intronic
923672961 1:236056729-236056751 CCCTGGGAGGGGAGTGGCAGTGG - Intronic
923710592 1:236385886-236385908 GAGAGGGAGGGGAGAGGGAAAGG - Intronic
924049300 1:240064158-240064180 AAGTGGGAGGGGAGGGGAGTAGG + Intronic
924136000 1:240967565-240967587 AAGTGGGGGGGGGGGGGAAAAGG + Intronic
924146213 1:241077522-241077544 CAGTGGAAGGGGAGGAAAAAGGG + Intronic
924240073 1:242031901-242031923 AAGTGGGAGGGGAGTGGTGAGGG + Intergenic
924436304 1:244047381-244047403 AAGTGGTGGGGGAGGGGGAATGG - Intergenic
924444488 1:244116626-244116648 CAGAGGGAGGTGAGGAACAAAGG - Intergenic
924577583 1:245294274-245294296 GAGAGGGAGGGGAGGGGAGAGGG - Intronic
924703165 1:246474797-246474819 AAGTGGGAGGGAAGGAGAAAGGG - Intronic
1062805147 10:413866-413888 CTGTGCGAGGGGGTGGGCAAAGG + Intronic
1062822403 10:544532-544554 TAGTGGGAGGGGAAGGAAAATGG - Intronic
1062976354 10:1686229-1686251 CAGGGGCAGGGGATGGGCCAAGG + Intronic
1063121323 10:3106941-3106963 CAGGGTGAGGAGAGGGGCAGGGG - Intronic
1063207569 10:3849110-3849132 AAGGGGGAGGGGAGGGGGGAAGG - Intergenic
1063353127 10:5374241-5374263 GAGGGGGAGGGGAGGGGGAGGGG + Exonic
1063356087 10:5399718-5399740 GAGTGGGAGGGGTGGAGAAAAGG - Intronic
1063369842 10:5514072-5514094 CAGAGGGAGGAGAGGGGGCAGGG - Intergenic
1063377385 10:5562169-5562191 CAGTGGGAGGGCTGGAGCCATGG - Intergenic
1063403944 10:5774886-5774908 CAGGGGAAGGGGAAGGGCAAGGG + Intronic
1064340787 10:14483556-14483578 CAGTGGGAAGGGTTGTGCAAAGG + Intergenic
1064348398 10:14554175-14554197 CAGTGGGAGGGTAGAGGAAAAGG - Intronic
1064602477 10:17007620-17007642 CAGTGGGGAGGGTGGGGCAGGGG + Intronic
1064999849 10:21328512-21328534 CTGGGGGAGGGGAGCAGCAATGG - Intergenic
1065009370 10:21407703-21407725 CAGTGGAAGGGGAGCTGGAAAGG + Intergenic
1065194922 10:23255080-23255102 CAGTGGGTGGGAAGTGGCCAGGG + Intergenic
1065488328 10:26255639-26255661 AAAGGGGAGGGGAGGGGGAAGGG + Intronic
1065667676 10:28080077-28080099 GAGGGAGAGGGGAGGGGAAAAGG + Intronic
1065793003 10:29278770-29278792 CAGAGGTTTGGGAGGGGCAAGGG + Intergenic
1065925136 10:30428278-30428300 CAGTGGCAGAGGTGGGGCATGGG + Intergenic
1066131720 10:32401027-32401049 GAGAGGGAGGGGAGGAGGAAAGG - Intergenic
1066227683 10:33400168-33400190 GAGTGGGAAGGGAAGGGAAATGG - Intergenic
1067091012 10:43265943-43265965 CAGTGGGAGAAGAGTGGCAGTGG + Intronic
1067287148 10:44914916-44914938 CAGGGGCTGGGGAGTGGCAAAGG - Intronic
1067704191 10:48594880-48594902 CAGTTGGGGGGGAGGGGGAGGGG - Intronic
1067704577 10:48597417-48597439 CAGTGGGTGAGGAGAGGCAGTGG + Intronic
1067732871 10:48825104-48825126 CAGTGGGTGGGGTGGGGAGAGGG - Intronic
1067840084 10:49668737-49668759 CAGCAGGAGTGGAGGGGAAAGGG + Intergenic
1068318845 10:55383128-55383150 CAGTGGAAGGGGAGCTGGAAAGG + Intronic
1068631719 10:59304845-59304867 GAGGGGGAGGGGAAGGGAAAGGG + Intronic
1069833198 10:71293565-71293587 CACTGGGAGGTGAGGAGCCACGG + Exonic
1070161340 10:73868366-73868388 AGGTGGGAGGGGAGGGGGACAGG + Intronic
1070279012 10:75035370-75035392 GAGTGGAAGGAGAGGGGCAGAGG - Intergenic
1070362535 10:75704877-75704899 CAGTGAGAGAGGAGAGGGAAAGG + Intronic
1070442850 10:76463639-76463661 CGGTGGCAGGGGAGGGGGGAAGG + Intronic
1070443435 10:76469217-76469239 GATTGGGAGATGAGGGGCAAGGG - Intronic
1070711799 10:78688599-78688621 CAGCGGGCAGGCAGGGGCAAAGG + Intergenic
1070830135 10:79413160-79413182 TGCTGGGAGGGGAGGGGCAGAGG - Intronic
1070954232 10:80454124-80454146 CTGGGGGAGGGGCGGGGCCAGGG + Intergenic
1071292197 10:84195944-84195966 CAGAGAGAGGGGAGGAGAAAGGG + Intronic
1071328409 10:84538835-84538857 CAATGGGAAAGGAGGGGCAGGGG + Intergenic
1071581543 10:86775972-86775994 CAGTGGGAGAGGACTGCCAAGGG - Intronic
1072158851 10:92747943-92747965 CAGAGGGAGAAGAGGGGGAAGGG - Intergenic
1072713616 10:97734871-97734893 GAGTGGGTGGGGAGTGGCGATGG + Intergenic
1073083473 10:100873975-100873997 CAGGGGGAGGGGGCAGGCAAAGG + Intergenic
1073284439 10:102379210-102379232 CAGTGAGTGGGGAGGGGGAAAGG + Intronic
1073351489 10:102823037-102823059 CAGTGGGGTGGGAAGCGCAACGG - Intergenic
1073400040 10:103249938-103249960 CAGTGGGTGGGAAGGGGGCATGG + Intergenic
1073457769 10:103647903-103647925 CAGGGGGAGGGGAGGAGAAGAGG + Intronic
1073502142 10:103949870-103949892 CAGTGGAAGGGGCAGGGGAAAGG + Intergenic
1073541985 10:104322303-104322325 CAGTGGGAGTAGATGGGCAGTGG - Intronic
1073556647 10:104459597-104459619 CAGGGGGTGGGGTGGGGGAAGGG - Intergenic
1073592128 10:104767624-104767646 AAGTGGGAGGGGAAGGGGGAAGG - Intronic
1073592149 10:104767678-104767700 AAGTGGGAGGGGAAGGGGAAGGG - Intronic
1073615362 10:104989766-104989788 CAGTGGAAGAGGAGGCACAATGG + Intronic
1074154922 10:110789746-110789768 GAGTGGGATGGGAGGGGCTGAGG - Intronic
1074249707 10:111732402-111732424 AAGTGGGAGGGGAGGGACTGTGG - Intergenic
1074276845 10:112011585-112011607 CAGTGTCAGGGGAGGGTGAATGG - Intergenic
1075081210 10:119385105-119385127 CAGTTGGAGGGGAGGGAGGAGGG + Intronic
1075438784 10:122463141-122463163 CAGTGCCAGGAGAGGGGCATAGG + Intronic
1075724818 10:124605838-124605860 CAGTGGAGGGGGAGGGGGAAGGG + Intronic
1075975628 10:126691682-126691704 CAGTGGGATGGGAGCTGGAAAGG + Intergenic
1076007085 10:126956441-126956463 GAGTGGGAGGAGAGGGGCTCAGG + Intronic
1076405944 10:130212666-130212688 CAGTGGGAGGGGAGGGGAAGGGG - Intergenic
1076494912 10:130890753-130890775 AAGTGGGAAAGGAGGGGGAAGGG + Intergenic
1076495631 10:130895870-130895892 AAGCGGCAGGGAAGGGGCAAAGG - Intergenic
1076542234 10:131221386-131221408 CAGTGGGAGGTGGGTGGGAAAGG + Intronic
1076583817 10:131532208-131532230 GAGAGGGAGGGGAGGGGCCGAGG - Intergenic
1076643859 10:131937851-131937873 GAGTGGTAGGAGAGGGTCAAAGG + Intronic
1076676502 10:132149856-132149878 GAGGGGGAGGGGAGGGGCAGGGG - Intronic
1076824323 10:132959605-132959627 GATTGGGTGGGGAGGAGCAAAGG - Intergenic
1076856292 10:133116926-133116948 CAGAGGGCGGGGAGGGTAAAGGG + Intronic
1076902714 10:133347743-133347765 CTGGGGGAGGGGAGGGGCTGGGG + Intronic
1077017466 11:403332-403354 GAGAGGGAGGGGAGGAGGAAGGG + Intronic
1077231941 11:1461630-1461652 CAGTGGGGGGGCTGGGGCCAGGG + Exonic
1077252876 11:1568322-1568344 CAGAGGGAGGGGAGGGAGGAGGG + Intronic
1077412697 11:2410894-2410916 CTGTGGGAGGGCAGAGGCCAGGG + Intronic
1077484245 11:2831652-2831674 CAGTGGTGGGGAAGGGGAAAGGG - Intronic
1077497853 11:2895205-2895227 CAGTGGGGGCTGAGGGGCCAGGG + Intronic
1077914690 11:6603696-6603718 CGGTGGGAGGGGAGGGACGGAGG + Intronic
1077915767 11:6610744-6610766 CAGTGGTAGGGATGGGGGAAGGG - Exonic
1077949881 11:6944929-6944951 CAGTGGAGGGGCAGGGGGAATGG - Intronic
1078146638 11:8726148-8726170 CAGTGGGAGAAGAGGGGTACAGG + Exonic
1078372972 11:10766167-10766189 CATTGGGAGTGGAGTGGCAGAGG + Intronic
1078384120 11:10872775-10872797 AAGAGGAAGGGGAGGGGTAAGGG - Intergenic
1078389124 11:10920500-10920522 GAGTGGGAGGAGAGAGGCAGAGG - Intergenic
1078637314 11:13064230-13064252 CAGTGGTAGGGGAGTGGAAAGGG - Intergenic
1078651852 11:13202592-13202614 AGGCGGGAGGGAAGGGGCAAAGG + Intergenic
1078741999 11:14075427-14075449 CTGTGGGTGGGGAGGGGGAGGGG + Intronic
1079129413 11:17738611-17738633 CAGTGGGAGGAGAGGGCCAGGGG - Intronic
1079360314 11:19765451-19765473 CAGAGGGAGGGGAAGGGGAAGGG - Intronic
1079474463 11:20814436-20814458 CGGTGGGAGGGTGGAGGCAAGGG - Intronic
1080176397 11:29368051-29368073 AAATGGTAGGGAAGGGGCAAAGG - Intergenic
1080609104 11:33888465-33888487 CAGAGGGAGGGAAGGAGGAAGGG - Intronic
1080844533 11:36015302-36015324 CAGGGGGCGGGGGGGGGGAATGG - Intronic
1080870039 11:36229125-36229147 CAGCAGGGGGGCAGGGGCAATGG - Intronic
1081717120 11:45258316-45258338 CAGTGGGGGTGGAGGTGCAAAGG - Intronic
1081870044 11:46379282-46379304 AAATGGGAGGGGTGGGGAAAAGG - Intronic
1082132350 11:48506184-48506206 GAGGGGGAAGGGAGGGGAAAGGG - Intergenic
1082132355 11:48506195-48506217 AAGAGGGAAGGGAGGGGGAAGGG - Intergenic
1082853825 11:57788671-57788693 GGGTGGGAAGGGAGGGGGAAGGG + Intronic
1083261410 11:61524992-61525014 CGGTGGGAGGGAAAAGGCAAAGG + Intronic
1083433157 11:62625379-62625401 TGGTGGGAGGGAAGGGGAAAAGG + Exonic
1083784186 11:64934348-64934370 CAGGGGGAGGGGGAGGGCACAGG + Exonic
1083938103 11:65880959-65880981 CAGCGAGAGGGCAGGGGCAGGGG - Intronic
1083985302 11:66210663-66210685 CAGAGGAAGGGAAGGGGCCACGG - Intronic
1084104892 11:66975015-66975037 AAGGGGGAGGGGAGGGGAGAAGG + Intergenic
1084104928 11:66975078-66975100 GAGGGGGAGGGGAGGGGGAGGGG + Intergenic
1084669041 11:70594593-70594615 CTGAGGGCGGGCAGGGGCAATGG + Intronic
1084782893 11:71422696-71422718 CAGGGGGTGGGGTGGGGGAACGG + Intergenic
1084809473 11:71603552-71603574 CACTGGGGGGGGCGGGGCAGGGG + Intergenic
1084839074 11:71830816-71830838 GAGGGGGAGGGGAGGGGGAGGGG - Intergenic
1085024474 11:73228580-73228602 CAGTGGGAGGGGATTGGACATGG - Intronic
1085445385 11:76597703-76597725 CAGTGGCAGGGGAGCGGGGACGG + Intergenic
1086165448 11:83772492-83772514 AAGGGGGAGGGGAAGGGGAAGGG + Intronic
1086243653 11:84725393-84725415 CAGTAGGAGAGGAGAGGGAAAGG - Intronic
1086505709 11:87502090-87502112 CAGAGGGAGGAGTGGGGGAAGGG - Intergenic
1087497086 11:98905857-98905879 AGGTGGGAGGGGATGGTCAATGG - Intergenic
1087887231 11:103495043-103495065 CAGTGGGATGGGAGTTGGAAAGG - Intergenic
1088259301 11:107928941-107928963 CCCTGGAAGAGGAGGGGCAAAGG - Intronic
1088821416 11:113460673-113460695 TGGTGGGAGGAGAGGAGCAAAGG - Intronic
1088999807 11:115042311-115042333 CAAGGGGAGGGAAGAGGCAAAGG + Intergenic
1089065441 11:115659122-115659144 CAGGGGGAGGGGAAGGACACAGG + Intergenic
1089347294 11:117798609-117798631 CTGGGGGAGGGGAGGGGAAGGGG - Intronic
1089350837 11:117820731-117820753 CAGGGGGAGGGGTGGGTCTAGGG + Intronic
1089365386 11:117918201-117918223 CAGTGGAAAATGAGGGGCAAAGG - Intronic
1089389082 11:118087775-118087797 CAGTGGTAGGGGTGGGGAATAGG + Intronic
1089458260 11:118638221-118638243 AAGAGGGAGGGGAGCTGCAAAGG + Intronic
1089622603 11:119730154-119730176 CAGGGGGAGGGGATGGGGATAGG - Intergenic
1090062625 11:123477263-123477285 GAGGGAGAGGGGAGGGGGAAGGG - Intergenic
1090226405 11:125074620-125074642 GAGTGGGGTGGGAGGGGAAAGGG + Intronic
1090444993 11:126756731-126756753 CATTGGGAGTGGAGGTGGAATGG - Intronic
1090640742 11:128726903-128726925 CTGAAGGAGGGGAGGGACAACGG + Intronic
1090855524 11:130607043-130607065 CAGTGGGAGGTAAGGGGGCAGGG - Intergenic
1091211331 11:133864020-133864042 CAGTGGCGGGGGAGGGGCGGGGG + Intergenic
1091297399 11:134483447-134483469 CAGTGGGACTCGAGGGGCACTGG + Intergenic
1091397515 12:163133-163155 GAGAGGGAGGGGAGGGGCTCCGG - Intronic
1091422998 12:359765-359787 GAGTGGGAGGGAAGGAGGAAGGG + Intronic
1091692338 12:2605653-2605675 CAGTGGGAAGGGACGGGGAGAGG - Intronic
1091710148 12:2734121-2734143 CAGGGGAAGGGGAAGGGAAAGGG + Intergenic
1091908051 12:4205347-4205369 CAGTGGGAGAGCAAGGACAAAGG + Intergenic
1092396681 12:8133721-8133743 CAGGGGGAGGGGAGGAGCTAGGG - Intronic
1092817297 12:12323035-12323057 GAGGGGGAGGGGAGGGGGGAGGG + Intergenic
1092817326 12:12323097-12323119 GAGGGGGAGGGGAGGGGGAGGGG + Intergenic
1092817343 12:12323124-12323146 GAGGGGGAGGGGAGGGGGAGGGG + Intergenic
1093304451 12:17496248-17496270 CAATGGGAGGCTAGAGGCAATGG + Intergenic
1093513880 12:19962230-19962252 CAATGGGATGAGAGGGGAAAGGG - Intergenic
1093523469 12:20077072-20077094 CTGTCGGTGGTGAGGGGCAAGGG + Intergenic
1094298595 12:28935794-28935816 CAGTGAGAAGGGAGGGGCGGGGG - Intergenic
1094555697 12:31497815-31497837 GAGGGGGCAGGGAGGGGCAAGGG + Intronic
1094555730 12:31497877-31497899 GAGGGGGCAGGGAGGGGCAAGGG + Intronic
1095203765 12:39415760-39415782 GAGTAGGTGGGGAGAGGCAAAGG - Intronic
1095529029 12:43162661-43162683 GAGTGGGTGGGGTGGGGAAAGGG + Intergenic
1096205915 12:49721773-49721795 TGGTGGGAGGGAAGGGGCAAGGG - Intronic
1096205928 12:49721823-49721845 GGGTGGGAGGGAAGGGGCAAGGG - Intronic
1096255007 12:50057591-50057613 CGGCGGGAGGGGAGGGGGAGGGG - Exonic
1096356888 12:50948876-50948898 GAGGGGGAGGGGAGGGGGAGGGG + Intergenic
1096498874 12:52053813-52053835 CACTGCGAGGGGAGGAGAAAAGG + Intronic
1096528401 12:52228104-52228126 GAGGGGGAGGGGAGGGGGAAGGG - Intergenic
1096528407 12:52228115-52228137 GAGGGGGAGGGGAGGGGGAGGGG - Intergenic
1096659864 12:53117689-53117711 CAGTGGGAGGGTGGTGCCAAGGG + Intronic
1096696947 12:53355331-53355353 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
1097067109 12:56328667-56328689 CACTTAGAGTGGAGGGGCAAGGG + Intronic
1097110244 12:56652453-56652475 GAGGGGGAGGGGAGGGGGAGGGG + Intergenic
1097110249 12:56652464-56652486 GAGGGGGAGGGGAGGGGGAGAGG + Intergenic
1097223416 12:57463191-57463213 CTGAGTGAGGGGAGGGGTAAGGG - Intronic
1097290097 12:57907228-57907250 CAGTGGGAGAGGGGTTGCAAGGG - Intergenic
1097293453 12:57939894-57939916 GAGTGGGAGGGGAAGGGTGAGGG + Intergenic
1097748226 12:63323452-63323474 CAGTGGGTTGCCAGGGGCAAGGG + Intergenic
1098392846 12:69987301-69987323 CAGTTGGAGGCATGGGGCAAAGG + Intergenic
1098928163 12:76376921-76376943 TATTGGGAGGTGGGGGGCAAGGG - Intronic
1099438325 12:82669619-82669641 CAGTCGGGGCTGAGGGGCAATGG + Intergenic
1099478238 12:83134604-83134626 CGGGGGGAGGGTTGGGGCAAGGG + Exonic
1099568704 12:84285605-84285627 AAGTGGCAGGGCAGGGGCCAAGG + Intergenic
1100361055 12:93879816-93879838 CACTGGGAGAGGTGGGGCACTGG + Intronic
1100436871 12:94579173-94579195 CAGTGAGAGGGGCAGGGCACAGG - Intronic
1100521711 12:95381584-95381606 GACTGGGAGGGGTGGGGCAGGGG + Intergenic
1100606722 12:96158096-96158118 GAGGGGGAGGGGAGGGGGAGGGG - Intergenic
1100637951 12:96453622-96453644 AAGGGGGAGGGAAGGGGAAATGG + Intergenic
1100702749 12:97165189-97165211 AAGGTGGAGGAGAGGGGCAAAGG + Intergenic
1101148414 12:101863302-101863324 CAGTGGGATGGGAGTTGGAAAGG + Intergenic
1101202291 12:102449389-102449411 CAGTCGGGGGGTGGGGGCAAGGG + Intronic
1101348593 12:103907280-103907302 CAGATGGAGGGGAGGGGGAGGGG + Intergenic
1101348598 12:103907291-103907313 GAGGGGGAGGGGAGGGGCAAGGG + Intergenic
1101467897 12:104966561-104966583 AAGGGAGTGGGGAGGGGCAAGGG + Intergenic
1101523487 12:105506234-105506256 CAGTGGCAGGGGTGGGGTGAAGG + Intergenic
1101673317 12:106896652-106896674 GAAGGGGAGGGGAGGGGGAAGGG + Intergenic
1101680103 12:106956142-106956164 CACTGGGAGGTGAGGGGCAGGGG - Intronic
1101693051 12:107098457-107098479 GAGGGGGAGGGGAGGGGAAGAGG + Intergenic
1101710001 12:107256462-107256484 CCCAGGGAGGGGAGGGGAAAGGG - Intergenic
1101798977 12:108003904-108003926 CAGTGGCAGGGGGAGGGCTATGG + Intergenic
1101865116 12:108515059-108515081 CAGCGGGAGGGGCGGGGCCTAGG - Intergenic
1101972428 12:109324868-109324890 CTGTTGGAGGGTAGGGGAAAAGG - Intergenic
1102146245 12:110657142-110657164 CAGGGCTAGGGGAGGGGGAATGG + Intronic
1102628156 12:114252947-114252969 CAGTGGGAGGGAAGAGGCAGAGG - Intergenic
1102651204 12:114443828-114443850 CACTGGGAGGGGAGGGTCGCTGG + Intergenic
1102984244 12:117265511-117265533 CTGTGGGAGGAGAGGGGACAGGG + Intronic
1102993339 12:117330397-117330419 CAGTGGGAGCAGAGGGGTCAAGG - Exonic
1103569068 12:121832203-121832225 CAGGGGGAGGGGTGAGGCAAGGG - Exonic
1103775696 12:123364872-123364894 GAGGGGCGGGGGAGGGGCAACGG + Intergenic
1103978960 12:124723590-124723612 CTGCGGGGGGGGGGGGGCAAGGG + Intergenic
1104337678 12:127915340-127915362 GTGTGGGAGGGAAGGGGAAAAGG - Intergenic
1104390562 12:128387958-128387980 CAGAGGGCGGGGAAGGGCACAGG - Intronic
1104795959 12:131517900-131517922 GAGAGAGAGGGAAGGGGCAAGGG + Intergenic
1104820200 12:131672680-131672702 CAGTGGGAATGGGGGTGCAAAGG - Intergenic
1105007309 12:132729463-132729485 GGGTGGGAGGGGAGGGGGAGGGG + Intronic
1105637540 13:22229807-22229829 CAGTGCTGGGGGAGGAGCAATGG - Intergenic
1105726242 13:23164985-23165007 CAGTGGGAGGGGAGGGCCACAGG - Intergenic
1106075488 13:26457352-26457374 AAGTGGGAGAGGAGGGGACAAGG - Intergenic
1106531257 13:30594357-30594379 GAGCGGGAGGGAGGGGGCAAGGG - Intronic
1106632539 13:31491259-31491281 CGGTGGGAGGGGGGTGGTAAAGG + Intergenic
1107437531 13:40393406-40393428 TATTGGGGGGTGAGGGGCAAGGG + Intergenic
1107482329 13:40795121-40795143 ATGGGGGAGGGGAGGGGGAAAGG - Intronic
1108272597 13:48776537-48776559 CATTGTGAGGGGAGTGACAAGGG + Intergenic
1108408349 13:50125616-50125638 CGGGGGGAGGGGAGGGGGAGGGG - Intronic
1108699637 13:52932974-52932996 CAGAGGGTGGGGAGGGGCCTGGG - Intergenic
1108837039 13:54563385-54563407 AAGCAGGAGGGGTGGGGCAAGGG + Intergenic
1109207040 13:59494154-59494176 CAGTGGGAGCATGGGGGCAAGGG - Intergenic
1109458557 13:62625560-62625582 CAGTGGGACGGGAGTTGGAAAGG + Intergenic
1109579151 13:64302746-64302768 CAGGGTGAGGGGAGAGGGAAGGG + Intergenic
1111188113 13:84770426-84770448 CAGTGTGGGGAGGGGGGCAATGG - Intergenic
1112399900 13:99067505-99067527 CTTTGGGAGAGGAGGGGCAGAGG - Intronic
1112506850 13:99980797-99980819 CGGGGGGAGGGGAGAGGAAAAGG + Intergenic
1112536536 13:100262672-100262694 GAGAGGGAGGGGAAGGGGAAGGG - Intronic
1112932424 13:104758523-104758545 CAGGGGCGAGGGAGGGGCAATGG + Intergenic
1113796533 13:113061742-113061764 GAGAGGGAAGGGAGGGGAAAGGG - Intronic
1113796543 13:113061765-113061787 GAGAGGGAGGGGAGGGGAAGGGG - Intronic
1113798566 13:113074711-113074733 GTGTGGGAGGGGAGGGGTACAGG - Intronic
1113813941 13:113158992-113159014 CGGGGAGAGGGGAGGGGGAAAGG + Intronic
1113868314 13:113543306-113543328 CAGAGGGAGGGCGGGGGCAGGGG - Intronic
1113901550 13:113800904-113800926 CTGCGGGAGGTGAGGGGCACCGG + Exonic
1113940824 13:114017867-114017889 GAGTGAGTGGGGAGGGGAAACGG - Intronic
1114345451 14:21789822-21789844 CAGTGGAAGGGGAGCTGGAAAGG - Intergenic
1114417150 14:22552523-22552545 CAGTCTGAGAGGAGAGGCAAAGG - Intergenic
1114450066 14:22819610-22819632 AGGTGGGAGAGGAGGGACAATGG - Intronic
1114613783 14:24057878-24057900 AGGTGGGAGAGGAGGGGGAAGGG + Exonic
1115389786 14:32841970-32841992 GAGGGGGAGGGGAGGGGGAGGGG - Intergenic
1115498229 14:34027326-34027348 GAGGGGGAGGGAAGGGGGAAGGG + Intronic
1115656638 14:35449612-35449634 CAATGTTAGGGGAGGGGAAATGG + Intergenic
1115724166 14:36194691-36194713 GAGGGGGAGGGGAGGGGGAGGGG + Intergenic
1116153098 14:41167164-41167186 CAGGGGAAAGGGAGGGGAAAGGG - Intergenic
1116501919 14:45634437-45634459 GAGGGGGAGGGGAGGGGGAGAGG - Intergenic
1116501946 14:45634488-45634510 GAGGGGGAGGGGAGGGGGAGGGG - Intergenic
1116547153 14:46182790-46182812 CTGTTGGGGGGCAGGGGCAAGGG - Intergenic
1117414340 14:55479931-55479953 CTATGGGAGGGGAGGGGAGAGGG - Intergenic
1117478556 14:56119690-56119712 CAGTGAAAGGGGAGGGGGAAGGG + Intronic
1118253461 14:64183972-64183994 GAGGGGGAGGGGAGGGGGAGAGG + Intronic
1118371123 14:65137893-65137915 CAGTGAGTGGGGATGGGCCACGG - Intergenic
1118430062 14:65708848-65708870 GTGTGGGAGGGGATGGGGAAAGG + Intronic
1118430355 14:65713037-65713059 TAGTGGGAGGTGGGGGGTAAGGG - Intronic
1118551676 14:66957793-66957815 CAGTGGGAGGTGAGCAGCAGCGG + Intronic
1118607495 14:67514741-67514763 CAGGGGGAAGCGAGGGGCAGCGG - Intronic
1118678160 14:68211210-68211232 CACTGGGTGGGGAGGGGAAAGGG - Intronic
1118821534 14:69349276-69349298 CAGTGGGAGGGGGTGGGCGTGGG - Intronic
1118866547 14:69708836-69708858 CAGTGGGAGGAGCGTGCCAAGGG + Exonic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1119184838 14:72632817-72632839 GAGGGGAAGGGGAGGGGAAAGGG + Intronic
1119855287 14:77895762-77895784 CAGTGGGTGGGGAGGGGGTCAGG - Intronic
1120392046 14:83921413-83921435 AAGTGTGAGGGGTGGGGAAATGG + Intergenic
1120614692 14:86688820-86688842 CAGTGGAAGGGGAGCTGGAAAGG - Intergenic
1121227782 14:92334027-92334049 AAGTGGGTGAGGAGGTGCAATGG + Intronic
1121377309 14:93424718-93424740 TAGTGGGGGTGGAGGGGCAATGG + Intronic
1121447445 14:93987953-93987975 GTGGGGGAGGGGAGGGGCCAGGG + Intergenic
1121547045 14:94770141-94770163 CAGGGGGCGGGGAGGGGCGCAGG - Exonic
1122141191 14:99664056-99664078 GAGTGGGAGGGGAGAGGAAGAGG + Intronic
1122144263 14:99679934-99679956 CAGTGGGGGAGGAGGGGCGAGGG - Exonic
1122208305 14:100159361-100159383 CCCAGGGAGGGGAGCGGCAATGG + Intronic
1122343744 14:101045386-101045408 CTCTGGCAGGGGTGGGGCAAGGG + Intergenic
1122448144 14:101782903-101782925 GAGAGGGAGGGGAGGGGGAAGGG - Intronic
1122462309 14:101905735-101905757 CAGTAGGAGGGCAGGGGAACAGG - Intronic
1122616577 14:103022088-103022110 CAGAGAGAGGGGAGGGGCCAAGG + Intronic
1122686836 14:103512667-103512689 CACAGGGAGGCGAGGGGCACTGG + Intergenic
1122978053 14:105179069-105179091 CAGTGGTGGGGAAGGGGCATGGG - Intronic
1122993771 14:105251480-105251502 GAGTGGGAGGAGAGAGACAAGGG - Intronic
1123103235 14:105819651-105819673 CCGTGGGTGGGGAGGGCAAATGG + Intergenic
1202894211 14_KI270722v1_random:188738-188760 CAGTGGGATGGGTGGGGAATTGG - Intergenic
1123422152 15:20142907-20142929 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1123442921 15:20303710-20303732 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1123531380 15:21149447-21149469 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1123721365 15:23064520-23064542 CATTGGCTGGGGAGGGGCACTGG - Intergenic
1123989224 15:25671051-25671073 TAGTGGGAAGGGAGGGGATAAGG + Intergenic
1123989971 15:25675952-25675974 AAGGGGAAGGGGAGGGGAAAGGG + Intergenic
1124026619 15:25972802-25972824 GAGTGGGAGAGCAGGGGCCAGGG + Intergenic
1124493600 15:30173375-30173397 CAGTGTGCGGGGAGGGGGAAGGG + Intergenic
1124749968 15:32365274-32365296 CAGTGTGCGGGGAGGGGGAAGGG - Intergenic
1125101625 15:35919644-35919666 CAGTGGGGGGGGGGGGGGAGTGG + Intergenic
1125350316 15:38759988-38760010 CTGTGGTAGGGGTGGGGCAGAGG + Intergenic
1125359452 15:38850060-38850082 CATTGGGTGGGGAGGGTCCATGG - Intergenic
1125447748 15:39776149-39776171 CAGAGGGAGGGGAGGAGCAGAGG + Intronic
1125447757 15:39776166-39776188 CAGAGGGAGGGGAGGGGCGGAGG + Intronic
1125507559 15:40275786-40275808 GAGGGGGTGGGGAGGGACAAGGG + Intronic
1125510326 15:40289170-40289192 CAGTGAGAGGGTAGGGGAAGGGG - Intronic
1125673007 15:41486854-41486876 CAGTGCGAGGGGAGGTGAAGGGG - Intergenic
1125686719 15:41567944-41567966 CTGTGAGAGGGGAGTGGTAAGGG + Intronic
1125712266 15:41796563-41796585 CTGTGGAAGGGGAGGAGCAGGGG - Intronic
1125733843 15:41909989-41910011 CAGGAGGAGGGGAGGGTCCAGGG + Intronic
1126105281 15:45143169-45143191 CACTGGGAGGGCAGAGGCAGAGG - Exonic
1126257461 15:46644437-46644459 AAGTGGAAAGGGAGGGGAAATGG + Intergenic
1126476917 15:49074933-49074955 CTGTGGGAGGTGAGGGGGTAGGG + Intergenic
1126642489 15:50841970-50841992 GAGGGGGAGGGGAAGGGCAAGGG - Intergenic
1126797747 15:52274047-52274069 GAGAGGGTGGGGAGGGGCAGAGG - Intronic
1126845195 15:52753219-52753241 AAGGGGGAGGGGTGGGGGAAGGG + Intergenic
1126849276 15:52787641-52787663 GAGTGGGGGGGGAGGGGGCATGG + Intronic
1127298082 15:57627393-57627415 GAGGGGGAGGGGAGGGGAAGGGG + Intronic
1127470104 15:59282877-59282899 GAGAGGGAGGGGAGGGGGGAGGG + Intronic
1127507596 15:59610966-59610988 GAGGGGGAGGGGAGGGGGAGGGG - Intronic
1127507613 15:59610993-59611015 GAGGGGGAGGGGAGGGGGAGGGG - Intronic
1127507620 15:59611004-59611026 GAGGGGGAGGGGAGGGGGAGGGG - Intronic
1127507627 15:59611015-59611037 GAGGGGGAGGGGAGGGGGAGGGG - Intronic
1127674472 15:61227419-61227441 CAGCGGGAGGGGGGCGGCGAGGG - Intronic
1127698625 15:61475449-61475471 CAGTGGGAGGGAAGAGGGCAAGG + Intergenic
1127824539 15:62691050-62691072 GAGGGGGAGGGGAGGGGGAGGGG + Intronic
1127828390 15:62726866-62726888 AATTGGGAGGGGAGGGGGCATGG + Intronic
1127866973 15:63041468-63041490 CAGTGGGAGGGGAGGAGAGGGGG - Intergenic
1128146141 15:65333419-65333441 CAGAGGAAGGGGAGGGGGGATGG + Intronic
1128252620 15:66173688-66173710 CCTGGGGAGGGGAGGGGTAATGG - Intronic
1128254637 15:66187654-66187676 CCCTCGGAGGGGAGGAGCAATGG + Intronic
1128512262 15:68320519-68320541 CACTGGGAGGAGAGTGGAAATGG + Intronic
1128609197 15:69060226-69060248 TCGTGGGAGGGGAGGGGGCATGG + Intronic
1128738272 15:70065974-70065996 CAGAGGGTGGGGCGGGGCAGGGG - Intronic
1128769609 15:70272035-70272057 CAGGGGAATGTGAGGGGCAAAGG - Intergenic
1128884316 15:71272429-71272451 AAGTGGGGAGGGAGGGGCAAAGG + Intronic
1129111671 15:73340684-73340706 GAGTGGGAGGGCAGTGGCAGGGG - Intronic
1129192018 15:73942821-73942843 CAGTGGGAGAGAAGGGGGGAGGG - Intronic
1129245682 15:74277403-74277425 CGGTGGGCGTGGAGGGGCCATGG + Intronic
1129296794 15:74604247-74604269 CAGTGGGCTGGGTGGGGCAGGGG + Intronic
1129424586 15:75454559-75454581 CAGCGGGCGGGGAGGGGCGCGGG - Intronic
1129442153 15:75589024-75589046 GAGTGGGAGGGGAGGGGAGAGGG + Intergenic
1129665435 15:77576989-77577011 CTGTGGGAAGGCAGGGGCTATGG - Intergenic
1129819033 15:78583924-78583946 AAGTGGGAGGTGAGAGGCAAGGG - Intronic
1129898792 15:79129745-79129767 CAGTGGGTTTGGAGGGGCATAGG - Intergenic
1130307096 15:82720501-82720523 CAGGGGGAGGGGAGGGGGAGGGG - Intergenic
1130750372 15:86705131-86705153 CAGTGGCTGGTGGGGGGCAAGGG + Intronic
1130957631 15:88638777-88638799 GAGGGGGAGGGCCGGGGCAAAGG + Exonic
1131370271 15:91875315-91875337 CAGTGGGAGGGGAGGGTCAGAGG - Intronic
1131522517 15:93127052-93127074 AAGTGGAAGGAGACGGGCAAAGG + Intergenic
1131641581 15:94299041-94299063 CAAAGGGAGGGGAAGGGGAAGGG - Intronic
1131885507 15:96907791-96907813 CAGTGGAAGGGGAGCTGAAAAGG + Intergenic
1132055356 15:98647814-98647836 CAGGGGGAGCGGAGGGGGAAGGG - Intergenic
1132184035 15:99788360-99788382 CAGAGGGAGGGAAGGAGGAAAGG - Intergenic
1132317474 15:100900554-100900576 CACTGGAGGGGGAGGGGCGAGGG - Exonic
1132520299 16:384178-384200 CAGTGGGAGGAGGGGGGCTTGGG - Intronic
1132607412 16:799425-799447 CAGTGGGAGGGTAGGAGCTGGGG - Intronic
1132610995 16:816314-816336 CAGTGCCAGGGGAGGGACACGGG - Intergenic
1132730000 16:1356492-1356514 CAGGCGGAGGGGAGGGGCCGTGG + Intronic
1132854877 16:2040288-2040310 CTCTGGGCGGGGAGGGGCACGGG - Intronic
1132997506 16:2830827-2830849 CTGTGGGATGGGAGGGGACATGG - Intronic
1133015336 16:2937090-2937112 AAATGGGAGGGGAGGAGCAGCGG - Intronic
1133034702 16:3028311-3028333 CCGTGTGCGGGGCGGGGCAAGGG - Intronic
1133215800 16:4291737-4291759 CAGAGAGAGTGGAGGGTCAAAGG + Intergenic
1133336793 16:5011532-5011554 CAGTTGGAGGGGAGGAGAAGGGG + Intronic
1133368322 16:5228610-5228632 GAGGGGGAGGGGAGGGAAAAAGG + Intergenic
1133568828 16:7022014-7022036 GAGGGGAAGGGGAGGGGGAAGGG - Intronic
1133976069 16:10600668-10600690 GAGAGGGAGGGGAGGGGCCCGGG + Intergenic
1134079531 16:11315577-11315599 GAGGGGGAGGGGAGGGCTAAGGG - Intronic
1134167333 16:11941303-11941325 CAGGGGGAGGGAAGGGGACAGGG + Intronic
1134167355 16:11941348-11941370 GAGGGGGAGGGGAGGGGGAGGGG + Intronic
1134493339 16:14712333-14712355 GAGGGGGAGGGGAGGGGGAGGGG - Intronic
1134498720 16:14751457-14751479 GAGGGGGAGGGGAGGGGGAGGGG - Intronic
1134523124 16:14927656-14927678 GAAGGGGAGGGGAGGGGCTAGGG - Intronic
1134523138 16:14927683-14927705 AAGGGGGAGGGGAGGGGTTAGGG - Intronic
1134523562 16:14928949-14928971 CAGGGGGAAGGGAGGGGAAGGGG - Intronic
1134525274 16:14938087-14938109 GAGGGGGAGGGGAGGGGGAGGGG - Intronic
1134549419 16:15132211-15132233 AAGGGGGAGGGGAGGGGCTAGGG + Intronic
1134549493 16:15132374-15132396 GAGGGGGAGGGGAGGGGTTAGGG + Intronic
1134549507 16:15132402-15132424 AAGGGGCAGGGGAGGGGCTAGGG + Intronic
1134581853 16:15377628-15377650 GAGGGGGAGGGGAGGGGGAGGGG + Intronic
1134581858 16:15377639-15377661 GAGGGGGAGGGGAAGGGGAAGGG + Intronic
1134602327 16:15543112-15543134 CAGTGGAAGGGGAGCTGGAAAGG + Intronic
1134710791 16:16326307-16326329 GAAGGGGAGGGGAGGGGCTAGGG - Intergenic
1134710805 16:16326334-16326356 AAGGGGGAGGGGAGGGGTTAGGG - Intergenic
1134712862 16:16336571-16336593 GAGGGGGAGGGGAGGGGGAGGGG - Intergenic
1134720721 16:16379878-16379900 GAGGGGGAGGGGAGGGGGAGGGG - Intronic
1134720728 16:16379889-16379911 GAGGGGGAGGGGAGGGGGAGGGG - Intronic
1134770633 16:16806111-16806133 GAGAGGGAGGGGAAGGGGAAGGG - Intergenic
1134946699 16:18331996-18332018 GAGGGGGAGGGGAGGGGGAGGGG + Intronic
1134946706 16:18332007-18332029 GAGGGGGAGGGGAGGGGGAGGGG + Intronic
1134948796 16:18342311-18342333 AAGGGGGAGGGGAGGGGTTAGGG + Intergenic
1134948810 16:18342338-18342360 GAAGGGGAGGGGAGGGGCTAGGG + Intergenic
1134953958 16:18372111-18372133 GAGGGGGAGGGGAGGGGGAGGGG + Intergenic
1134953965 16:18372122-18372144 GAGGGGGAGGGGAGGGGGAGGGG + Intergenic
1134955748 16:18381470-18381492 CTAGGGGAGGGGAGGGGCTAGGG + Intergenic
1134955780 16:18381536-18381558 AAGGGGGAGGGGAGGGGTTAGGG + Intergenic
1134955794 16:18381564-18381586 AAAGGGGAGGGGAGGGGCTAGGG + Intergenic
1135312786 16:21418996-21419018 GAGGGGGAGGGGAGGGGGAGGGG + Intronic
1135365702 16:21851265-21851287 GAGGGGGAGGGGAGGGGGAGGGG + Intronic
1135365709 16:21851276-21851298 GAGGGGGAGGGGAGGGGGAGGGG + Intronic
1135446105 16:22519886-22519908 GAGGGGGAGGGGAGGGGGAGGGG - Intronic
1136024856 16:27462745-27462767 CATTGGCAGGAGAGGGACAAGGG + Intronic
1136151948 16:28356752-28356774 GAGGGGGAGGGGAAGGGGAAGGG + Intronic
1136168185 16:28470590-28470612 GAGGGGGAGGGGAAGGGGAAGGG + Intronic
1136194792 16:28644428-28644450 GAGGGGGAGGGGAGGGGGAGGGG - Intronic
1136194803 16:28644445-28644467 GAGGGGGAGGGGAGGGGGAGGGG - Intronic
1136194814 16:28644462-28644484 GAGGGGGAGGGGAGGGGGAGGGG - Intronic
1136211130 16:28758530-28758552 GAGGGGGAGGGGAAGGGGAAGGG - Intronic
1136309458 16:29397749-29397771 GAGGGGGAGGGGAGGGGGAGGGG + Intronic
1136322899 16:29499504-29499526 GAGGGGGAGGGGAGGGGGAGGGG + Intronic
1136437583 16:30239472-30239494 GAGGGGGAGGGGAGGGGGAGGGG + Intronic
1136478661 16:30527728-30527750 AAGGTGGAGGGGAGAGGCAAGGG - Intronic
1136499835 16:30664692-30664714 CTGTGGGAGGGGACGGGAGAAGG - Intronic
1136541270 16:30928665-30928687 CAGGGTGAAGGGTGGGGCAAGGG - Intronic
1136718322 16:32301972-32301994 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1136773638 16:32860174-32860196 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1136836696 16:33508242-33508264 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1136862684 16:33712768-33712790 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1136896973 16:34001345-34001367 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1137286117 16:47017077-47017099 CAGGGGGTAGGGAAGGGCAAAGG + Intergenic
1137537951 16:49341830-49341852 CAGAGGGAGTGGCAGGGCAAAGG + Intergenic
1137775372 16:51049790-51049812 CAGGGGGAGGGTTGGGGGAATGG - Intergenic
1137787961 16:51152532-51152554 CGGGGGGAGGGGAGGGGCTGCGG + Intergenic
1138417893 16:56881634-56881656 CAGTAGCAGGGGAGGGGAACAGG + Intronic
1138667716 16:58586298-58586320 GAGGGGGAGGGGAGGGGAAGGGG + Intronic
1138795434 16:59962664-59962686 CAGTTGGAAGGGAGGGACATCGG + Intergenic
1139222357 16:65196559-65196581 CAAAGGAAGGTGAGGGGCAATGG - Intergenic
1139295684 16:65898439-65898461 AAGTTGGAGGAGTGGGGCAAAGG + Intergenic
1139320401 16:66109670-66109692 GAAGGGGAGGGGAGGGGAAAGGG + Intergenic
1139371487 16:66471994-66472016 GAGTGGGAGGAGCTGGGCAAGGG - Intronic
1139511859 16:67432241-67432263 CAGAGGGAGGGAAGGGGAAGGGG + Intronic
1139583423 16:67886189-67886211 CAGTGGGGGCGCAGGGGCCATGG - Exonic
1139615063 16:68084054-68084076 CAGTGGGAAGAGAGGGTAAAGGG - Intergenic
1140365525 16:74377784-74377806 GAGGGGGAGGGGAGGGGAAGGGG - Intergenic
1140365535 16:74377801-74377823 GAGGGGGAGGGGAGGGGGAGGGG - Intergenic
1140365542 16:74377812-74377834 GAGGGGGAGGGGAGGGGGAGGGG - Intergenic
1140365549 16:74377823-74377845 GAGGGGGAGGGGAGGGGGAGGGG - Intergenic
1140365556 16:74377834-74377856 GAGGGGGAGGGGAGGGGGAGGGG - Intergenic
1140365563 16:74377845-74377867 GAGGGGGAGGGGAGGGGGAGGGG - Intergenic
1140952653 16:79834013-79834035 TATTGGGAGGTGGGGGGCAAGGG - Intergenic
1141063998 16:80899449-80899471 CTGTTGGAGGGTGGGGGCAAAGG - Intergenic
1141137778 16:81477888-81477910 GAGTGGCAGGGGAGTGGAAAAGG + Intronic
1141392353 16:83675398-83675420 CAGAGGGAGGGGAGCAGCGAGGG - Intronic
1141618253 16:85222140-85222162 CAGGGAGCGGGGAGGGGCAGTGG - Intergenic
1141703744 16:85653758-85653780 CACGTGGAGGGCAGGGGCAAAGG - Intronic
1141713995 16:85716552-85716574 CAGAGGGAGGGAAGGGGAGAGGG + Intronic
1141729914 16:85815194-85815216 CAGGGGCTGGGGAGGGGAAATGG - Intergenic
1142139530 16:88466586-88466608 CAGTGGGAGGGGATGGGCGGAGG + Intronic
1142225931 16:88877674-88877696 CAGAGGCAGGGGTGGGGCAGAGG - Intronic
1142450080 16:90169217-90169239 CAGTGTGAGGCGAGGGGCTCGGG - Intergenic
1203008106 16_KI270728v1_random:215793-215815 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1203076057 16_KI270728v1_random:1122285-1122307 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1203124160 16_KI270728v1_random:1560910-1560932 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1203146882 16_KI270728v1_random:1808543-1808565 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1142755666 17:2015142-2015164 CAGTGGCGGAGGAGGTGCAAAGG + Intronic
1143114361 17:4573973-4573995 AAGTTGGAGGGGATGGGCCACGG - Intergenic
1143471657 17:7179298-7179320 CAATGGGAGGGGAGCGGGCAGGG + Exonic
1143542996 17:7580625-7580647 GATTGGGAGGGGAGGGGCGCCGG - Intronic
1143582636 17:7835663-7835685 AAGGGAGAGGGGAGGGGCAGCGG + Intergenic
1144235648 17:13258019-13258041 CAGTGGAGGGGGAAGGGGAAGGG - Intergenic
1144305753 17:13967773-13967795 CAGTGGGATGGGAGTGGGAAAGG + Intergenic
1144591527 17:16528300-16528322 CACTGGGAGGAGAGAGGCTATGG + Intergenic
1144930888 17:18858103-18858125 CGGTGGGCGGGGAGGGGCGAGGG - Exonic
1145238534 17:21225981-21226003 AAGAGGGAGGGGAGGAGGAAGGG - Intergenic
1145983789 17:29030717-29030739 CAGATGTAGGGGAGGTGCAAGGG + Intronic
1146581304 17:34040431-34040453 CAGTGGGGGAGGAGGGGGAGGGG + Intronic
1146699231 17:34940167-34940189 CAGTGGGAGGGGAGGGGCACTGG - Intronic
1147016609 17:37497058-37497080 CAGTGGGAAGGGAAGAGAAATGG - Intronic
1147139207 17:38452150-38452172 AGGTGGGAGGGGAGGGGGAAGGG - Intronic
1147161531 17:38571971-38571993 CCCTGGGAGGGGAGGGGCTAGGG + Intronic
1147242074 17:39097073-39097095 CAAGGGGATGGGAGGTGCAATGG - Intronic
1147516364 17:41121780-41121802 GAAAGGGAGGGGAGGGGAAAGGG + Intergenic
1147544308 17:41388556-41388578 CACTGGGTTGGGATGGGCAATGG - Intronic
1147566273 17:41538141-41538163 CTGAGGGAGGGGAAGGACAAGGG + Intergenic
1147704244 17:42414972-42414994 CAGTGGGAGGGGAGAGGTGTAGG - Intronic
1147747297 17:42702664-42702686 GAGTGGGAGGGGAAGTGAAACGG - Intronic
1147792551 17:43022415-43022437 CAGCGGGAGGGGCGGGGCGCCGG + Exonic
1148071993 17:44913999-44914021 GAGGTGGAGGGGAGGGGCAGGGG - Intronic
1148239068 17:45988162-45988184 CAATGGGAGAGGAGGGACACAGG - Intronic
1148269771 17:46253767-46253789 GAGGGGGAGGGGAGGGGGAGAGG + Intergenic
1148555927 17:48578536-48578558 GGGTGGGTGGGGAGGGGGAAGGG - Exonic
1148562245 17:48612878-48612900 CACGGGGAGGGGAGGGGCATGGG + Exonic
1148562677 17:48614761-48614783 GAGGGGGTGGGGAGGGGGAAAGG + Exonic
1148603443 17:48910565-48910587 CAGGGGGAGGGGAGGGAGAGAGG - Intronic
1148614662 17:48991204-48991226 AAGAGAGAGGGGAGGGGCAGGGG + Intergenic
1148619272 17:49022408-49022430 CAGCGGGAGGGGCGGGGCGGGGG - Intronic
1148684606 17:49494766-49494788 TAGGGGGAGGGGAGGGGCGCAGG - Intergenic
1148700170 17:49582324-49582346 CAGTGGATGGGGAAGGTCAACGG - Intronic
1148742835 17:49902390-49902412 AAGGGGGAGGGCAGGGGCAGGGG - Intergenic
1148745590 17:49916243-49916265 CTGTGGGAGGGCAGGAGCTAGGG + Intergenic
1149376833 17:56052350-56052372 CAGTGGAAGTGGTGGGGCAGTGG + Intergenic
1149601443 17:57895696-57895718 ACCTGGGAGGGGAGGGGCAGGGG - Intronic
1149649591 17:58268599-58268621 CAGAGAAAGGGGAGGGGCAGGGG + Intergenic
1149960468 17:61104205-61104227 CTGTGGGTGGGGAGGTGGAATGG - Intronic
1150221373 17:63497487-63497509 GACTGGGAGGGGAGGGGGACAGG - Intronic
1150279157 17:63918869-63918891 CAGTGGGAGAGAAGGGGCCAGGG - Intergenic
1150627228 17:66849327-66849349 CACTGGGACGGGAGGGGCAGAGG + Intronic
1150666429 17:67143275-67143297 CAGTTGGAAGGGAGGAGCTATGG - Intronic
1150947568 17:69765300-69765322 CTGGGGGAGGGGAGGGGGAAGGG - Intergenic
1150984847 17:70184530-70184552 GAGGGGGAGGGGAGGGGAGAGGG - Intergenic
1151068197 17:71176684-71176706 CAGTGGCAGGGCAGTGTCAAGGG - Intergenic
1151474823 17:74339504-74339526 CAGTGGGAGGGAAGGGGGCGAGG - Intronic
1151474842 17:74339563-74339585 CAGTGGGAGGGAAGGGGGCGAGG - Intronic
1151486146 17:74402088-74402110 AGCTGGGAGTGGAGGGGCAAAGG - Intergenic
1151569215 17:74917760-74917782 CAGAGGGAGGGCAGGGGCATCGG - Exonic
1151724247 17:75875365-75875387 CAGTGTGAGTGGAGGGGGCACGG + Intronic
1151952333 17:77362024-77362046 CAGTGTTGGGGGAGGGGCCAAGG + Intronic
1152098218 17:78285253-78285275 CTGGGGGAGGGAAGGGGAAATGG + Intergenic
1152327758 17:79651458-79651480 CAGTGGGAGGGGACGGCCCGGGG - Intergenic
1152360683 17:79831918-79831940 CATGGGGAGGGGAGGGGGAAGGG - Intergenic
1152589673 17:81205376-81205398 CAGTGGGGTAGGAGGGGCAGCGG + Intronic
1152616429 17:81340058-81340080 GAGGGGGAGGGGAGGGGAAGGGG - Intergenic
1152641024 17:81449288-81449310 CAAGGGGAGGGCAGGGGCAGGGG - Intronic
1152789732 17:82272874-82272896 CCGTGGGAGGGGAGGGGGTAGGG - Intronic
1153106884 18:1537987-1538009 CTGTTGGGGGGTAGGGGCAAGGG - Intergenic
1153260576 18:3220050-3220072 CAGGAGGAGGAGAGGGGCATGGG + Exonic
1153946647 18:10023823-10023845 CTGTGAGAGGGGAGGGCCACTGG + Intergenic
1154241516 18:12657795-12657817 CAGTGGGCGGCGAGGGGCCGCGG - Exonic
1154275166 18:12952745-12952767 GGGTGGGAGGGGAGGGGAGAGGG - Intronic
1154415159 18:14172285-14172307 CAGTGCCAGGGAAAGGGCAAGGG + Intergenic
1155533260 18:26789449-26789471 AAGTGGGTGGGAGGGGGCAAGGG + Intergenic
1155611136 18:27669155-27669177 CAGTGGGAGGGGAGGGCAAGTGG - Intergenic
1155760446 18:29558837-29558859 TAGGAGAAGGGGAGGGGCAAGGG - Intergenic
1155859508 18:30879324-30879346 CATTGTGAGAGAAGGGGCAATGG + Intergenic
1155947184 18:31868106-31868128 CAGTGGGAGAGAAGGGAAAAAGG + Intronic
1156036002 18:32769569-32769591 CGGAGGGAGGGGAGGGGGCAGGG - Intronic
1156219504 18:35037528-35037550 CAGTTGGAGGTGAAGGGCAATGG + Intronic
1156325091 18:36067590-36067612 CAGCGGGAGGGGCGGGGCGTGGG - Intergenic
1156843762 18:41639189-41639211 GAAAGGGAGGGGAGGGGGAATGG + Intergenic
1157009794 18:43633442-43633464 CTATGGGCGGGGGGGGGCAAGGG - Intergenic
1157270830 18:46274819-46274841 CAGTGGGAGGGGAAATGGAAAGG + Intergenic
1157340106 18:46770845-46770867 CAGCGAGAGAGGAGGAGCAAGGG - Intergenic
1157529824 18:48410551-48410573 CAGTGCGAGGGGAGGAGGAAGGG + Intronic
1157958593 18:52126672-52126694 CAGTGGAAGGGGAGCTGGAAAGG - Intergenic
1158570368 18:58592599-58592621 CAGTGGGTGGGGAGGAGCTCCGG + Intronic
1159028303 18:63206782-63206804 CAGTGGGAGGGTTGGGGCAGGGG + Intronic
1159084218 18:63769969-63769991 CAGTGTGAGTGGAAGGGGAAGGG + Intronic
1159310876 18:66707346-66707368 CAGTGGGAGCAGAGAGGCAGTGG + Intergenic
1159623524 18:70667354-70667376 GAGGGGGAGGGGAGGGGGAAGGG - Intergenic
1159964117 18:74579335-74579357 GAGGGGGAGGGGAGGGGGAGGGG - Intronic
1160051970 18:75442195-75442217 CAGTGGGTGGGGATGGGCCCAGG + Intergenic
1160545064 18:79647425-79647447 AGGGGGGAGGGGAGGGGGAAGGG + Intergenic
1160975365 19:1790151-1790173 GAGGGGAAGGGGAGGGGCAGCGG - Intronic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1161269393 19:3381584-3381606 GAGTGGGAGGGGCTGGGCAGAGG - Intronic
1161363954 19:3868060-3868082 CAGGAGGAGGGGAAGGGCAGAGG - Intronic
1161364048 19:3868396-3868418 CAGGAGGAGGGGAAGGGCAGAGG - Intronic
1161364072 19:3868484-3868506 GAGTGGGTGGGGATGGGCAGAGG - Intronic
1161438776 19:4279211-4279233 CAGGGGGAGGGGAGGGGCGGGGG + Exonic
1161491120 19:4562203-4562225 CAGTAGGATGGGAGGTGCCAGGG - Intergenic
1161491362 19:4563677-4563699 CAGTAGGATGGGAGGTGCCAGGG - Intergenic
1161821643 19:6533801-6533823 CAGGGGGAGGGAAGGGGGAAGGG - Intronic
1162059519 19:8086126-8086148 CAGTGGGGGGGGACAGGCAGTGG + Intronic
1162059650 19:8086876-8086898 CAGTGGGGGGGGACAGGCAGTGG - Intronic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1163283925 19:16334424-16334446 CAGTGGCTGGGGAGGGAGAATGG - Intergenic
1163334293 19:16661062-16661084 CCGCGGGAGAGGAGGGGCGACGG - Intergenic
1163675133 19:18651931-18651953 CAGTGGGAGGGAATGGGAAAGGG + Intronic
1164911628 19:32017140-32017162 CACTGGTAGGGGATGGGGAATGG - Intergenic
1165190125 19:34056235-34056257 CAGGGGGAGGGCAGGAGCAGCGG + Intergenic
1165395859 19:35563309-35563331 CAGTGGGCGGGGAGGGGGCCAGG - Intronic
1165468092 19:35987021-35987043 CAGGGGAAGGGGCGGGGCAGAGG - Intergenic
1165732659 19:38156392-38156414 AAGAGGGAAGGGAAGGGCAATGG - Intronic
1166214719 19:41327637-41327659 CAGAGGCAGGGGCGGGGCAGGGG + Intronic
1166231680 19:41428385-41428407 CTGGGGGAGGGGAGGGGCCCGGG - Intronic
1166234945 19:41449135-41449157 CGAGGGGAGGGGAGGGGAAAAGG - Intergenic
1166259372 19:41627145-41627167 AAATGAGAGGGGAGGGGCAGAGG - Intronic
1166305284 19:41934042-41934064 AAGTGGGGAGGAAGGGGCAAGGG + Intergenic
1166560631 19:43730168-43730190 CAGGGGGTGGGGGAGGGCAATGG + Exonic
1166663595 19:44663425-44663447 CAGCAGGATGGCAGGGGCAAAGG + Exonic
1166705344 19:44905377-44905399 AAGTGGGATGGGAGGGGCTGGGG - Intergenic
1166738248 19:45098630-45098652 CAGCGGGAGGGGTGGGGGCAGGG + Intronic
1166979978 19:46626483-46626505 GAGATGGGGGGGAGGGGCAAAGG - Intergenic
1166996525 19:46722195-46722217 TAGTGGGTGGGGAGGGCCAGAGG - Intronic
1167010497 19:46803826-46803848 GGGTGGGAGGGGCAGGGCAAAGG + Intergenic
1167036215 19:46996438-46996460 CAGGGGGTGGGGAGGGGCAGGGG - Intronic
1167080120 19:47272327-47272349 GGGTGGCAGGGGTGGGGCAAAGG + Intergenic
1167275725 19:48538059-48538081 CGGTGGGGGGTGGGGGGCAAGGG - Intergenic
1167413145 19:49356697-49356719 CAGAGGGAAGGGAGGGGGACAGG + Intronic
1167486653 19:49766943-49766965 CGGGCGGAGGGGAGGGGCAGGGG + Intergenic
1167493075 19:49802894-49802916 AACTTGGTGGGGAGGGGCAAAGG - Intronic
1167587428 19:50382886-50382908 CAGAGGGAGGGGAGGACCCATGG + Exonic
1167632991 19:50637431-50637453 GTGTGGGAGGGATGGGGCAAGGG + Exonic
1167687002 19:50962688-50962710 CAGTGGGAAGGCAGAGACAATGG - Intronic
1168165125 19:54541953-54541975 AAGTGGGAGGGGAGGCACACTGG + Intronic
1168296649 19:55380310-55380332 AAGGGGGAGGGGACGGGCAAGGG - Intronic
1168313442 19:55473173-55473195 AAGGCGGAGGGGACGGGCAAAGG - Intergenic
1168494602 19:56838839-56838861 CACAGGGAGGGGCGGGGCCACGG - Intronic
925182180 2:1824473-1824495 CACAGGGAGGAGAGGGGCATGGG + Intronic
925335734 2:3098027-3098049 CACTGGGAGAGGCGGTGCAAGGG + Intergenic
925418367 2:3690262-3690284 GAGGGGGAGGGGAGGGGGGAGGG - Intronic
925418386 2:3690291-3690313 GAGGGGGAGGGGAGGGGGGAGGG - Intronic
925423067 2:3727179-3727201 CAGGGGGAGGGGAGGGGAGGAGG - Intronic
925647805 2:6054806-6054828 CAGTGGCAGGGGGCAGGCAAGGG - Intergenic
925739487 2:6993296-6993318 AAGTGGGAGGTGAGGGCCATGGG + Intronic
925822880 2:7817832-7817854 CGGTGGGAGGGGAGGACAAAGGG + Intergenic
925975671 2:9140249-9140271 CAGAGGGAGGGGAGGCTCCAGGG + Intergenic
926300219 2:11596769-11596791 CAGTGAGGGGGGTGGGGCACTGG + Intronic
926683547 2:15681088-15681110 GAGGGGGAGGGGAGGGGGGAGGG + Intergenic
926683559 2:15681106-15681128 GAGGGGGAGGGGAGGGGGAGGGG + Intergenic
926683575 2:15681130-15681152 GAGGGGGAGGGGAGGGGGAGGGG + Intergenic
926791645 2:16577892-16577914 CTGCGGGAGGGGAGGAGCATTGG + Intronic
926921680 2:17946419-17946441 GAGGGGGAGGGAAGGGGGAAGGG - Intronic
926963590 2:18386160-18386182 GAGTGGGAAGGAGGGGGCAAAGG + Intergenic
927279174 2:21288534-21288556 GAGTGGGAGGGGAGGGGAGGGGG + Intergenic
927405420 2:22761082-22761104 CACAGGGTGGGAAGGGGCAAAGG - Intergenic
927552554 2:24011928-24011950 CAGAGGAATGGGAAGGGCAAAGG + Intronic
927868803 2:26610364-26610386 CAGTGGGTGGGCAGGGGGAGAGG - Intronic
927951680 2:27174466-27174488 CAGTGGGAGAGGAGGGGTAAGGG - Intergenic
928081324 2:28315047-28315069 GAAGGGGAGGGGAGGGGAAAGGG + Intronic
928108452 2:28488190-28488212 GAGGGGGAGGGGAGGGGGAGGGG + Intronic
928498679 2:31863346-31863368 GAGAGGGAGGGGAGGGGGAGGGG + Intergenic
928570976 2:32608387-32608409 CAGAGGGAGAGGAGAGGAAAAGG - Intronic
928883874 2:36126970-36126992 CAGGTGGAGGGGATGGGCAGAGG - Intergenic
929244052 2:39682991-39683013 CAGGGGGATGGCAGTGGCAAAGG + Intronic
929428448 2:41867691-41867713 GTGTGGGAGGAGAGGAGCAAGGG + Intergenic
929703721 2:44188795-44188817 GAGGGGGAGGGGAGTGGGAAGGG - Intronic
929905178 2:46039551-46039573 GAGGGGGAGGGGAGAGGGAAGGG + Intronic
930320103 2:49843722-49843744 CAGTGGAAGGGGAGCTGGAAAGG + Intergenic
930639567 2:53840670-53840692 GAGGGGGAGGGGAGGGGGAGGGG + Intergenic
930721437 2:54641838-54641860 CAGTGGGAGTGGAAGGGCCTTGG + Intronic
930762076 2:55049196-55049218 GAGGGGGAGGGGAAGCGCAAAGG + Intronic
930774540 2:55159273-55159295 CAGTGGAAGTGGAGGGGGCAAGG - Intergenic
930826326 2:55700293-55700315 GAGGGGGAGGGGAGGGGGAGTGG - Intergenic
931378186 2:61727052-61727074 TTGTGGGAGGGGAGCAGCAATGG - Intergenic
931795281 2:65702379-65702401 GAGGGAGAGAGGAGGGGCAAGGG + Intergenic
931796179 2:65712224-65712246 GAAGGGGAGGGGAGGGGGAAGGG - Intergenic
932336706 2:70935814-70935836 GAGAGGGAGGGGAGGGGGAGAGG + Intergenic
932407294 2:71522001-71522023 CAGCGGGAGGGGCGGAGGAAGGG - Intronic
932780819 2:74557241-74557263 CAGAGGGATGGGAGAGTCAAGGG + Exonic
932873756 2:75429628-75429650 CAATGTGATGGGAGGTGCAAAGG - Intergenic
933679449 2:85086860-85086882 CTGTCGGGGGTGAGGGGCAAGGG - Intergenic
933912702 2:86957310-86957332 CAGTGGGAGGAGAGGGGATGTGG + Intronic
934010293 2:87812580-87812602 CAGTGGGAGGAGAGGGGATGTGG - Intronic
934461121 2:94214153-94214175 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
934478037 2:94605824-94605846 CAGTTTGAGGGGATGGGCAGAGG + Intergenic
934575345 2:95397111-95397133 CAGTGGAAGGATGGGGGCAAAGG + Intergenic
934676416 2:96252853-96252875 CACTGAGAGGGAAGGGGCCAGGG + Exonic
934912932 2:98275809-98275831 CAGTGGAATGGTGGGGGCAAAGG + Intronic
935075989 2:99744533-99744555 CATTGGGAGGGCAGGGGTATGGG - Intronic
935162369 2:100540344-100540366 TAGGGGGAGGGGAGGGGCATAGG + Intergenic
935308405 2:101759654-101759676 GAGGGGGAGGGGAGGGGGGATGG - Intronic
935560505 2:104554205-104554227 AAATGGGAGGGGAAGGACAAAGG + Intergenic
935594296 2:104867551-104867573 CTGTGGGAGCGCAGGGGCAGAGG - Intergenic
935632395 2:105222912-105222934 CAGAGGGCTGGGAGGGGGAAGGG - Intergenic
935646562 2:105340883-105340905 GAGTAGGAGGGTAGGGGTAAAGG + Intronic
935773857 2:106453300-106453322 CAGTGGGAGGAGAGGGGATGCGG - Intronic
935796438 2:106645642-106645664 GGGTGGGAAGGGAGGGGAAAAGG + Intergenic
935842581 2:107129338-107129360 CAGTTGTAGGGGAAGGGCAAGGG + Intergenic
935906206 2:107842613-107842635 CAGTGGGAGGAGAGGGGATGCGG + Intronic
935992674 2:108735136-108735158 CAGTGGGAGGAGAGGGGATGCGG + Intronic
936532014 2:113283051-113283073 CAGAGAGAGGGGAGAGTCAATGG + Intergenic
937316919 2:120937583-120937605 CAGTGGGTGGGGTTGGGGAAAGG - Intronic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937735035 2:125277800-125277822 GAGGGGGAGGGGAGGGGGAGGGG + Intergenic
937837256 2:126484186-126484208 CAGTGGGGAGGGTGGGACAAAGG - Intergenic
937885925 2:126899913-126899935 CTATGGGAGGGGAGGGACAGGGG - Intronic
937899863 2:127011692-127011714 CTGGGGGAGGGGAGGAGGAAAGG - Intergenic
938015445 2:127863423-127863445 TTGTGGGAAGGGATGGGCAAGGG - Exonic
938092160 2:128441079-128441101 CAAGGGGAGGGGAAAGGCAAAGG - Intergenic
938235049 2:129699161-129699183 TTGTGGGAGGGGAGGGCAAAGGG + Intergenic
938554137 2:132408595-132408617 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
938585467 2:132686066-132686088 CAATGGCTGGGTAGGGGCAAGGG + Intronic
938750024 2:134319558-134319580 CAGTGGGAGTGATGGGACAATGG + Intronic
939092184 2:137792109-137792131 CAGAAGGAAAGGAGGGGCAAGGG + Intergenic
939495774 2:142926124-142926146 CTGTGGGGGGTGAGGGGCTAAGG + Intronic
939929095 2:148209765-148209787 CATGGTGAGGGGAGGAGCAAGGG + Intronic
940216141 2:151305414-151305436 AAGGGGGAGGGGAAGGGGAAGGG + Intergenic
940901405 2:159129711-159129733 GATTGTGAGGGGAGGGGCAGTGG + Intronic
940929792 2:159414273-159414295 TAGTGAGAGGAGAGGGGCAAGGG + Intronic
941038179 2:160590486-160590508 GAGGGGGAGGGGAGGGTGAAGGG - Intergenic
941038188 2:160590504-160590526 AAGGGGGAGGGGAGGGGGGAGGG - Intergenic
941234003 2:162946579-162946601 AAGGGGAAGGGGAGGGGGAAAGG + Intergenic
941712746 2:168731596-168731618 CCATGGGAAGGGAGGGACAAAGG + Intronic
941815014 2:169787389-169787411 GAGGGGGAGGGGAGGGGGAGAGG + Intergenic
942456871 2:176143947-176143969 CAGGAGGAGGGGAGGAGAAAAGG + Intergenic
942767472 2:179473670-179473692 CTGTCAGAGGGTAGGGGCAATGG - Intronic
942795396 2:179812646-179812668 CAGAGGGAGAGAAGGGGGAAAGG + Intronic
942846450 2:180431966-180431988 TAGTGGTAGGGGAGGGGAATTGG + Intergenic
942888808 2:180962544-180962566 CACGGGGAGGGGAGGAGGAAGGG - Intergenic
943308636 2:186299098-186299120 CAGTGGGAGGGGAGTGGTCATGG + Intergenic
943350475 2:186791300-186791322 CAGGGGGAGGGGTGGGGGAAGGG + Intergenic
943552748 2:189360766-189360788 CTGTTGGAGGGGTGGGGGAAGGG - Intergenic
943773100 2:191740125-191740147 AAGGGGGAAGGGTGGGGCAATGG + Intergenic
943811416 2:192194244-192194266 CAGTAGGAGGTGAGGGGCTGAGG + Intronic
943921522 2:193713239-193713261 AAGGGGAAGGGGAGGGGGAAGGG - Intergenic
944279762 2:197882138-197882160 CAGTGGAGGGGGAGGAGCCAAGG + Intronic
944621172 2:201517311-201517333 CAGGGGTTGGGGAGGGGAAATGG - Intronic
944782952 2:203039279-203039301 CAGGGGGAGGGGAAGCGAAAGGG - Intronic
945210417 2:207376617-207376639 CATTGGGGGGTGGGGGGCAAGGG - Intergenic
946010504 2:216560172-216560194 GAGGGGGAGGGGAGGGGGAAGGG - Intronic
946139786 2:217680489-217680511 CAGGGGGAGGTGAGAGGCCAAGG + Intronic
946227699 2:218272969-218272991 CCTTGGGATGGGAGGGGCAGAGG + Intronic
946684763 2:222256468-222256490 CAGTGGGAGTGGAGAGGGAGAGG - Intronic
946764066 2:223023822-223023844 CAGTGGTTGAGGAGGGGCAATGG + Intergenic
947232512 2:227902424-227902446 CTGGGGGAGGGGAGTGGGAAGGG + Intronic
947587552 2:231365934-231365956 CAGTGGGAGGGGCCAGGCAGAGG + Intronic
947628710 2:231637662-231637684 AAGTGGGGGAGGAGGGGAAAAGG + Intergenic
947666768 2:231910903-231910925 AGGTGGGTGGGGAGGGGCAGAGG - Intergenic
948058620 2:235027678-235027700 AATTGGCAGGGGAGGAGCAAGGG + Intronic
948120723 2:235528360-235528382 CAGTGGGAGGGGAGGGGGCGGGG - Intronic
948603978 2:239123293-239123315 CATTGGGACGGGAAGGGCACAGG - Intronic
948724760 2:239927713-239927735 CAGGGTTAGGGGTGGGGCAAGGG + Intronic
948803597 2:240443633-240443655 CAGTGGGAGGTGAGGCCCAGCGG + Intronic
948888536 2:240896006-240896028 CAGTGGCAGGTGAGGGCCAGTGG + Exonic
948971769 2:241433918-241433940 CAGTAGGAGGGGAGCGGCTGAGG + Intronic
1168771132 20:417687-417709 GAGTGGGAAGGGAGGGCCAGAGG - Intronic
1168849530 20:967127-967149 CAGGGAGAGGGGAGGGGCAGGGG + Intronic
1168870167 20:1120721-1120743 CAGGGGGAGCTGAGGGCCAATGG - Intronic
1169165759 20:3422165-3422187 CTGAGGGAGTGGAGGGACAATGG + Intergenic
1169353121 20:4886103-4886125 GGGTGGGAGGAGAGTGGCAATGG - Intronic
1169355502 20:4901620-4901642 CAGTGGGAGGGGAGGGCAGCCGG - Intronic
1169525976 20:6426196-6426218 GAGTGGGAGAGGAGGAGGAAGGG - Intergenic
1169894649 20:10489762-10489784 CAGTGAGAGGGAAAGGGAAATGG + Intronic
1170546148 20:17437119-17437141 CAGTGGGAAGGAAGGGGCCGGGG + Intronic
1170607959 20:17887860-17887882 CAGTGGGAGGGGATGTGCTGTGG - Intergenic
1170803420 20:19609563-19609585 CTGTTGGAGGTGGGGGGCAAGGG - Intronic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1170961355 20:21028586-21028608 CAGTGGGAGGGTGGGGGCTTCGG - Intergenic
1171057506 20:21921442-21921464 AAGTGGGTGGGGAGGTGGAAGGG + Intergenic
1171066208 20:22017972-22017994 CAGAGGGAGGAGAGGGGATATGG + Intergenic
1171210282 20:23311183-23311205 GAGTGGGAGGGGAGGGGGACAGG - Intergenic
1171249733 20:23638325-23638347 CAGTAGGAGAGGAGGGGGAGGGG - Intronic
1171338766 20:24410724-24410746 GGGTCTGAGGGGAGGGGCAATGG + Intergenic
1171448095 20:25218724-25218746 CAGTGGGGTGGGAGGGGCAGAGG - Intronic
1172007721 20:31828928-31828950 CAGTGGGAGAGGGGAGGGAAAGG + Intronic
1172028625 20:31966773-31966795 GAGGGAGAGAGGAGGGGCAAAGG - Intergenic
1172186492 20:33034295-33034317 GTGTGGCAGGGGAGGGGCAGCGG + Intronic
1172426951 20:34861923-34861945 CAGTCCTGGGGGAGGGGCAAGGG - Intronic
1172464596 20:35146801-35146823 TAGTGCGAGCGGAGGGGCAAGGG - Intronic
1172479781 20:35264216-35264238 GTGTGGAAGGGGAGGGGTAAAGG - Intronic
1172625613 20:36344898-36344920 CTTTGGGAGGGGAGGAGCCAGGG + Intronic
1172970609 20:38870644-38870666 CAGTGGGAAGGGAAGGGACAGGG + Intronic
1173313078 20:41917690-41917712 AAGGGGGAGGGGAGGGGGAGAGG + Intergenic
1173705541 20:45107761-45107783 CATGGGGTGGGGAGGGGAAAGGG + Intergenic
1173874822 20:46363976-46363998 GATTGGGAGGGGTGGGGCATTGG - Intronic
1173955826 20:47031812-47031834 CAGGGGCAGGGGTGGGGGAAGGG + Intronic
1174880530 20:54274371-54274393 CAGGGGGTGGGGTGGGGGAAGGG - Intergenic
1175153130 20:56950971-56950993 GAGGGGGAGGGGAGGGGGATGGG + Intergenic
1175216070 20:57392138-57392160 CAGCGGGGGGTGAGGAGCAATGG + Intronic
1175238190 20:57526885-57526907 CAATGGGAGAGGATGGGGAATGG + Intergenic
1175625216 20:60483998-60484020 GAGGGGGAGGGGAGGGGGAGAGG - Intergenic
1175674945 20:60938323-60938345 CCCAGGGAGGGGAGGTGCAAAGG + Intergenic
1175699305 20:61125468-61125490 CAGGGGGAGGGGAAGGAGAAGGG + Intergenic
1175940260 20:62534557-62534579 GACTGGGGGGTGAGGGGCAAGGG - Intergenic
1175944548 20:62552599-62552621 CAGTGGCAGGACAGGGGCCAGGG + Intronic
1175960760 20:62635177-62635199 CAGTGGGGAGGGAGGGACACAGG - Intergenic
1176127362 20:63482037-63482059 CAGTTGGAGGGAACGGGCGAGGG - Intergenic
1176275590 20:64265691-64265713 AAGAGGGAGGTGAGGGGGAAGGG - Intronic
1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG + Intergenic
1176866423 21:14057177-14057199 CAGTGCCAGGGAAAGGGCAAGGG + Intergenic
1177681047 21:24371595-24371617 GAGTGGTAGAGGAGGGGCGAGGG - Intergenic
1177712261 21:24793447-24793469 CAGGAGCAAGGGAGGGGCAATGG - Intergenic
1177779428 21:25607201-25607223 CTGGCGGAGGGCAGGGGCAAGGG - Intronic
1178323497 21:31624383-31624405 CAGGGGGAAGGTAGGGGCAGAGG - Intergenic
1178355596 21:31908470-31908492 CCATCGTAGGGGAGGGGCAAGGG + Intronic
1178389391 21:32185798-32185820 CAGAGGGAGGGGAGGTGGCAGGG - Intergenic
1178822007 21:35983866-35983888 CTGTGGGACTTGAGGGGCAAGGG + Intronic
1178846683 21:36179963-36179985 CAGGCAGAGGAGAGGGGCAAAGG - Intronic
1179135780 21:38678842-38678864 GAGGGGGAGGGGAGGGGGAGGGG + Intergenic
1179215922 21:39366950-39366972 CGAGGGGAGGGGAGGGGAAAGGG - Intergenic
1179407017 21:41134790-41134812 CAGTGTCATGTGAGGGGCAAGGG - Intergenic
1179450879 21:41467548-41467570 CAGTGAGAGGCAATGGGCAATGG + Intronic
1179564617 21:42239576-42239598 CTTTGAGAGTGGAGGGGCAAGGG + Intronic
1179788093 21:43741097-43741119 CAGTGGGAGTGTGGGGGCCACGG + Intronic
1179852580 21:44146065-44146087 CAGTGGGTGGGGAGGGCCGAGGG - Intergenic
1179878045 21:44281452-44281474 TAGTAGGAGGGGAGGGGGCAGGG + Intergenic
1179957346 21:44749026-44749048 CAGTGGATGAGGAGGGGCAGTGG + Intergenic
1180024811 21:45154965-45154987 CAGTGGGAGGGGAGAGAGATGGG + Intronic
1180051276 21:45332031-45332053 CAGGGGGAGGGCAGGGGGAGGGG + Intergenic
1180051297 21:45332100-45332122 CAGTGGGAGGGCAGGGGGAAGGG + Intergenic
1180051320 21:45332159-45332181 CAGGGGGAGGGCCGGGGCAGGGG + Intergenic
1180094449 21:45549621-45549643 ATGTGGCAGGGGAGGGGCAGGGG + Intergenic
1180104291 21:45607677-45607699 CAGAGGGAGGGGAGGAGGGAGGG + Intergenic
1180129241 21:45816434-45816456 CAGGGGACGGGGAGGGGGAAGGG - Intronic
1180129250 21:45816451-45816473 GAGAGGGAGGGGAGGGGCAGGGG - Intronic
1180135215 21:45857989-45858011 CAGTGGGAAGGGTGTGGGAATGG - Intronic
1180209588 21:46286568-46286590 CGGGGTGCGGGGAGGGGCAACGG - Exonic
1180602735 22:17033091-17033113 GAGTGGGTGGGGAGGGCCAGAGG + Intergenic
1180675017 22:17580997-17581019 CAGGGGGAGGAGAGAGGCAGAGG - Intronic
1180872507 22:19154595-19154617 GAGGGGGAGGGGAGGGGGAGGGG - Intergenic
1181051582 22:20240604-20240626 CAGTGGCTGGGGAGGGGGAGAGG - Intergenic
1181306724 22:21921325-21921347 CAGGGGGAGGAGAGGAGAAAGGG - Exonic
1181355121 22:22292573-22292595 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1181613662 22:24036886-24036908 CTGTGGGAGGGAGGGGGCACTGG - Intronic
1181787658 22:25238456-25238478 CAGCGGGAGGGAGGGGGAAAAGG + Intergenic
1181819394 22:25463494-25463516 CAGCGGGAGGGAGGGGGAAAAGG + Intergenic
1181896081 22:26108911-26108933 CAGTGGGACAGGATGGGGAATGG - Intergenic
1182321315 22:29480062-29480084 CAGTGAGAGGGGCGGGGCAGGGG - Intergenic
1182349776 22:29692721-29692743 CACTGGAAGGAGAGGGGCCAGGG + Intronic
1182420696 22:30247205-30247227 CAGTGGGAGGAGGAGGGCTAGGG + Intergenic
1182449326 22:30409355-30409377 CTGTGGGATGGGTGAGGCAATGG + Intronic
1182679833 22:32070224-32070246 GAGGGGGAGGGGAGGGGGGAGGG - Intronic
1182696854 22:32204003-32204025 CGGTGGGAGGAGAGGGGCAGAGG - Intergenic
1182696988 22:32204526-32204548 CAGGGGGCGGGGAGGGGGACAGG - Intergenic
1183093335 22:35538444-35538466 AAGTGGGTGGGGAGGGGGGAAGG + Intergenic
1183101214 22:35585414-35585436 CAGAAGGTGGGGAGGGGCAGAGG - Intergenic
1183253191 22:36744487-36744509 AAGTGGTAGGAGAGTGGCAAGGG + Intergenic
1183485464 22:38085784-38085806 GAGAGGGAGGGGAGGAGCAAGGG - Intronic
1183503335 22:38194402-38194424 CAGAGGGAGGGGATGGGGACTGG + Intronic
1183748149 22:39704114-39704136 CCCTGGGAGGGGAGGGGAGAAGG + Intergenic
1183799610 22:40150930-40150952 GTGTAGGAGGGGAGGGGTAAGGG - Intronic
1184177380 22:42795913-42795935 GAGGGGAAGGGGAGGGGCAGTGG + Intergenic
1184404393 22:44291940-44291962 CAGAGAGAGGGGTGGGGCAGGGG - Intronic
1184459265 22:44627914-44627936 CAGAGGCAGGGGAGGAGCAATGG + Intergenic
1184600231 22:45539114-45539136 AAGTGGGAGGGGAGGGGGAGGGG - Intronic
1184933707 22:47702218-47702240 GAGGGGGAGGGGAGGGGGGAGGG - Intergenic
949735420 3:7166491-7166513 CAGTGGCTGGGGAAGGGTAAGGG - Intronic
949854735 3:8451113-8451135 CTGTGGGAGGGGAAGAGAAATGG - Intergenic
949909566 3:8890632-8890654 CATTAGGAGAGGAGGAGCAAAGG + Intronic
950110789 3:10417306-10417328 CAGTGGCAGGGGCTGGGCAGAGG + Intronic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950359589 3:12441014-12441036 CAAGGGGAGGGGAGGGACACCGG + Intergenic
950545628 3:13636422-13636444 CTGGGGGAGAAGAGGGGCAATGG - Intronic
950656206 3:14438461-14438483 CTGTGGAAAGGGCGGGGCAAGGG + Intronic
951080665 3:18446065-18446087 CATTGGGAGAGAAGGGGCCAAGG + Intergenic
951795931 3:26538240-26538262 AAGGGGGAGGGGAAGGGGAAGGG + Intergenic
952967538 3:38630544-38630566 CTGAGGGAGGAGAGGGGGAAGGG + Intronic
953340998 3:42134183-42134205 AAGGGGAAGGGGAGGGGGAAGGG - Intronic
954399810 3:50312984-50313006 GAGGGGGAGGGGAGGGGGAGGGG + Intergenic
954406859 3:50350022-50350044 CCTGGGGAGGGGAGTGGCAATGG + Exonic
954426778 3:50447557-50447579 CAGTGGTATGGGAGGGACATGGG - Intronic
955281716 3:57600426-57600448 AAGGGGGAAGGGAGGGGAAAAGG - Intergenic
955796462 3:62642475-62642497 AAGTGGGAGGGGTGGAGAAAAGG + Intronic
959060038 3:101608318-101608340 CAGAGGGAGGGGAGAGAAAAAGG - Intergenic
959912489 3:111779392-111779414 TAGAGGGAGGAGGGGGGCAAGGG - Intronic
959946853 3:112134163-112134185 CAGTGGAAGGGGAGCTGCAAAGG - Intergenic
960084694 3:113578053-113578075 CAGTGGCAGGAGAGGGCCAAAGG + Intronic
960964124 3:123092716-123092738 CAGAGGGAGGTGAGTGGCAGAGG + Intronic
961319489 3:126063111-126063133 CAGTGGGAATGGAGGGTCACAGG - Intronic
961366775 3:126405138-126405160 CAGGGCTAGGGGAGGGGGAATGG - Intronic
961460275 3:127045603-127045625 AAGAGGGAGGGAAGGGGAAAGGG + Intergenic
961940881 3:130636793-130636815 GAGGGGGAGGGGAGGGGGAGGGG - Intronic
961940896 3:130636816-130636838 GAGGGGGAGGGGAGGAGGAAGGG - Intronic
962305947 3:134286236-134286258 CAGTGGGGGGGGTGGGGGGAGGG + Intergenic
962404563 3:135089801-135089823 CAGAGGGAGGAATGGGGCAAAGG - Intronic
962700680 3:137996926-137996948 CAGTGGGAGGGCAGGAGGAAGGG - Intergenic
962828709 3:139121224-139121246 CAATGGGATGGGAGGAGCACAGG - Intronic
963049295 3:141127927-141127949 CTGTGGGAGGGGCAGGGCTAAGG - Intronic
963143263 3:141965553-141965575 AAGGGGGAGGGGAAGGGGAAGGG + Intronic
963742984 3:149097973-149097995 GAGGGGGAGGGGAGGGGGTAGGG + Intergenic
964024705 3:152058324-152058346 CAGTGGGAACAGAAGGGCAAGGG - Intergenic
964120758 3:153180646-153180668 CAGTGTGAGGCCAGGTGCAATGG - Intergenic
965772249 3:172193275-172193297 GAGAGGGAGGGGAGGGGGAGGGG - Intronic
966131607 3:176647137-176647159 AAGGGGGAAGGGTGGGGCAAGGG + Intergenic
966206865 3:177413704-177413726 GAGGGGGAGGGGAGGGGGAAGGG + Intergenic
966396516 3:179509633-179509655 AAGAGGGAAGGGAGGGCCAAAGG - Intergenic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966754513 3:183355934-183355956 CAAGGGGAGGGGAGGGGGGAAGG - Intronic
966886297 3:184379807-184379829 GAGGGGGAGGGGAGGGACCAGGG - Intronic
966925927 3:184644549-184644571 CCGTGGGGAGGGAGAGGCAAGGG - Intronic
966940123 3:184740969-184740991 AGGTGGGATGGGATGGGCAATGG - Intergenic
967033616 3:185631421-185631443 GAGTGGGAGGGGGGGGGGAGAGG - Exonic
967291647 3:187926684-187926706 CAGTGATAGGGGTGGGGGAAAGG - Intergenic
967612171 3:191520369-191520391 CAGTGAGAGGTGAGGGCAAATGG + Intergenic
967817637 3:193812868-193812890 CAGTGGGCGGGAATGGGCCATGG + Intergenic
967837344 3:193975469-193975491 CAATCGGAGGGGTGGGGGAAGGG + Intergenic
968599496 4:1502402-1502424 CAGTGGGAGGGGAGGGGCATGGG - Intergenic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
968620726 4:1602305-1602327 CAGGGGCAGGGGAGGGGCAGTGG + Intergenic
968632983 4:1661727-1661749 CGGTGGGAGGGGAGTGGGCACGG - Intronic
968754264 4:2407126-2407148 GAGTGGGAGGCAAGGTGCAATGG - Intronic
969183736 4:5460623-5460645 AGGTGGGATGGGAGGGGCAGAGG + Intronic
969328839 4:6461223-6461245 CAGGGAGAGGGGAGGGTCAGGGG + Intronic
969474617 4:7414423-7414445 CAGTGGGAGCCGCGGGGCAATGG + Intronic
969596397 4:8151621-8151643 CAGTGGGCGGGGTGGGGCGGTGG + Intronic
971373014 4:26033360-26033382 CTATGAGAGGGGAGGGGCAGAGG + Intergenic
971511371 4:27429499-27429521 CAGTCTGAGGGGCGGGGGAAGGG - Intergenic
971963132 4:33515622-33515644 AAGAGGGAGAGGAGGGGGAAAGG - Intergenic
972241971 4:37203388-37203410 ATTTGGGAGGGGAGGGGCCAGGG - Intergenic
972249165 4:37281040-37281062 GAGTGGGTCTGGAGGGGCAAAGG + Intronic
972327012 4:38026333-38026355 CTGTGGGAGGGGAGGAGCCGTGG + Intronic
972756278 4:42050359-42050381 CAGTGGGAGGAGAGGGGATAGGG + Intronic
972908593 4:43784756-43784778 CAGAAGGAGGGGAGGGGGAGTGG + Intergenic
973779135 4:54271964-54271986 GAGGGGGAGGGGAGGGGGGAGGG - Intronic
974833393 4:67216424-67216446 GAGGGGGAGGGGAGGGGGAGGGG + Intergenic
974833400 4:67216435-67216457 GAGGGGGAGGGGAGGGGGGAGGG + Intergenic
974849266 4:67385610-67385632 GAGGGGGAGGGGAGGGGGGAAGG + Intergenic
975460884 4:74651323-74651345 GAGGGGGAGGGGAGGGGGAAGGG + Intergenic
975673288 4:76802791-76802813 CACAGGGAGGGGAGGGGAAGTGG + Intergenic
976401831 4:84615572-84615594 CAGGGGGAGGGGGTGGGCAACGG - Intronic
976753758 4:88477289-88477311 AAGGGGGAGGGGAGGGGGAGGGG + Intronic
976938200 4:90665897-90665919 CAGTGGGAGGTGTGGGAAAAGGG + Intronic
978399494 4:108315598-108315620 AAGTGTGAGGGGTGGGGCAGGGG - Intergenic
978618201 4:110615875-110615897 TAGGGGGCGGGGAGGGCCAAAGG - Intergenic
978989497 4:115061617-115061639 CTGTCGGGGGTGAGGGGCAAGGG + Intronic
980019331 4:127689745-127689767 AAGGGGGAGGGAAGAGGCAAGGG + Intronic
981354055 4:143766683-143766705 AAAGGGGAGGGGAGGGGAAACGG - Intergenic
982258695 4:153474416-153474438 CAGAGGGAATGGAGGTGCAAAGG + Intronic
983188518 4:164728828-164728850 CAGTGGGAGGAGTGAGGCAATGG - Intergenic
983523604 4:168736883-168736905 CAGTGGGAGGGGGAGGGGAGTGG + Intronic
983910432 4:173232895-173232917 CAGTGGCTGGGAAGGGGAAAGGG - Intronic
984172878 4:176381856-176381878 CAGTGTGAGGGGCAGGGCAGTGG - Intergenic
984541188 4:181039621-181039643 CAGGGGGTGGGGAGGGATAAGGG - Intergenic
985118558 4:186616386-186616408 GAGTGGGTGGGGAGGGGCCATGG - Intronic
985271266 4:188197004-188197026 AGGTGGGTGGGGAGGGGGAAGGG - Intergenic
985271425 4:188197604-188197626 AGGTGGGTGGGGAGGGGGAAGGG - Intergenic
985650009 5:1103036-1103058 CAGAGGGAGGGCAAGGGCCAGGG - Intronic
985690114 5:1304252-1304274 AAGTGGAAGGGGAAGGGGAAGGG - Intergenic
985756654 5:1723490-1723512 GAGAGGGAGAGGAGGGGAAAGGG - Intergenic
985930387 5:3052394-3052416 AAGTGGGAGAGGAGAGACAAAGG + Intergenic
986013929 5:3740970-3740992 CAGATGTAGAGGAGGGGCAAGGG - Intergenic
986302535 5:6489706-6489728 CAGTGGGAAGGCAGCTGCAATGG - Intronic
986588702 5:9346287-9346309 CAGTGGAAGGGGAGCTGGAAAGG - Intronic
986923407 5:12716829-12716851 CAGTGGGAGAGGTGTGGCCAGGG + Intergenic
987265384 5:16247992-16248014 CAGTGGCAGTGGAGATGCAAAGG - Intergenic
987361500 5:17111515-17111537 GAGGGGGAGGGGAGGGGGAGGGG - Intronic
987414842 5:17652017-17652039 GAGGGGGAGGGGAGGGGGAGGGG - Intergenic
987560143 5:19509295-19509317 CAGAGAGTGGGAAGGGGCAAGGG + Intronic
988791887 5:34616085-34616107 CAGAGGGAGGAGAGGAGGAAGGG + Intergenic
989170896 5:38469614-38469636 CTGTGGGAGGAGAGGGGTATGGG + Intergenic
989173245 5:38494332-38494354 CAGGGGTAGGGTGGGGGCAAGGG + Intronic
989194986 5:38707676-38707698 CAATGGGGGAGGAGAGGCAATGG + Intergenic
990231263 5:53715698-53715720 GGATGGGAGGGGAGGGGCCAAGG + Intergenic
990743715 5:58937261-58937283 CAGGGGAAGGGGAGGGGCGGGGG + Intergenic
990879312 5:60521676-60521698 AAGGGAGAGGGGAGGGGGAAGGG + Intronic
991098984 5:62770893-62770915 CAGTGGGAGGCGATGGGAACAGG - Intergenic
991693161 5:69245281-69245303 GAGGGGGAAGGGAGGGGAAAAGG - Intronic
991693172 5:69245304-69245326 GAGGGGAAGGGGAGGGGGAAGGG - Intronic
992085006 5:73270421-73270443 CAGTGGGAGTGGATGGGGATGGG - Intergenic
992136185 5:73748762-73748784 CTGTGGGAGTGGCGGGGAAATGG - Intronic
992149432 5:73888137-73888159 AAGTGGGAGAGCAGGGCCAATGG - Intronic
992158936 5:73981896-73981918 CAGTGGTAGGGAAGGGAAAAGGG - Intergenic
992409616 5:76492542-76492564 CAGTGGGAGGGAAGGAAGAAAGG + Intronic
992415995 5:76551879-76551901 GAGGGGGAGGGGAGGGGGAGGGG + Intronic
992605145 5:78448042-78448064 GAGGGGGAGAGGAGGGGGAACGG - Intronic
993004309 5:82414187-82414209 CAGAGTGAGGGCATGGGCAATGG + Intergenic
993047550 5:82885250-82885272 CAGAGGAAGAGGAGGAGCAAGGG + Intergenic
993901157 5:93584934-93584956 CGCTGGGAGGGGAAGGGGAAGGG - Exonic
994051989 5:95372735-95372757 TGGTGGGAGGGGTGGGCCAAAGG - Intergenic
994433224 5:99695359-99695381 CAGTGGAAGGGGAGCTGGAAAGG + Intergenic
995340388 5:111052256-111052278 TATTGGGAGGTGGGGGGCAAGGG - Intergenic
996466382 5:123807268-123807290 CGGGGGGAGGGGATGAGCAAGGG + Intergenic
997032139 5:130142802-130142824 CAGTGGGACTGGAAGGGCCAAGG + Intronic
997054411 5:130424165-130424187 CAGTTGGAGGGTAGGGGTATAGG - Intergenic
997222199 5:132178754-132178776 AAGAGGGAAGGGAAGGGCAATGG - Intergenic
997225748 5:132208384-132208406 AAGGGGGAGGGGAGGGGGAGGGG + Intronic
997225755 5:132208395-132208417 GAGGGGGAGGGGAGGGGGAGGGG + Intronic
997581719 5:135021532-135021554 CAGTGGGAGGACAGGGGCAGTGG + Intergenic
998134854 5:139669184-139669206 CAGTGGGAGGGGGAGCGCCATGG + Intronic
998649425 5:144101397-144101419 TAGTGACAGGGGAGGGGAAATGG - Intergenic
999500087 5:152138192-152138214 GAGTGGAAGGGGCAGGGCAAAGG - Intergenic
999612801 5:153388639-153388661 CAGCGGGTGGGGTGGGGAAAAGG - Intergenic
999655609 5:153807753-153807775 CAGGCAGAGGGGAGGGGCAGGGG - Intronic
999758426 5:154682566-154682588 CTGTGGGATGGGAGGGGCCGGGG - Intergenic
1000185080 5:158851397-158851419 GAGGGGGAGGGGAGGGGAAAGGG + Intronic
1000294519 5:159901428-159901450 GAGGGGGAGGGGAGGGGGAGGGG + Intergenic
1000294525 5:159901439-159901461 GAGGGGGAGGGGAGGGGGACGGG + Intergenic
1000309083 5:160024069-160024091 AAGTGTGGGGGGATGGGCAATGG + Intronic
1000480441 5:161767250-161767272 AAGTGGCAGGTGAGGGACAAAGG - Intergenic
1000919410 5:167120382-167120404 CTGTGGGAGAGGAGGGGAAGTGG + Intergenic
1001160846 5:169311391-169311413 CAGAGGGAGGAGGTGGGCAAGGG - Intergenic
1001404975 5:171469804-171469826 CCGGGGGTGGGGAGGGGCAGGGG - Intergenic
1001456191 5:171862121-171862143 CAGGGGGAAGGGAGGGGGCAGGG - Exonic
1001622195 5:173096520-173096542 GAAGGGGAGGGGAGGGGGAAGGG - Intronic
1001625870 5:173132468-173132490 GAGGGGGAGGGGAGGGGGAGGGG - Intronic
1001625877 5:173132479-173132501 AAGAGGGAGGGGAGGGGGAGGGG - Intronic
1001672511 5:173485920-173485942 CATTGGGGGGTGAGGGGCTAGGG - Intergenic
1001919421 5:175588685-175588707 AAGTGGGAGGGGAGGAGAAAAGG + Intergenic
1001939975 5:175733509-175733531 CACTGGGAAAGGAAGGGCAATGG - Intergenic
1001959730 5:175872645-175872667 ATGGGGGAGGGGAGGGGCAGCGG - Intronic
1002078478 5:176723726-176723748 CAGGGGCAGGGCAGGGGCACCGG - Intergenic
1002098897 5:176847812-176847834 CGGGGGGAGGGGAGGGCCAGGGG - Intronic
1002134201 5:177097991-177098013 CAGGGGGAGGTGTGGGGAAAGGG - Exonic
1002294631 5:178223522-178223544 AGGTGGGAGGGCAGGGCCAATGG + Intronic
1002327633 5:178420386-178420408 CTCAGGGAGGGGAGGGGGAAAGG - Intronic
1002614900 5:180445833-180445855 CTGTTGGGGGTGAGGGGCAAGGG - Intergenic
1003094797 6:3133631-3133653 GAGTGGGAAGGGAGCGGGAAGGG - Intronic
1003174987 6:3747548-3747570 CAGTGGAAGAGCAGGTGCAAAGG - Intronic
1003226056 6:4207107-4207129 GGGAGGGAGGGGAGGGGGAAGGG - Intergenic
1003628823 6:7768192-7768214 CAGTGGGAGAGGAAAGGGAATGG - Intronic
1003948201 6:11094141-11094163 CAGGGGGTGGGGCGGCGCAAAGG - Exonic
1003993290 6:11510260-11510282 CCATGGGTGGGGCGGGGCAAGGG + Intergenic
1004285143 6:14314803-14314825 CGGTGGCAGGGGATGGGCCAGGG - Intergenic
1004349458 6:14878405-14878427 TAGGGGAAGGGGAGGGGCAGAGG + Intergenic
1004607293 6:17206456-17206478 GAGGGGGCGGGGAGGGGCAAGGG + Intergenic
1005333914 6:24774779-24774801 GGGTCGGAGGGGAGGGTCAAAGG + Intergenic
1005989459 6:30893872-30893894 GAGTGGGGTTGGAGGGGCAAAGG + Intronic
1006028826 6:31164551-31164573 CAGGGGGAGGGGAGGAGCTAGGG - Exonic
1006093037 6:31639447-31639469 TAGTGGGAGGGGTTGGGCTAGGG - Intronic
1006322890 6:33330865-33330887 CTGAGGGAGGGGAGGGGGAACGG + Intergenic
1006341369 6:33448901-33448923 CAGTGAGAGGGGAGAGGCTCCGG - Intronic
1006392819 6:33768765-33768787 CAGTGGGAGGGCTGGGGCTGTGG + Intergenic
1006433017 6:34009757-34009779 CAGCAGGAGGGGAGAGGAAAGGG + Intergenic
1006435859 6:34025956-34025978 CAGTGTGAGGGGAAGGCCAAGGG + Intronic
1006505402 6:34485860-34485882 CAGTGGCTGGGGAGGGCCAGAGG + Intronic
1006618072 6:35343045-35343067 CAGAGGCAGGGGAGGGGAATGGG - Intronic
1006641129 6:35490338-35490360 GAGGGGGAGGGGAGGGGGGACGG + Intronic
1006744293 6:36330567-36330589 CAGTGGGCAGGGAGAGCCAATGG + Exonic
1006898293 6:37484431-37484453 CAGTGGGAAGTGAGGGGTGAAGG - Intronic
1007166435 6:39831928-39831950 CAGTGCGAGGGCCGGGGCACTGG + Intronic
1007180506 6:39926095-39926117 CAGTGGGAGGCCAAGGGCATGGG + Intronic
1007514156 6:42398081-42398103 CAGTAGGATGGGAAGGGCAGGGG + Intronic
1007908107 6:45484370-45484392 GAGGAGGAAGGGAGGGGCAAAGG + Intronic
1008265873 6:49425759-49425781 AGCTGGGAGGGGAGGGGAAAAGG - Intergenic
1008590289 6:52987037-52987059 GAGAAGGAGGGAAGGGGCAAGGG + Intronic
1009593794 6:65708932-65708954 GAGAGGGAGGGGAGGGGGAGGGG - Intergenic
1010317299 6:74466313-74466335 CATTGGCAGGAGTGGGGCAATGG + Intergenic
1011399833 6:86948550-86948572 CAGTGGGAGGTGAGAGGAAGTGG - Intronic
1011888783 6:92130335-92130357 CAGTGGCAGGAGAGTGGGAAAGG - Intergenic
1011959558 6:93070243-93070265 CAGTGGTGGGGAAGGGGAAAGGG + Intergenic
1013177685 6:107691290-107691312 CGGGGAGGGGGGAGGGGCAAGGG - Intergenic
1013329177 6:109081669-109081691 GGATGGGAGGGGAGGGGCAGAGG - Intronic
1013363965 6:109421130-109421152 GTGTGGGAGGGAGGGGGCAAGGG - Intronic
1014955170 6:127606473-127606495 CAAAGGGAGGGGTGGGGCTAGGG - Intergenic
1015222776 6:130824015-130824037 GAGTGGGAGGGGTGGGGGACAGG + Intergenic
1015629323 6:135215657-135215679 CAGTGGGAGGGGATGTGGAGTGG - Intronic
1015840653 6:137473415-137473437 CAGAGGGAGGGGAGGGGCGGAGG + Intergenic
1015882355 6:137881727-137881749 CTGGGGGAGGGGAGGTGGAATGG - Exonic
1016898308 6:149075567-149075589 AGGTGGCAGGGGAGGGGCAGTGG - Exonic
1017063195 6:150505977-150505999 GTGAGGGAGGGGAGGGGAAATGG + Intergenic
1018172853 6:161155231-161155253 CAGTGGGATGGACGGGGCAGTGG + Intronic
1018602783 6:165563180-165563202 GAGGGGCAGGGGAGAGGCAAGGG + Intronic
1018765820 6:166932139-166932161 CAGGGGGATGGGAGAGGCAGAGG - Intronic
1018954412 6:168398561-168398583 CAGGGGTCAGGGAGGGGCAATGG + Intergenic
1019158251 6:170052891-170052913 GAGGGGGAGGGGAGGGACAGAGG - Intergenic
1019159083 6:170057629-170057651 AATGGGGAGGGGAGGGGGAAGGG - Intergenic
1019369730 7:655377-655399 CAGCAGGAGGGCAGGTGCAAAGG - Intronic
1019477746 7:1252132-1252154 CCGGGGCAGGGGAGGGGAAAGGG - Intergenic
1019551788 7:1606800-1606822 GAGTGGGAGGGGAGGAGGGAGGG - Intergenic
1020410726 7:7888888-7888910 GAGGGGGAGGGGAGGGGGAGGGG + Intronic
1021272516 7:18608286-18608308 GAGTGGGAGGGGAGGGGGACTGG + Intronic
1021524626 7:21573729-21573751 CAATGGGAGGGGAAGGGCAGAGG - Intronic
1021974879 7:26002144-26002166 CACTGGATGGGGAGGGGCAGGGG - Intergenic
1022201185 7:28119328-28119350 TTGTTGGAGGGGAGGGGCAGCGG - Intronic
1022970697 7:35514212-35514234 CAGTGGAAGGGGTGGGGAGAGGG - Intergenic
1023003767 7:35840227-35840249 AAGGGGAAGGGGAGGGGAAAGGG - Intronic
1023038455 7:36153056-36153078 GAGTGGGAGAGGCGGGGCCATGG - Intergenic
1023139909 7:37091579-37091601 CAGTGAGAGTGGAGGGGGCAGGG - Intronic
1023856036 7:44184703-44184725 CAGTGGGAGGGCAGGAGGCAGGG + Intronic
1023871378 7:44264715-44264737 CAGTGGGAGGGGAGAGGGGAGGG - Intronic
1024265902 7:47606256-47606278 CTGTGGCAGGGGTGGGGTAAGGG + Intergenic
1024380839 7:48694723-48694745 CAGTGTGAGGGAATGGGGAAGGG + Intergenic
1024403515 7:48951266-48951288 CATTGAGAGGGCAGGAGCAAAGG + Intergenic
1024963565 7:55003248-55003270 CAGTGGGGGGGGGGGGGAATGGG - Intergenic
1025814065 7:64893683-64893705 GAGGGGGAGGGGAGGGGGAGGGG - Intronic
1025852646 7:65257368-65257390 GAGGGGGAGGGGAGGGGGAGGGG - Intergenic
1026016826 7:66678212-66678234 CAGCAGGATGGGAGGGGCAGGGG - Intronic
1026190623 7:68122931-68122953 CACTGGCAGGGGAGTGGAAACGG - Intergenic
1026428844 7:70324002-70324024 CAGTGGGAGGACAGGCGTAAAGG + Intronic
1026800658 7:73397883-73397905 CGGGGGGAGGGGAGGGGGAGGGG + Intergenic
1026902129 7:74043198-74043220 CAGAGGGCAGGGAGGGGCAGAGG + Intronic
1026930518 7:74220774-74220796 CAGGGGGAGAGGTGGGGCAGGGG - Intronic
1026930526 7:74220791-74220813 CAGGGGGAGAGGTGGGGCAGGGG - Intronic
1027159765 7:75793773-75793795 GAGAGGGAGGGGAAGGGGAAGGG + Intergenic
1027753813 7:82185489-82185511 GAGGGGGAGGGGAGGGGGAGGGG + Intronic
1028033804 7:85953131-85953153 CAGTGGAAGGGAAGGAGAAAGGG - Intergenic
1029238644 7:99143533-99143555 CAGGGGGCGGGGCCGGGCAACGG + Intronic
1029392171 7:100282576-100282598 AAGGGGGAGGGGAGGGGGAGGGG - Intergenic
1029392196 7:100282619-100282641 AAAGGGGAGGGGAGGGGGAAGGG - Intergenic
1029490122 7:100866326-100866348 CAGTGGGCGGGGAGACGCAGAGG + Exonic
1029609957 7:101621543-101621565 CAGTGGGATGGGTGGGCAAAGGG + Intronic
1029881980 7:103823446-103823468 AATAGGGAGGGGAAGGGCAAAGG - Intronic
1030272749 7:107687270-107687292 CAGAAGGAGGGCAAGGGCAAGGG + Intronic
1031297851 7:120026640-120026662 CAGTGGGAAGGGTTGGGGAAGGG - Intergenic
1032037489 7:128531245-128531267 CAGTGGGAGAGGAGGGGGAGGGG - Intergenic
1032056480 7:128688760-128688782 GAGGGGGAGGGGAGGGGGAGGGG - Intergenic
1032058253 7:128701340-128701362 GAGGGGGAGGGGAGGGGAAGGGG + Intergenic
1032078146 7:128845838-128845860 GAGTGGGAGAGGAGGGGGAGAGG + Intronic
1032284870 7:130532374-130532396 CATGGGGAGGGAAGGCGCAAAGG + Intronic
1032285666 7:130536906-130536928 CACGGGGAGGGAAGGTGCAAAGG + Intronic
1032286438 7:130541336-130541358 CACGGGGAGGGAAGGTGCAAAGG + Intronic
1032409909 7:131687326-131687348 CAATGGAAGGGAAGGGGCAGGGG - Intergenic
1032436212 7:131902382-131902404 TAGTGGAAGGGGAAGGGAAAGGG - Intergenic
1032469129 7:132165263-132165285 CCGTGGGCTGGGAAGGGCAAGGG + Intronic
1032498098 7:132377936-132377958 CTGTGGTATGGGAGAGGCAATGG + Intronic
1032515039 7:132500473-132500495 GAGGGGGAGGGGAAGGGGAAGGG + Intronic
1032672662 7:134099499-134099521 AAGTGTGATGGGAGGAGCAAAGG - Intergenic
1032794938 7:135269626-135269648 CAGTGGGAAGGCAGGGCCAAGGG + Intergenic
1033250545 7:139754767-139754789 CAGTGGGAGGGGAGCTGAAGGGG + Intronic
1033619701 7:143051193-143051215 CGGCGGGAGGGGAAGTGCAATGG + Intergenic
1033743096 7:144289925-144289947 CAGTGGGAGAGGGGGGGGATGGG - Intergenic
1033750802 7:144359674-144359696 CAGTGGGAGAGGGGGGGGATGGG + Intronic
1033969821 7:147025417-147025439 AAGGGGGAGGGGAGGGGGAGGGG + Intronic
1034263626 7:149771757-149771779 GAGCGGGAGGGGCGGGGCAGAGG - Intronic
1034355163 7:150445440-150445462 GAGTGGGTGGGGAGGGGAGAGGG + Intergenic
1034436342 7:151064442-151064464 TAGTGGGAGGAGTGGGGCTAGGG + Intronic
1034612330 7:152382453-152382475 CATTGGGTGGGGTGGGGGAAGGG - Intronic
1034691395 7:153017250-153017272 CAGAGGGAGAGGAGGAGGAAGGG + Intergenic
1034925049 7:155114481-155114503 CAGAGGAAGGGCAGGGGCAGAGG - Intergenic
1035281175 7:157779437-157779459 CAGTGTGTGGTGAGGGGCAGCGG - Intronic
1035776356 8:2191419-2191441 GAGGGGGAAGGGAGGGGGAAGGG - Intergenic
1035776362 8:2191430-2191452 GAGGGGGAAGGGAGGGGGAAGGG - Intergenic
1035776378 8:2191463-2191485 GAGGGGGAAGGGAGGGGGAAGGG - Intergenic
1035776425 8:2191555-2191577 GAGGGGGAAGGGAGGGGGAAGGG - Intergenic
1035776431 8:2191566-2191588 GAGGGGGAAGGGAGGGGGAAGGG - Intergenic
1035776447 8:2191599-2191621 GAGGGGGAAGGGAGGGGGAAGGG - Intergenic
1035776480 8:2191661-2191683 GAGGGGGAAGGGAGGGGGAAGGG - Intergenic
1035776486 8:2191672-2191694 GAGGGGGAAGGGAGGGGGAAGGG - Intergenic
1035776492 8:2191683-2191705 GAGGGGGAAGGGAGGGGGAAGGG - Intergenic
1035776498 8:2191694-2191716 GAGGGGGAAGGGAGGGGGAAGGG - Intergenic
1035776517 8:2191726-2191748 GAGGGGGAAGGGAGGGGGAAGGG - Intergenic
1035776523 8:2191737-2191759 GAGGGGGAAGGGAGGGGGAAGGG - Intergenic
1035776542 8:2191778-2191800 GAGGGGGAAGGGAGGGGGAAGGG - Intergenic
1035776548 8:2191789-2191811 GAGGGGGAAGGGAGGGGGAAGGG - Intergenic
1035776554 8:2191800-2191822 GAGGGGGAAGGGAGGGGGAAGGG - Intergenic
1035776573 8:2191841-2191863 GAGGGGGAAGGGAGGGGGAAGGG - Intergenic
1036293721 8:7518136-7518158 CACTGGGTGGGGAGGGGAGAGGG - Intergenic
1036328840 8:7802859-7802881 CACTGGGTGGGGAGGGGAGAGGG + Intergenic
1036635527 8:10547654-10547676 GAGTGGGAAGGGAAGGGAAAAGG - Intronic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037057042 8:14455974-14455996 CAGTTGGAGGGGAGGGGATGCGG + Intronic
1037467268 8:19172655-19172677 GAGAGGGAGGGGAGGGGGAGGGG + Intergenic
1037701125 8:21274690-21274712 CACAGGGAGTGGAGGGGGAAGGG - Intergenic
1037751384 8:21684615-21684637 CAGTGGCTGGGGAGGGGACAAGG - Intergenic
1037754803 8:21703764-21703786 CAGTGGGAGGGGAACAGCGATGG - Intronic
1037845032 8:22275497-22275519 AAGTGGGAGGGGAGAGGCCCGGG - Intronic
1037963209 8:23115225-23115247 CAGTAGCAAGGGAGGTGCAAGGG - Intronic
1037967811 8:23147322-23147344 CAGTAGCAAGGGAGGCGCAAGGG + Intronic
1038277218 8:26131621-26131643 TGTTGGGAGGTGAGGGGCAAAGG + Intergenic
1038319374 8:26513739-26513761 CAGGTGGAGGAGAGGGGCACTGG + Intronic
1038542693 8:28402416-28402438 CAGGGGAAGGGGCGGGGCGAGGG + Intronic
1038691192 8:29765035-29765057 CAGTGGGTGTGAAGGGGAAAGGG - Intergenic
1039187155 8:34930367-34930389 GAGTGGGAGGGAAGGAGGAAGGG + Intergenic
1039884380 8:41646930-41646952 GAGGGGGAGGGGAGGGGGAGGGG - Intronic
1040479311 8:47809139-47809161 GAGGGGGAGGGGAGGGGAGAAGG + Intronic
1041182139 8:55259919-55259941 CAAGGGGTGGGGAGGGGCAGTGG - Intronic
1041266583 8:56071547-56071569 CAGCAGTAGGGGAGGGGCAAGGG + Intronic
1042130498 8:65582779-65582801 GAGGGGGAGGGGAGGGGAGAGGG + Intergenic
1042227523 8:66525546-66525568 CAGTGGGAGGGGCAGGGCACAGG + Intergenic
1042467083 8:69140555-69140577 CAGGGGGCAGGGAGGTGCAATGG + Intergenic
1042564974 8:70101995-70102017 CAGCGTGAGGGGATGGGTAATGG - Intergenic
1043769873 8:84184647-84184669 CCGTGGGAGGGGTGGGGGGAGGG - Intronic
1043908370 8:85833171-85833193 CAAGGGAAGGGGAGGGGAAAGGG - Intergenic
1043908378 8:85833188-85833210 GAGGGGAAGGGGAGGGGCAAGGG - Intergenic
1043961799 8:86424856-86424878 GAGGGGGAGGGGAGGGGAGAGGG + Intronic
1044093381 8:88030142-88030164 CAGTAGGAGGGGAGAGCCAGTGG + Intergenic
1044462053 8:92457191-92457213 GGGTGGGAAGGGAGGGGAAAAGG + Intergenic
1044472777 8:92590032-92590054 CAGAGGGAGGGGAGGGTGTATGG - Intergenic
1044591310 8:93916836-93916858 GAGTGGGAGGGGAGGCGGAGAGG - Intronic
1044932051 8:97260185-97260207 GAGGGGGAGGGGAGGGGGAGGGG + Intergenic
1045481561 8:102596908-102596930 CATTGGGGGGCGGGGGGCAATGG - Intergenic
1045593764 8:103629117-103629139 CAGGTGCAGGGTAGGGGCAAAGG - Intronic
1045698142 8:104834559-104834581 CAGTAGGAGGTGAGCGGCAGGGG + Intronic
1045950725 8:107848942-107848964 AAGGGGAAGGGGAGGGGCAAGGG + Intergenic
1046396829 8:113651152-113651174 CAGTGGAAGGGGAGCTGGAAAGG - Intergenic
1046936043 8:119887101-119887123 GAGGGGGAGGGGAGGGGAAGGGG - Intronic
1047214204 8:122863597-122863619 GAGAGGGATGGGAGGGGCAGGGG + Intronic
1047254778 8:123206987-123207009 GAGGAGGAGGGGAGGGGGAAGGG - Intronic
1047429257 8:124776414-124776436 CAGTGGCTGGGGTGGGGAAAAGG + Intergenic
1048179276 8:132180349-132180371 GAGTGGGAGGGAAGAGGGAAAGG + Intronic
1048398126 8:134034437-134034459 GAGGGGGAGGGGAGGGGAAATGG + Intergenic
1048464628 8:134655137-134655159 GAGAGGGAGGAGAGGGGCATGGG + Intronic
1048484278 8:134832434-134832456 CAGTGGGCGGGGACAGGAAATGG - Intergenic
1049090791 8:140511963-140511985 CAGTGGGGTGGGCGGGGCGAAGG - Intronic
1049105299 8:140608941-140608963 CAGTGGGTGGGGAGGGCCTGTGG - Intronic
1049161593 8:141101684-141101706 CAGTGGGAGGGCAGTGGGGAAGG - Intergenic
1049379750 8:142306022-142306044 CCGAGGGAGGGCAGGGGCCAGGG + Intronic
1049383894 8:142331295-142331317 CACGGCCAGGGGAGGGGCAACGG - Intronic
1049485497 8:142857003-142857025 GAGGGGGAGGGGAGGGGGAGGGG + Intronic
1049541596 8:143211468-143211490 CAGTGGGGGAGGCGGGGCATGGG + Intergenic
1049541651 8:143211599-143211621 CAGTGGGGGAGGCGGGGCAGTGG + Intergenic
1049541676 8:143211650-143211672 CAGTGGGGGAGGCGGGGCAGTGG + Intergenic
1049541684 8:143211667-143211689 CAGTGGGGGAGGCGGGGCAGTGG + Intergenic
1049556701 8:143286091-143286113 CTGGGGGAGGGGAAGGGAAAGGG - Intergenic
1049621410 8:143599896-143599918 CAGGGGGAGGGGAGGAGAGATGG - Exonic
1049712357 8:144071158-144071180 GAGGGGGAGGGGAGGGAGAAAGG - Intergenic
1049712360 8:144071169-144071191 AAGGGGGAGGGGAGGGGGAGGGG - Intergenic
1049712388 8:144071220-144071242 AAGGGGGAGGGGAGGGGGGAGGG - Intergenic
1050398655 9:5227705-5227727 CTGTGGGGGTGGTGGGGCAAGGG + Intergenic
1050975685 9:11935383-11935405 GAGTGGGAGGGGAGGGTGCAGGG + Intergenic
1051195400 9:14558523-14558545 CAGAAGGAAGGGAGGGGCACTGG - Intergenic
1051624554 9:19086309-19086331 AAGGGGGAGGGGAGGGGGAAGGG + Intronic
1051642686 9:19238466-19238488 AAGGGGGAGGGGAGGGGAGAGGG - Intronic
1052331684 9:27276549-27276571 CTGTGGGTGGGGTGGGGAAACGG + Intergenic
1052518917 9:29518177-29518199 GAGTGGGAAGGGAGGGGAGATGG - Intergenic
1052713391 9:32085415-32085437 TAGTGGGAGGGGGGAGGCAGGGG + Intergenic
1052713561 9:32087832-32087854 CAGTGGGTGGGGTGGGGGAAGGG + Intergenic
1052851911 9:33383736-33383758 CAGTTTGAGGGGATGGGCAGAGG - Intergenic
1052868492 9:33481194-33481216 CAGTGGGAGGTGAGCGGCAGGGG + Intergenic
1052951858 9:34219828-34219850 AAGGGGGAGGGGAAGGGGAAGGG - Intronic
1052951916 9:34219948-34219970 AAGGGGGAGGGGAGGGGAGAGGG - Intronic
1052951959 9:34220037-34220059 GAGGGGGAGGGGAGGGGAAGGGG - Intronic
1052999907 9:34572166-34572188 CAGGGGCAGGGCAGGGGCAGGGG - Intronic
1053329215 9:37188608-37188630 GAGGGGGAGGGGCGGGGGAAGGG - Intronic
1053329256 9:37188693-37188715 GAGGGGGAGGGGTGGGGGAAGGG - Intronic
1053564620 9:39235963-39235985 CAGTGGCAGGGAAGGGGCGTGGG + Intronic
1053680019 9:40480284-40480306 CAGTTTGAGGGGATGGGCAGAGG - Intergenic
1053691605 9:40589813-40589835 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1053830403 9:42073865-42073887 CAGTGGCAGGGAAGGGGCGTGGG + Intronic
1054132532 9:61383071-61383093 CAGTGGCAGGGAAGGGGCGTGGG - Intergenic
1054273197 9:63047672-63047694 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1054283693 9:63144651-63144673 CAGTTTGAGGGGATGGGCAGAGG + Intergenic
1054293100 9:63315794-63315816 CAGTTTGAGGGGATGGGCAGAGG - Intergenic
1054302861 9:63390779-63390801 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1054391126 9:64620287-64620309 CAGTTTGAGGGGATGGGCAGAGG - Intergenic
1054401642 9:64717295-64717317 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1054435245 9:65201604-65201626 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1054495145 9:65820077-65820099 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1054504602 9:65896039-65896061 CAGTTTGAGGGGATGGGCAGAGG + Intergenic
1054600155 9:67113590-67113612 CAGTGGCAGGGAAGGGGCGTGGG - Intergenic
1055208980 9:73766205-73766227 CAGTCGGGGGTGGGGGGCAAGGG + Intergenic
1055765369 9:79657442-79657464 CAATGAGAGGGGGTGGGCAATGG - Intronic
1055954445 9:81761040-81761062 CAGTGGGAAAGGAAGTGCAAAGG - Intergenic
1055987232 9:82063811-82063833 CAGTGAGAGGGGAGGGGCAGTGG + Intergenic
1056097217 9:83267299-83267321 CATTGGGAGGGGAGGAGGGAGGG + Intronic
1056258215 9:84822244-84822266 CAGTGGGGGAGGAGTGTCAAGGG - Intronic
1056482065 9:87015928-87015950 AAGTGGGAGGGGAGGGGTGGGGG + Intergenic
1056485219 9:87049861-87049883 CAGAGGGAGGGAGGGGGCAAGGG - Intergenic
1056488835 9:87085337-87085359 CAGGGGAGGGGGAGGGGAAAAGG - Intergenic
1056494389 9:87141663-87141685 CACTAGGAGGGGAGTGGGAAAGG + Intergenic
1056571048 9:87815066-87815088 TAGTGGGAGGGGATTGGCAGGGG - Intergenic
1056762171 9:89423695-89423717 CAGAGGGAGGGGAGGTGCTAAGG - Intronic
1057912794 9:99033389-99033411 GGGTGGGAGGGGAGGGGAGATGG + Intronic
1058170678 9:101677517-101677539 CAGTGGGAAGGGAGCTGGAATGG - Intronic
1058375284 9:104316040-104316062 GAGGGGGAGGGGAGGGGGAGGGG - Intergenic
1058700809 9:107598604-107598626 GGGTGGGAGGGAAGGGGCAATGG - Intergenic
1058940435 9:109808325-109808347 CAGAGGGAGATGAGGAGCAAAGG + Intronic
1059449483 9:114361501-114361523 CAGTGGGATGGGAGGTGGCAGGG - Intronic
1060124022 9:121024272-121024294 GAGGGGGAGGGGAGGGGGAGGGG + Intronic
1060124046 9:121024312-121024334 GAGGGGGAGGGGAGGGGGAGGGG + Intronic
1060124053 9:121024323-121024345 GAGGGGGAGGGGAGGGGGAGGGG + Intronic
1060182762 9:121545670-121545692 CAGTGCGAGGGGAGGGCCGCTGG + Intergenic
1060220656 9:121762495-121762517 CAGAGGGACAGCAGGGGCAAAGG - Intronic
1060453909 9:123771866-123771888 TGGGGGGAGGGGAGGGGGAAAGG + Intronic
1060591883 9:124822298-124822320 CAGTGGAAGTTGAGGGTCAAAGG - Intergenic
1060815941 9:126635209-126635231 GAGTGGGAGGGCTGGGGGAAGGG - Intronic
1060954571 9:127629398-127629420 CAGTGGGAGGGAAGAGGCTGTGG + Intronic
1061073361 9:128325737-128325759 CATTGGGAGGGTGTGGGCAAAGG - Intronic
1061082772 9:128382143-128382165 GAGTGGGAGGGAAGGCACAATGG + Intronic
1061202873 9:129147532-129147554 CAGAGGGAGGGGATGGGGAGGGG - Exonic
1061274593 9:129562121-129562143 CAGTGGGAAGGCAGGGGTGAGGG + Intergenic
1061293492 9:129665494-129665516 AAGTGGGTGGGGAGGGTGAAGGG + Intergenic
1061304526 9:129724687-129724709 CAAAGAGGGGGGAGGGGCAACGG + Intergenic
1061360414 9:130138442-130138464 GAGGGGGAGGGGATGGGGAAGGG - Exonic
1061390616 9:130315339-130315361 GAGAGGGAGGGGAGTGGGAAGGG - Intronic
1061503949 9:131020120-131020142 GAGTGGGGCGGGAGGGGCTAGGG + Intronic
1061653658 9:132070777-132070799 GTGTGGGAGTCGAGGGGCAAAGG - Intronic
1061923621 9:133795394-133795416 CAGGGGGAGGGGAGGCTCAAGGG + Intronic
1061994572 9:134177112-134177134 CAGGGGGAGAGGAGGGACATGGG - Intergenic
1062059773 9:134488917-134488939 CAGTGTGAGATGAGGGGCAGAGG + Intergenic
1062070572 9:134553108-134553130 CAGTGGAAGGGGCGGGCCAGAGG + Intergenic
1062105709 9:134753761-134753783 GGGTGGCAGGGGAGGGGCAGGGG - Intronic
1062153988 9:135036008-135036030 CCCTGGGAAGGGAGGTGCAAGGG + Intergenic
1062170637 9:135132967-135132989 CAGATGAAGGGGAGGGGCCAGGG + Intergenic
1062249581 9:135587493-135587515 CAGTGTTGGGGGAGGGGCCAGGG + Intergenic
1062312770 9:135948183-135948205 CCGTGGCAGGGCTGGGGCAAGGG + Intronic
1062395806 9:136352346-136352368 CACAGGGTGGGGAGGGGCAGGGG - Intronic
1062477879 9:136738277-136738299 CACTTGGAGGGGAGGGACAGAGG + Intronic
1062540010 9:137037400-137037422 GAGTGAGAGGTGAGAGGCAAGGG + Exonic
1062579970 9:137225120-137225142 CCTTGGGAGGGGCGGGGCCATGG - Exonic
1062623163 9:137431628-137431650 CAGTGGGAGGGGAGGGGCAATGG - Intronic
1062640410 9:137515721-137515743 GATTGGGCGGGGAGGGGCCAGGG - Intronic
1062690192 9:137837626-137837648 AAGAGGGAGGGGAGGGGGAGGGG - Intronic
1185502478 X:608423-608445 GAGGGGGAGGGGAGGGGAACGGG - Intergenic
1185502497 X:608454-608476 GAGGGGGAGGGGAGGGGGAGGGG - Intergenic
1185502504 X:608465-608487 GAGAGGGAGGGGAGGGGGAGGGG - Intergenic
1185537298 X:872774-872796 GAGAGGGAGGGGAGGGGAGAGGG - Intergenic
1185537345 X:872869-872891 GAGGGGAAGGGGAGGGGAAAAGG - Intergenic
1185540483 X:899381-899403 AAGTGGAAGGGGATGGGGAAGGG - Intergenic
1185581371 X:1213246-1213268 AAGGGGGAGGGGAGGGGGAGGGG - Intergenic
1185630846 X:1514854-1514876 CAGGGGAAGGGGAGGGGGAGGGG - Intronic
1185756641 X:2659151-2659173 AAGGGGGAGGGGAGGGGAAGGGG - Intergenic
1186078800 X:5908199-5908221 GAATGGGAGGGGAAGAGCAAGGG + Intronic
1186408157 X:9321816-9321838 CAGGGGGCGGGGAAGGGCGAAGG + Intergenic
1187249049 X:17580560-17580582 CAGTGGGAGGCGTGGGGAACTGG + Intronic
1187286307 X:17907168-17907190 AAGTGGGAGTGGAGGGGTGAGGG - Intergenic
1187414246 X:19078873-19078895 CAGAGGGAGGGGAGGGAAAAAGG + Intronic
1187467668 X:19541383-19541405 CAGTGGGCGGGGCGGGGCAGTGG - Intronic
1189110539 X:38285918-38285940 AAGTGGAAGGGGAGGTGGAAGGG - Exonic
1189113553 X:38320266-38320288 GTGGGGGAGGGGCGGGGCAAGGG + Intronic
1189447658 X:41095617-41095639 TACTGGGAGGGGAGGGGTTATGG + Intronic
1190305157 X:49077808-49077830 TGTTGGCAGGGGAGGGGCAATGG - Intronic
1190367411 X:49709354-49709376 GAGGGGGAGGGGAGGGGGAGGGG + Intergenic
1190727246 X:53197621-53197643 AGGTGGGAGGGGTGAGGCAAGGG - Intronic
1191086113 X:56569033-56569055 GTGTGGGAGGGGAGGGGCAGGGG + Intergenic
1192042530 X:67637971-67637993 CAGTGAGGGGTGAGGGGCAAGGG - Intronic
1192177594 X:68895515-68895537 CAGTGGGAGGGGAGTGGGACAGG + Intergenic
1192190057 X:68985565-68985587 CAGTGGGAGGAGAAGGACAGGGG + Intergenic
1192957558 X:76089395-76089417 CATCGGGGGGTGAGGGGCAAGGG - Intergenic
1193086211 X:77449278-77449300 CAGTAGGTTGGGAGGGGTAATGG + Intronic
1193843346 X:86437425-86437447 CAGTGGGTGGGTAGGAGGAATGG - Intronic
1194682616 X:96872242-96872264 AAGTGGGTGGGGAGGGGAAATGG - Intronic
1194688163 X:96950474-96950496 CAGTGGGTGGGGCAGGGAAAAGG - Intronic
1194792446 X:98167739-98167761 CAGTGGGAGAGGATGGTGAAAGG + Intergenic
1194988495 X:100518326-100518348 GAGTTAGAGGGGAAGGGCAAGGG + Intergenic
1195238933 X:102931954-102931976 GAGAGGGAGGGGAGGGGGAGGGG + Intergenic
1195860755 X:109380499-109380521 CAGAGGAAAGGAAGGGGCAAGGG - Intronic
1196223472 X:113138878-113138900 CAGTGGGGGGGTATGGGCATTGG + Intergenic
1196569519 X:117249088-117249110 GAGAGAGAGGGGAAGGGCAAGGG - Intergenic
1197161215 X:123324517-123324539 CAGTGGGAGTTGAGGGGACATGG - Intronic
1197176257 X:123488704-123488726 CAGTGGGAAGGGATCTGCAAAGG - Exonic
1197302431 X:124797843-124797865 CAGTTGGAGGGTGGGGACAAAGG - Intronic
1197766932 X:130065456-130065478 AAGTGGGAGATGAGGGGCATTGG + Exonic
1197943653 X:131815476-131815498 CAGAGAGTGGGGAGGAGCAAAGG - Intergenic
1198097364 X:133393110-133393132 AAGTGGGAGAGGAGGGAGAATGG + Intronic
1198715937 X:139558080-139558102 CTGGGGGAGGGGAGTGGCAATGG - Intronic
1199728391 X:150606945-150606967 GAGGGGGAGGGGAGGGGGAGGGG - Intronic
1199886104 X:152023485-152023507 GGGTGGGAAGGGTGGGGCAAGGG - Intergenic
1200082984 X:153588539-153588561 CATGGGCAGGGGAGGGGCACAGG + Intronic
1200160073 X:154002576-154002598 CAGCGGGAGGGGAGAGACAGGGG - Intergenic
1200172250 X:154085740-154085762 CAGAGGGTGGGGTGGGGGAAAGG + Intronic
1200364005 X:155641839-155641861 CAGTTTCAGGGGAGGGGGAAGGG + Intronic
1200392571 X:155958578-155958600 CAGTTTCAGGGGAGGGGGAAGGG + Intergenic
1201925543 Y:19283285-19283307 AATTGAGAGGGGAAGGGCAATGG - Intergenic
1202136492 Y:21670909-21670931 GAAGGGGAGGGGAGGGGGAAAGG - Intergenic
1202583246 Y:26403165-26403187 CAAAGGGAGGGCAGGGCCAAAGG + Intergenic