ID: 1062623164

View in Genome Browser
Species Human (GRCh38)
Location 9:137431629-137431651
Sequence CATTGCCCCTCCCCTCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623151_1062623164 17 Left 1062623151 9:137431589-137431611 CCCTGCAGGCCCTCAGCCCCCAG 0: 1
1: 0
2: 5
3: 70
4: 609
Right 1062623164 9:137431629-137431651 CATTGCCCCTCCCCTCCCACTGG No data
1062623161_1062623164 -8 Left 1062623161 9:137431614-137431636 CCACCTCAGTTTGGCCATTGCCC 0: 1
1: 0
2: 1
3: 10
4: 122
Right 1062623164 9:137431629-137431651 CATTGCCCCTCCCCTCCCACTGG No data
1062623160_1062623164 -2 Left 1062623160 9:137431608-137431630 CCAGGACCACCTCAGTTTGGCCA 0: 2
1: 0
2: 0
3: 13
4: 128
Right 1062623164 9:137431629-137431651 CATTGCCCCTCCCCTCCCACTGG No data
1062623159_1062623164 -1 Left 1062623159 9:137431607-137431629 CCCAGGACCACCTCAGTTTGGCC 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1062623164 9:137431629-137431651 CATTGCCCCTCCCCTCCCACTGG No data
1062623155_1062623164 7 Left 1062623155 9:137431599-137431621 CCTCAGCCCCCAGGACCACCTCA 0: 1
1: 1
2: 4
3: 89
4: 716
Right 1062623164 9:137431629-137431651 CATTGCCCCTCCCCTCCCACTGG No data
1062623156_1062623164 1 Left 1062623156 9:137431605-137431627 CCCCCAGGACCACCTCAGTTTGG 0: 1
1: 1
2: 1
3: 23
4: 308
Right 1062623164 9:137431629-137431651 CATTGCCCCTCCCCTCCCACTGG No data
1062623158_1062623164 0 Left 1062623158 9:137431606-137431628 CCCCAGGACCACCTCAGTTTGGC 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1062623164 9:137431629-137431651 CATTGCCCCTCCCCTCCCACTGG No data
1062623150_1062623164 25 Left 1062623150 9:137431581-137431603 CCACGTAGCCCTGCAGGCCCTCA 0: 1
1: 0
2: 1
3: 18
4: 221
Right 1062623164 9:137431629-137431651 CATTGCCCCTCCCCTCCCACTGG No data
1062623152_1062623164 16 Left 1062623152 9:137431590-137431612 CCTGCAGGCCCTCAGCCCCCAGG 0: 1
1: 0
2: 8
3: 85
4: 800
Right 1062623164 9:137431629-137431651 CATTGCCCCTCCCCTCCCACTGG No data
1062623154_1062623164 8 Left 1062623154 9:137431598-137431620 CCCTCAGCCCCCAGGACCACCTC 0: 1
1: 0
2: 6
3: 60
4: 620
Right 1062623164 9:137431629-137431651 CATTGCCCCTCCCCTCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623164 Original CRISPR CATTGCCCCTCCCCTCCCAC TGG Intronic
No off target data available for this crispr