ID: 1062623163

View in Genome Browser
Species Human (GRCh38)
Location 9:137431628-137431650
Sequence CAGTGGGAGGGGAGGGGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623163_1062623178 10 Left 1062623163 9:137431628-137431650 CCATTGCCCCTCCCCTCCCACTG No data
Right 1062623178 9:137431661-137431683 GACCAGGAGTGACCCAGCTGGGG No data
1062623163_1062623180 15 Left 1062623163 9:137431628-137431650 CCATTGCCCCTCCCCTCCCACTG No data
Right 1062623180 9:137431666-137431688 GGAGTGACCCAGCTGGGGACAGG No data
1062623163_1062623186 26 Left 1062623163 9:137431628-137431650 CCATTGCCCCTCCCCTCCCACTG No data
Right 1062623186 9:137431677-137431699 GCTGGGGACAGGCGGGAGGCAGG No data
1062623163_1062623184 22 Left 1062623163 9:137431628-137431650 CCATTGCCCCTCCCCTCCCACTG No data
Right 1062623184 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG No data
1062623163_1062623176 8 Left 1062623163 9:137431628-137431650 CCATTGCCCCTCCCCTCCCACTG No data
Right 1062623176 9:137431659-137431681 GTGACCAGGAGTGACCCAGCTGG No data
1062623163_1062623177 9 Left 1062623163 9:137431628-137431650 CCATTGCCCCTCCCCTCCCACTG No data
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623163_1062623182 19 Left 1062623163 9:137431628-137431650 CCATTGCCCCTCCCCTCCCACTG No data
Right 1062623182 9:137431670-137431692 TGACCCAGCTGGGGACAGGCGGG No data
1062623163_1062623175 -6 Left 1062623163 9:137431628-137431650 CCATTGCCCCTCCCCTCCCACTG No data
Right 1062623175 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG No data
1062623163_1062623181 18 Left 1062623163 9:137431628-137431650 CCATTGCCCCTCCCCTCCCACTG No data
Right 1062623181 9:137431669-137431691 GTGACCCAGCTGGGGACAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623163 Original CRISPR CAGTGGGAGGGGAGGGGCAA TGG (reversed) Intronic