ID: 1062623167

View in Genome Browser
Species Human (GRCh38)
Location 9:137431634-137431656
Sequence GCACCCCAGTGGGAGGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 1, 1: 1, 2: 7, 3: 52, 4: 516}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623167_1062623184 16 Left 1062623167 9:137431634-137431656 CCCCTCCCCTCCCACTGGGGTGC 0: 1
1: 1
2: 7
3: 52
4: 516
Right 1062623184 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG No data
1062623167_1062623187 30 Left 1062623167 9:137431634-137431656 CCCCTCCCCTCCCACTGGGGTGC 0: 1
1: 1
2: 7
3: 52
4: 516
Right 1062623187 9:137431687-137431709 GGCGGGAGGCAGGACAGCTCTGG No data
1062623167_1062623182 13 Left 1062623167 9:137431634-137431656 CCCCTCCCCTCCCACTGGGGTGC 0: 1
1: 1
2: 7
3: 52
4: 516
Right 1062623182 9:137431670-137431692 TGACCCAGCTGGGGACAGGCGGG No data
1062623167_1062623176 2 Left 1062623167 9:137431634-137431656 CCCCTCCCCTCCCACTGGGGTGC 0: 1
1: 1
2: 7
3: 52
4: 516
Right 1062623176 9:137431659-137431681 GTGACCAGGAGTGACCCAGCTGG No data
1062623167_1062623180 9 Left 1062623167 9:137431634-137431656 CCCCTCCCCTCCCACTGGGGTGC 0: 1
1: 1
2: 7
3: 52
4: 516
Right 1062623180 9:137431666-137431688 GGAGTGACCCAGCTGGGGACAGG No data
1062623167_1062623178 4 Left 1062623167 9:137431634-137431656 CCCCTCCCCTCCCACTGGGGTGC 0: 1
1: 1
2: 7
3: 52
4: 516
Right 1062623178 9:137431661-137431683 GACCAGGAGTGACCCAGCTGGGG No data
1062623167_1062623186 20 Left 1062623167 9:137431634-137431656 CCCCTCCCCTCCCACTGGGGTGC 0: 1
1: 1
2: 7
3: 52
4: 516
Right 1062623186 9:137431677-137431699 GCTGGGGACAGGCGGGAGGCAGG No data
1062623167_1062623177 3 Left 1062623167 9:137431634-137431656 CCCCTCCCCTCCCACTGGGGTGC 0: 1
1: 1
2: 7
3: 52
4: 516
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623167_1062623181 12 Left 1062623167 9:137431634-137431656 CCCCTCCCCTCCCACTGGGGTGC 0: 1
1: 1
2: 7
3: 52
4: 516
Right 1062623181 9:137431669-137431691 GTGACCCAGCTGGGGACAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623167 Original CRISPR GCACCCCAGTGGGAGGGGAG GGG (reversed) Intronic
900114909 1:1024296-1024318 ACCACCCAGTGTGAGGGGAGGGG - Intronic
900344334 1:2203952-2203974 GATCCCCAGTGGGAGGTCAGTGG - Intronic
900373931 1:2344695-2344717 CCGCCCCAGTGGGAAGGGAAAGG + Intronic
900543475 1:3215725-3215747 GCACCCGAGGAGGAGGGCAGGGG - Intronic
900580486 1:3406178-3406200 GCACACCAATGGGAGGAGACAGG + Intronic
900977795 1:6028022-6028044 ACACCCCAGAGGGTGGGCAGGGG - Intronic
901317101 1:8316751-8316773 CCACCCCATTGGGAGGGTCGAGG - Intergenic
901772005 1:11535335-11535357 GGACCCCTGAGGGAGGGGACAGG - Intronic
901845622 1:11980407-11980429 CCACCCCAGGGGGAGGCGGGAGG - Exonic
902705548 1:18201690-18201712 ACACCCCAATGAGAGGGCAGAGG - Intronic
902832767 1:19028449-19028471 GCACTCTAGTGGGTGGGAAGAGG - Intergenic
902918428 1:19652501-19652523 CCTCCCCAGTGGGCTGGGAGTGG + Intronic
903065530 1:20697191-20697213 GGACCCCAGTGGGAGGTGGTAGG + Intronic
903193554 1:21669403-21669425 GCTCCGCAGTGAGTGGGGAGCGG - Intergenic
903789134 1:25880886-25880908 GCACAGAGGTGGGAGGGGAGGGG + Intergenic
904344073 1:29856751-29856773 GCACCCCCATGGCTGGGGAGTGG + Intergenic
905473093 1:38207638-38207660 GCACCCCGGTGGGGAGGGACAGG + Intergenic
906051753 1:42880303-42880325 GCAAGCCAGTGGGAGGGGGTGGG + Intergenic
906344083 1:45004420-45004442 GCCCCCCAGTGTGAGGCGGGAGG - Intronic
906492370 1:46278564-46278586 GGAACCCAGGGGCAGGGGAGGGG + Exonic
906643225 1:47454299-47454321 TCACCCAAGTGGGAGTGCAGTGG + Intergenic
907138625 1:52163444-52163466 GCAACCAAGTGGGAGTGGAGTGG - Intronic
907249637 1:53129641-53129663 GAGGCCCAGTGGGAGGGCAGTGG - Intronic
907339950 1:53727709-53727731 CCTTCCCAGAGGGAGGGGAGAGG + Intronic
907421974 1:54353703-54353725 GCAGCCCAGGGCAAGGGGAGTGG + Intronic
908048141 1:60195063-60195085 GCACAGCAGTGAGAGAGGAGAGG + Intergenic
909240738 1:73209540-73209562 TCACCCCAGCTGGAGGGCAGTGG - Intergenic
910254579 1:85235074-85235096 GCACTCCACTGGGTGGGGGGTGG + Intergenic
911062965 1:93763720-93763742 GCACACCAGTGGGGTGGAAGAGG - Intronic
911176994 1:94826965-94826987 GCTCCCCAGGGGCAGGGCAGAGG - Intronic
911183053 1:94877865-94877887 GCACCCCAGTGTGGGTGGAGAGG + Intronic
911391354 1:97248257-97248279 GGAACCCAGTGGGAGGTGATTGG + Intronic
911719710 1:101177614-101177636 GCAGCACAGTGGGAGGTGAGTGG + Intergenic
912628590 1:111227287-111227309 TCACCCCAGTTGGAGTGCAGTGG - Intronic
912679550 1:111720434-111720456 GGAGCCAAGTGGGAGGGGTGAGG + Intronic
912760089 1:112359128-112359150 CTGCCCCAGTGTGAGGGGAGAGG + Intergenic
912889009 1:113507864-113507886 ACACCCCAGTGGAAAGAGAGAGG + Intronic
913112150 1:115666349-115666371 GCATCTGAGTGGGAGTGGAGAGG + Intronic
915073545 1:153291730-153291752 TCACCCCAGTCGGAGCTGAGTGG + Intergenic
915440274 1:155941544-155941566 ACACCTCAGAGGGAGGGGTGTGG - Intergenic
915695693 1:157739485-157739507 GCTCCACAGTGGGAGGTGGGGGG + Intergenic
915941069 1:160118543-160118565 GCAGCCCAATGGAAGGGGTGGGG - Intronic
916079620 1:161224293-161224315 GCCCTCCATTGGGAGGGGACGGG - Intergenic
916304046 1:163309173-163309195 TCACCCAAGTGGGAGTGCAGTGG - Intronic
916309064 1:163374268-163374290 TCACCCAAGTGGGAGTGCAGTGG + Intergenic
919883234 1:201914748-201914770 GCACCAGAGTGCGTGGGGAGGGG - Intronic
920034874 1:203059320-203059342 GCAGCCCAGGGGAAGGGAAGTGG - Intronic
920299333 1:204978799-204978821 GGGCCCCTGTGGGAAGGGAGTGG + Intronic
920312090 1:205054501-205054523 GCACCCCAGACGGAGCAGAGGGG + Intronic
920372789 1:205490099-205490121 TCACCCTAGTGGGCGGGGAGGGG + Intergenic
920516290 1:206586811-206586833 GCATCCCACTGTGAGGCGAGAGG - Exonic
923659370 1:235945171-235945193 GCACCTCACTGGGATGGGATGGG + Intergenic
924041306 1:239986362-239986384 CCATCCCAGTGGGTGTGGAGTGG + Intergenic
1063219291 10:3951086-3951108 GCCCCCAAATGGGAGGTGAGGGG + Intergenic
1063664545 10:8053588-8053610 GCGCCCCAGCGAGAGGGGCGGGG - Intronic
1064653541 10:17534267-17534289 GCACCCCAGGGGCAGGGCAGTGG - Intergenic
1066026318 10:31363018-31363040 ACACCTCAGTTGCAGGGGAGGGG + Intronic
1066087944 10:31989296-31989318 GCAGCACTGTGGGTGGGGAGTGG + Intergenic
1066276274 10:33871583-33871605 GCACCTTAGGGGGAGGGGTGGGG - Intergenic
1067054893 10:43044688-43044710 GCAGAACAGGGGGAGGGGAGCGG + Intergenic
1067478097 10:46579242-46579264 GCACCCCAGCGGGGGCGGCGGGG - Intronic
1067616643 10:47762545-47762567 GCACCCCAGCGGGGGCGGCGGGG + Intergenic
1067779890 10:49193827-49193849 GCAAGGCAGAGGGAGGGGAGAGG + Intergenic
1069623546 10:69852753-69852775 AGACCCCAGTGGGCTGGGAGGGG + Intronic
1069903494 10:71719320-71719342 TGGCCCCAGTGGGAAGGGAGTGG - Intronic
1070657317 10:78280298-78280320 GCTTCCCAGCGGGAGGGTAGAGG - Intergenic
1070834232 10:79437917-79437939 GCAGCCCAGAGGGAGAAGAGAGG + Intronic
1070985946 10:80690015-80690037 GCACCACTGTGGGAGAGGTGAGG + Intergenic
1072614888 10:97042868-97042890 GCCCCCCGGTGGCAAGGGAGAGG - Intronic
1074823510 10:117198668-117198690 ACACCAGAGTGGGAGGGGAGGGG - Intronic
1074950461 10:118329346-118329368 GGACCCCATTGTGAAGGGAGTGG - Intronic
1074967265 10:118502222-118502244 GCCACCCAGGGTGAGGGGAGCGG - Intergenic
1075013228 10:118892475-118892497 GCTACACAGTGGGAGGTGAGTGG - Intergenic
1075321126 10:121492583-121492605 GCTCCCCATTGTGAGGGGATGGG + Intronic
1075426153 10:122343230-122343252 TCTCCCCCGTTGGAGGGGAGGGG - Intergenic
1075997958 10:126893414-126893436 GCACCCCATGGGAAGGTGAGCGG - Intergenic
1076405950 10:130212672-130212694 GGTCCCCAGTGGGAGGGGAGGGG - Intergenic
1076603014 10:131671163-131671185 GCACCCATGGGGGAGGGAAGGGG + Intergenic
1076738683 10:132469895-132469917 GGACCCAAGGGGCAGGGGAGAGG + Intergenic
1076769559 10:132655663-132655685 GCCCTGCAGTGGGAGGGGTGGGG + Intronic
1077341365 11:2027834-2027856 GGAGACCAGTGGGATGGGAGGGG - Intergenic
1079258205 11:18851731-18851753 ACCCCACAGTGGGAGGGGAGGGG - Intergenic
1079347102 11:19662620-19662642 GCACCCCAGTGGCACCGGACAGG + Intronic
1080583470 11:33661838-33661860 TCGCCCCAGCGGGAGTGGAGTGG - Intronic
1081781651 11:45717047-45717069 GCAGGCCGGTGGGAGGAGAGTGG - Intergenic
1082010627 11:47447781-47447803 GCACCCCAGGGGGACAGCAGTGG - Intronic
1083304106 11:61753841-61753863 GGACCGCAGTGGGAGGGGGAGGG + Intronic
1084592056 11:70096389-70096411 GCCCCCCAGCAGGAGGTGAGTGG + Intronic
1084692887 11:70737181-70737203 GCCCCCCAGGGGTAGGGGACTGG + Intronic
1085157018 11:74305078-74305100 GCCCCCCAGCAGGAGGTGAGTGG - Intronic
1085335495 11:75690704-75690726 TCATCCCAGTGGGTGGGGAGAGG - Intergenic
1085445379 11:76597697-76597719 GCACCCCAGTGGCAGGGGAGCGG + Intergenic
1085898058 11:80663449-80663471 GCAGCCCAGCAGGAGGTGAGTGG + Intergenic
1086424283 11:86669128-86669150 GCACTCCAGTGGGAAGAGAAGGG + Intronic
1087317055 11:96615125-96615147 GCTCCCCAGGGAGACGGGAGTGG - Intergenic
1089832701 11:121342758-121342780 TCACCCAAGTGGGAGTGCAGTGG + Intergenic
1090509400 11:127358060-127358082 ACACCCCTGGGGGAGGGGAGAGG - Intergenic
1091164099 11:133455885-133455907 ACACCACAGTGGAAGGGGTGAGG - Intronic
1202824350 11_KI270721v1_random:83023-83045 GGAGACCAGTGGGATGGGAGGGG - Intergenic
1091498382 12:991519-991541 GCAGCCCGGGGGGTGGGGAGGGG + Intronic
1091727616 12:2856733-2856755 TCACCCCAGTGGGTGGGGCTGGG + Intronic
1092864341 12:12746796-12746818 GCACTCCAGAAGGAGGGAAGGGG - Intronic
1093288778 12:17298282-17298304 TCTTCCCAGTGGGTGGGGAGGGG - Intergenic
1093736571 12:22625999-22626021 ACATCGCAGGGGGAGGGGAGAGG - Intronic
1095252169 12:39991578-39991600 GCACCCATGTGGGAAGAGAGGGG - Intronic
1095586818 12:43858937-43858959 GCACTGCAGTGGGAGTGGAAGGG + Intronic
1096182880 12:49560148-49560170 AGGCCCCAGTGGGAGGGGAGGGG + Intronic
1096354412 12:50928233-50928255 GAACCCCAGTGGTAGGAGATGGG - Intronic
1097019111 12:56007609-56007631 GCGGCCCAGTGCGGGGGGAGTGG - Intergenic
1097776808 12:63656648-63656670 GAATCCCAGTGGGAGAGGAAAGG - Intronic
1097892628 12:64793301-64793323 TCACCCAGGTGGGAGGGTAGTGG - Intronic
1098138857 12:67431119-67431141 GCACCAAACTGGGAAGGGAGGGG - Intergenic
1098559436 12:71855232-71855254 GGAACCCAGTGGGAGGTGACTGG - Intronic
1101932740 12:109028067-109028089 CCATCCCAGTGGGTGTGGAGTGG + Intronic
1102038179 12:109783790-109783812 GCACATCAGAGGGAGGGGTGGGG + Intronic
1102652776 12:114454515-114454537 GGACCACAGTGGGAGGAGGGGGG + Intergenic
1102987903 12:117293459-117293481 GCTGGCCAGTGGAAGGGGAGAGG - Intronic
1102995359 12:117345968-117345990 GCAGCCCTGTGAGAGGTGAGAGG + Intronic
1104476121 12:129072015-129072037 GCACCACAGTTGCAGGGGAGAGG + Exonic
1104747686 12:131220309-131220331 GCACAGGAGTGAGAGGGGAGTGG - Intergenic
1104957724 12:132474620-132474642 GCACCGCGGAGGGAGGGGAAGGG - Intergenic
1105845636 13:24291524-24291546 GCACCCCGGTGGGTAGGGAACGG - Intronic
1105867770 13:24475822-24475844 TCACCCAAGTGGGAGTGCAGTGG + Intronic
1106759916 13:32858287-32858309 GAACACCGGGGGGAGGGGAGAGG + Intergenic
1107230296 13:38101421-38101443 GCAGCCTAGTGGGAGGTGATTGG - Intergenic
1108333348 13:49412904-49412926 GCAGCACAGTAGGAGGTGAGTGG - Exonic
1108717096 13:53091794-53091816 GCATCCCAGTGGGAGGCTAGTGG + Intergenic
1110626678 13:77661595-77661617 CCACCTCAGTTGCAGGGGAGGGG + Intergenic
1111657015 13:91166504-91166526 GCACCACGGTGGGAGGAAAGTGG - Intergenic
1112019486 13:95359388-95359410 CCACCACACTGGCAGGGGAGAGG - Intergenic
1112441245 13:99426442-99426464 GCCACCCAGTGGCAGGAGAGGGG - Intergenic
1112662608 13:101529632-101529654 GAAACCCAGTGGGAGGTGATTGG + Intronic
1113117525 13:106889201-106889223 GCTGCACAGTGGGAGGTGAGTGG - Intergenic
1113484917 13:110646587-110646609 GGACACCCGTGGGTGGGGAGTGG + Intronic
1113773870 13:112931121-112931143 GCCTCCCAGTGGGGAGGGAGTGG + Intronic
1114258595 14:21022306-21022328 GAAACCCAGAGGGAGGGGAGGGG - Intronic
1114431734 14:22667196-22667218 GCTCCACAGTAGGAGGTGAGTGG - Intergenic
1114486264 14:23064071-23064093 GCACCCCAGTGTCAGGGGAAAGG - Intronic
1114642406 14:24232397-24232419 GGAACCCAGTGGGGGGGGGGGGG - Exonic
1114866309 14:26598383-26598405 GCGCTCCTGTGGGAAGGGAGGGG + Intergenic
1115552264 14:34515104-34515126 TCACCCAGGTGGGAGTGGAGTGG + Intergenic
1116591458 14:46781162-46781184 GCACTCCAGTGGGATGGCAGGGG - Intergenic
1117046866 14:51821738-51821760 GCATCCCAGGAGGTGGGGAGAGG + Intergenic
1117159437 14:52974128-52974150 GCAGCCTGGTGTGAGGGGAGGGG + Intergenic
1117677384 14:58168476-58168498 GCAAGCAAGTGGGAGAGGAGAGG + Intronic
1117956843 14:61129697-61129719 GGACCCCTGTGTGAGGGGAGGGG - Intergenic
1118952840 14:70450062-70450084 CCACCCCAGTGAGTGGGGTGGGG + Intergenic
1119574180 14:75703249-75703271 TCACTCCAGTGGGAAGAGAGGGG - Intronic
1120885471 14:89448535-89448557 TCAGCCCTGTGGGAGGAGAGAGG - Intronic
1121131549 14:91452182-91452204 TCACCCAAGTGGGAGTGCAGTGG + Intergenic
1121313963 14:92950205-92950227 GCATCCCACTGGGAAGGGAGGGG + Intronic
1121391231 14:93576770-93576792 GCACCCAAGTGGGCAGGGAGAGG + Intronic
1121646435 14:95520492-95520514 GCACCCAAGTGGGAAAGGACAGG - Intergenic
1121950611 14:98167850-98167872 GCACACTGGTGGGAGGGCAGGGG - Intergenic
1122986891 14:105216582-105216604 GCACCCCAGGGGAGGGGCAGGGG + Intronic
1123442342 15:20301530-20301552 GCACCAGAGTGGTAGGAGAGCGG + Intergenic
1124673230 15:31659762-31659784 GCACACAAGTGAGTGGGGAGTGG + Intronic
1124881811 15:33649769-33649791 GCAGACCAGTGGGAGGGTATGGG - Intronic
1125382588 15:39103053-39103075 GGAACCCAGTGGGAGGTGACTGG + Intergenic
1126413255 15:48393757-48393779 GCACAGCAGGAGGAGGGGAGGGG - Intergenic
1126697684 15:51340163-51340185 GGAGCCCAGTGGGAGGTGACTGG - Intergenic
1126746436 15:51830126-51830148 GCGGCTCAGCGGGAGGGGAGGGG - Intronic
1127569668 15:60229754-60229776 GCATGCCAGAGGGAGAGGAGAGG - Intergenic
1128352197 15:66898648-66898670 GCAGCCCAGTGGCAGGTGTGGGG - Intergenic
1129089207 15:73130763-73130785 CCACCCCAGTGTGAAGGGAAGGG - Intronic
1129194276 15:73954851-73954873 GCACCCCAGTTGAAGGGGAGAGG - Intergenic
1129423818 15:75451076-75451098 CCACCCCAGGAGGAGGGGAGGGG + Intronic
1129682338 15:77664810-77664832 TGACTCCAGTGGGAGGGGAAGGG + Intronic
1129727459 15:77908913-77908935 GTACCTCAGAGGGAGGGAAGGGG - Intergenic
1129891616 15:79075436-79075458 GCAGCCCAGTTGGACAGGAGAGG - Intronic
1130076430 15:80694782-80694804 GAATCCCAGGGGGAGGGGAGGGG + Intronic
1130467062 15:84197715-84197737 GCACCCCAGTAGCTGGTGAGGGG + Intergenic
1130486541 15:84401462-84401484 GCACCCCAGTAGCTGGTGAGGGG - Intergenic
1130497202 15:84475821-84475843 GCACCCCAGTAGCTGGTGAGGGG - Intergenic
1130875653 15:88011795-88011817 TCACCCCAGTGGCAGGCGAAGGG - Intronic
1131318701 15:91366051-91366073 AACCCACAGTGGGAGGGGAGAGG + Intergenic
1132156087 15:99496044-99496066 CCATCCCAGTGGCAGGGTAGGGG + Intergenic
1132255708 15:100373932-100373954 GGACCCCAGTGGGGTGGGGGCGG + Intergenic
1132423604 15:101695271-101695293 GGAGTCCAGTGGGTGGGGAGAGG - Intronic
1132585914 16:705694-705716 GCTCCCCGGTGGGAGAGGATCGG + Exonic
1132603240 16:783134-783156 GGGCCCCAGTGGGTGGGGAGGGG - Intronic
1132689664 16:1176842-1176864 TCACCCCAGGGGACGGGGAGGGG + Intronic
1134303619 16:13012965-13012987 GCATCCCGGAGGGAGGGGCGTGG + Intronic
1136021480 16:27443138-27443160 GCAGCTTTGTGGGAGGGGAGGGG + Intronic
1136126094 16:28181900-28181922 GAACCCCAAAGGGAGGGGATGGG - Intronic
1137359529 16:47800862-47800884 TCACCCCAGCTGGAGTGGAGAGG + Intergenic
1137587957 16:49675465-49675487 GCACCGCTGAGGGAGGGGTGGGG - Intronic
1138114099 16:54346658-54346680 GCATCCTAGTGGGAGTGAAGCGG + Intergenic
1138127612 16:54451934-54451956 TCAGCCCAGGGTGAGGGGAGAGG + Intergenic
1138182783 16:54953756-54953778 GCAGGCCAGTGGGAGTGGTGGGG + Intergenic
1138829329 16:60358674-60358696 CCACCTCAGTTGCAGGGGAGGGG + Exonic
1140409226 16:74731558-74731580 TCACCCAAGTGGGAGTGCAGTGG + Intronic
1142237189 16:88927833-88927855 GCAGCCCAGCAGGAGGGGACCGG - Intronic
1142697752 17:1643234-1643256 GGACACCGGTGGGCGGGGAGGGG - Intronic
1142747812 17:1968711-1968733 GCATCCCAGGGAGAGGGGACGGG - Intronic
1142753469 17:2001920-2001942 TCAGCCCTGGGGGAGGGGAGGGG + Intronic
1143146985 17:4782837-4782859 GCTCCCCTGTGGGAGGGGTGAGG - Exonic
1143492515 17:7292680-7292702 GAACCCCAGTGGGTGGGGGGAGG + Intronic
1143777903 17:9211454-9211476 GCATCACAGCAGGAGGGGAGAGG - Intronic
1144515157 17:15912338-15912360 TCACCCAAGTGGGAGTGCAGTGG - Intergenic
1144793408 17:17874739-17874761 CCACCCCAGTGGGAAGGCTGTGG - Intronic
1145017753 17:19410265-19410287 GCACCCAGTTGGGAGGGGTGAGG + Intergenic
1145124944 17:20292368-20292390 GCACCCCAGCTGGAGTGCAGTGG + Intronic
1146439016 17:32877221-32877243 GCTCCTCAGTGGGCCGGGAGGGG - Intergenic
1146453986 17:32995392-32995414 GCACCCCTGGGAAAGGGGAGAGG - Exonic
1146678719 17:34791881-34791903 GCAGCCCATGGGGAGGGCAGAGG - Intergenic
1146880846 17:36441398-36441420 GCAACCTGGTGGGAGGGGATGGG - Intergenic
1147341474 17:39755181-39755203 GGACCCCAGGGGTAGGGGACAGG - Intergenic
1147893936 17:43738093-43738115 GCAACCCAGTGGGAAGGGTGGGG - Intergenic
1148160218 17:45445540-45445562 GCACCTCATTGGGAGGAGACGGG - Exonic
1148751212 17:49946927-49946949 ACCCCCCAGTCTGAGGGGAGAGG - Intergenic
1148751238 17:49947011-49947033 ACCCCCCAGTCTGAGGGGAGAGG - Intergenic
1148756118 17:49973818-49973840 AGATCCCAGAGGGAGGGGAGGGG - Exonic
1150449262 17:65252172-65252194 GGAACCCAGTGGGAGGTGATTGG + Intergenic
1150895716 17:69208380-69208402 GCACTCCAGTCTGAGGGGACAGG + Intronic
1150994995 17:70307117-70307139 GTACCTCTGTGGGAGGTGAGAGG - Intergenic
1151365560 17:73614111-73614133 GTACAGCAGTGGGAGGGGAGGGG - Intronic
1151512642 17:74570685-74570707 GAACCCCAGAGGGAGGGGTCTGG - Intergenic
1151786156 17:76276004-76276026 GAACCCCTGGGGGTGGGGAGAGG + Intronic
1151972808 17:77467518-77467540 GGCGCCCGGTGGGAGGGGAGTGG - Intronic
1152155485 17:78629936-78629958 TGACCCCAGTGGGAGGTGAACGG - Intergenic
1152385153 17:79969434-79969456 CCATCCCAGTGGGTGTGGAGTGG - Intronic
1152992510 18:376184-376206 CCACCCCAGGGGGTGGGAAGTGG + Intronic
1153716028 18:7849028-7849050 GTTCCCCTGTGGCAGGGGAGAGG - Intronic
1153872605 18:9334686-9334708 GGACCCCAGCGGGGGCGGAGGGG + Intergenic
1154310876 18:13265414-13265436 GCAGCACAGTGGGAAGGGGGAGG - Intronic
1155070054 18:22307099-22307121 GTACCACAGTGAGCGGGGAGCGG + Intergenic
1155155228 18:23151905-23151927 GCACCACAGTGGTAGCGAAGCGG + Intronic
1156102484 18:33613883-33613905 TCACCCAAGTTGGAGTGGAGCGG - Intronic
1156485716 18:37464405-37464427 CCAGAACAGTGGGAGGGGAGAGG - Intronic
1157478167 18:48036463-48036485 GCACCCCATGGGGTGGGGCGGGG + Intronic
1158430835 18:57385856-57385878 GAACTCCAGTCTGAGGGGAGAGG + Intergenic
1159109839 18:64043249-64043271 GTAGCCCACGGGGAGGGGAGGGG - Intergenic
1160236025 18:77087648-77087670 ACACCGCAGGAGGAGGGGAGGGG + Intronic
1160701368 19:508932-508954 GGAGCCAGGTGGGAGGGGAGCGG + Intronic
1160789957 19:918722-918744 GCTCCGCAGTGGGAGGGGAGGGG + Intronic
1160789972 19:918771-918793 GCTCCGCAGTGGGAGGGGAGGGG + Intronic
1161139430 19:2638733-2638755 GCATCCCCTGGGGAGGGGAGGGG + Intronic
1161266148 19:3365778-3365800 GCACCCAAGGGGCAGGGGAGGGG - Intronic
1161438772 19:4279205-4279227 GGAGCGCAGGGGGAGGGGAGGGG + Exonic
1161590332 19:5126565-5126587 GCACTCCGGGGCGAGGGGAGGGG - Intronic
1161699656 19:5787767-5787789 GCCCCCCAGTGGGGAGGGAACGG - Intronic
1161841930 19:6687150-6687172 GCTCTCCAGTGGGAGGGTTGAGG + Intronic
1161964299 19:7539900-7539922 GGATCCTGGTGGGAGGGGAGGGG - Exonic
1161968276 19:7561128-7561150 CCCCCCAAGAGGGAGGGGAGTGG + Intronic
1162188743 19:8927870-8927892 GCCAGCCAGAGGGAGGGGAGGGG + Intronic
1162658156 19:12148017-12148039 TCACCCAAGTGGGAGTGCAGTGG + Intronic
1163675130 19:18651925-18651947 TCACCTCAGTGGGAGGGAATGGG + Intronic
1163758506 19:19120667-19120689 GGACCGCGGTGGGGGGGGAGAGG - Intronic
1164671733 19:30076357-30076379 GCTCCCCTGTGGGCTGGGAGGGG - Intergenic
1165312127 19:35034725-35034747 CTACCCCAGAGGGTGGGGAGAGG - Intronic
1165353904 19:35292097-35292119 GGCACCCAGGGGGAGGGGAGGGG + Intergenic
1165426155 19:35746546-35746568 GGAGGCCAGTGGCAGGGGAGAGG + Intronic
1165738363 19:38191827-38191849 GACCCCCTGTGTGAGGGGAGAGG - Intronic
1165861595 19:38912025-38912047 GGACTCCAGTGGGAGGGGGCAGG - Intronic
1165900482 19:39167209-39167231 GCCCCGCAGTGGGGAGGGAGCGG + Intronic
1165900626 19:39167681-39167703 GGAGCCCCGTGGGAGGGGGGTGG - Intronic
1166131479 19:40748505-40748527 GGACCCAGGTGGGAGGGGAAAGG - Intronic
1166851726 19:45764570-45764592 GCACCCCAGTGGGGCAGCAGGGG - Intergenic
1166907225 19:46119779-46119801 GCTCACCAGTGGGTGGGGTGGGG + Intergenic
1167774918 19:51548576-51548598 AGGCCCCAGTGGGAGGGGTGGGG + Intergenic
1168654510 19:58117785-58117807 CCGCCCCAGTGGGAGGGTAGAGG + Intronic
925181355 2:1819016-1819038 GCACCCCAGTGGGAGGGACCTGG - Intronic
925201039 2:1967978-1968000 GCACCCCAGGAGGGGAGGAGGGG + Intronic
925348751 2:3187546-3187568 GCACGCTGGTGGGTGGGGAGTGG - Intergenic
925556637 2:5137970-5137992 TCACCCCAGTTGGAGTGCAGTGG - Intergenic
925970511 2:9103539-9103561 GGAGCCCAGGGTGAGGGGAGAGG + Intergenic
927466496 2:23340602-23340624 GCAACCAAGTGGGAGGGGAGAGG + Intergenic
927754478 2:25697775-25697797 GCAACTCGGTGGGAGGGGAGGGG + Intergenic
927877956 2:26671217-26671239 GCTGCCCAGTGGGAGGGGATAGG - Intergenic
927972997 2:27317301-27317323 GCCCAGCAGCGGGAGGGGAGTGG + Intronic
929349879 2:40937714-40937736 GCACCCCACTGGTTGGGGAAAGG + Intergenic
929588419 2:43130387-43130409 GCATCCCAGTGGGATGAGGGAGG - Intergenic
929653413 2:43705293-43705315 TCACCCAGGTGGGAGTGGAGTGG + Intronic
930517598 2:52428212-52428234 GCACCCATGTGAGAGGGAAGTGG - Intergenic
930532948 2:52613304-52613326 GCACCCCAATAGTAGGGGATGGG + Intergenic
931429367 2:62196602-62196624 TCAGCCCAGAGGGAGAGGAGAGG + Intronic
931782552 2:65591262-65591284 GGACCCCAGTGGGAAGGAAGAGG + Intergenic
932058016 2:68466934-68466956 GCAGCGCAGTCGGAGGGGCGGGG + Intronic
932063234 2:68528433-68528455 CCACCTCAGTTGCAGGGGAGGGG + Intronic
932471694 2:71963355-71963377 GAAACCCAGAGGGAGGGCAGAGG - Intergenic
932874213 2:75433452-75433474 GCACCCCAGTGAGGAGGGATGGG - Intergenic
933834427 2:86233826-86233848 GCACTGCAGTGGCATGGGAGAGG + Intronic
934529060 2:95074006-95074028 TCACCCGAGTGGGGTGGGAGTGG - Intergenic
934709953 2:96508288-96508310 GCGCCCCAGAGGGAGGTGAGCGG + Intergenic
934986134 2:98886291-98886313 GCACCTCAGTGGGAGAGAAAAGG - Intronic
935333455 2:101994322-101994344 GCTCTCCAGGGGGAGGGGAGGGG - Intronic
935842576 2:107129332-107129354 ACACCCCAGTTGTAGGGGAAGGG + Intergenic
936328135 2:111523166-111523188 TCTCACCAGTGGGAGGAGAGGGG + Intergenic
936349514 2:111702324-111702346 GCCCCTCCGTGGTAGGGGAGAGG + Intergenic
938687769 2:133756997-133757019 GGAACCCAGTGGGAGGTGATTGG - Intergenic
939547458 2:143570959-143570981 GCAGCACAGTAGGAGGTGAGTGG + Intronic
939961391 2:148568986-148569008 CCCCCCCAGAGGGAGTGGAGGGG + Intergenic
940883738 2:158970304-158970326 GCACTCCTGAGGCAGGGGAGGGG + Intronic
941476156 2:165953812-165953834 GGGCCCCAGCGGGAGGGGCGGGG + Exonic
942885611 2:180919740-180919762 GCACCTCAGTGAGAGGAGTGTGG - Intergenic
942934303 2:181535905-181535927 GAACCCCACTGGGTGGGCAGAGG + Exonic
944433259 2:199659496-199659518 AACCCCCAGAGGGAGGGGAGGGG + Intergenic
944675535 2:202032600-202032622 GCAGCCCGGAGAGAGGGGAGAGG + Intergenic
945769837 2:214029465-214029487 TCACACTAGTGGGCGGGGAGAGG + Intronic
947187089 2:227465052-227465074 GCACCGCAGGGGCAGGGGAAGGG + Intergenic
947722940 2:232380347-232380369 GCACAGCAGGGGGAGGGCAGAGG + Intronic
947727288 2:232408428-232408450 GCACAGCAGGGGGAGGGCAGAGG + Intronic
948120729 2:235528366-235528388 AACCGCCAGTGGGAGGGGAGGGG - Intronic
948213040 2:236209020-236209042 AGTCCCCAGTGGGAGGAGAGAGG - Intronic
948223296 2:236290165-236290187 GAACCCAGGTAGGAGGGGAGGGG + Intergenic
948482551 2:238259292-238259314 GCCCACCAGGGGGAGGGGACTGG + Intronic
948519785 2:238528675-238528697 GCACCCAGGTGGGAGTGCAGTGG - Intergenic
948681245 2:239636163-239636185 GGACCCCAGTGAGTGGTGAGGGG - Intergenic
948771181 2:240251939-240251961 GCACCCCTGGGGGAGGAGCGGGG - Intergenic
1168760696 20:347796-347818 GGAGCTCGGTGGGAGGGGAGCGG - Intronic
1169115178 20:3059773-3059795 GCACACCAGTGGCAGTGAAGTGG - Intergenic
1169132469 20:3173313-3173335 GGTCCCAAGGGGGAGGGGAGCGG - Intronic
1169367080 20:5000974-5000996 GCACCACCGGGGGAGGGGCGAGG + Intronic
1169622610 20:7524896-7524918 CCACCCCAGTGGGAAGACAGAGG - Intergenic
1170509343 20:17060515-17060537 ACACAGCAGTGGGAGGGGAAGGG + Intergenic
1171354597 20:24534308-24534330 GTGCCCCAGATGGAGGGGAGGGG - Intronic
1172011908 20:31850574-31850596 GCACACTGGTCGGAGGGGAGGGG + Intronic
1172083301 20:32358893-32358915 CCCCCCCACTGGGGGGGGAGGGG + Intronic
1172563554 20:35910563-35910585 GGAGCTCAGGGGGAGGGGAGAGG - Intronic
1172768612 20:37364064-37364086 GTACCCCAATGGCAGGGGAGAGG - Intronic
1172945234 20:38682511-38682533 GCACACCAATGGGAGGGCTGAGG + Intergenic
1172972162 20:38881504-38881526 GCAACCCAGTGGGCGGGATGTGG + Intronic
1173495772 20:43516139-43516161 GCACCCCAGAGAGTGAGGAGTGG + Exonic
1173729517 20:45318599-45318621 GCAACCCACTGTGAGGGGTGAGG + Intergenic
1174130609 20:48341343-48341365 GAAGCCCAGTGGGAGGGCCGGGG - Intergenic
1174168246 20:48599907-48599929 GCTCACCTCTGGGAGGGGAGAGG - Intergenic
1175790637 20:61738053-61738075 GGGCCCCAGAGGGTGGGGAGGGG - Intronic
1175883380 20:62273339-62273361 GCTTCCCAGTGGGAGAGGACCGG + Exonic
1176308141 21:5135083-5135105 GCTCACCAGTGGGAGAGAAGCGG + Exonic
1178202457 21:30422992-30423014 GCAGCCCAGCAGGAGGTGAGTGG - Intronic
1178337439 21:31756024-31756046 GCAGCTCAATGGGAGGGGAAGGG - Intergenic
1179804220 21:43826807-43826829 GCAGCCCTGTGCCAGGGGAGGGG - Intergenic
1179848919 21:44126949-44126971 GCTCACCAGTGGGAGAGAAGCGG - Exonic
1179916900 21:44483532-44483554 CGGCACCAGTGGGAGGGGAGAGG + Intergenic
1180003211 21:45004486-45004508 GCACCGCAGTGGGGGTGGACCGG - Intergenic
1180069177 21:45427585-45427607 GCACCACGGCGGGCGGGGAGCGG + Intronic
1180205330 21:46256112-46256134 GCCTCCCAGTGGGTGGGGACTGG - Intronic
1180568671 22:16696772-16696794 GCATACCAGGGGCAGGGGAGCGG + Intergenic
1181015890 22:20068577-20068599 GCACCACAGTCGGCCGGGAGCGG - Intergenic
1181154453 22:20909996-20910018 GCACCCAAGTTGGAGTGCAGTGG - Intergenic
1181274136 22:21677864-21677886 GCACAGCAGGGGGAGGGGAGAGG + Intronic
1181781977 22:25200156-25200178 GCTCCTCTGAGGGAGGGGAGTGG + Intronic
1181831848 22:25565614-25565636 GCGGCCCAGAGGGAGGTGAGAGG - Intronic
1182349771 22:29692715-29692737 GCTCCCCACTGGAAGGAGAGGGG + Intronic
1182418995 22:30239583-30239605 GCTCCAGAGTGGGAGGGGATAGG - Intergenic
1182878642 22:33714146-33714168 TCACCACAGTGGTAGGAGAGTGG - Intronic
1184130604 22:42514601-42514623 GCGCCCCAGAGGGAGGGCAGTGG - Intronic
1184140782 22:42576431-42576453 GCGCCCCAGAGGGAGGGCGGTGG - Intergenic
1184152028 22:42644912-42644934 GCACCACTGTGGGAGGGCCGGGG - Intronic
1184781356 22:46651246-46651268 GGAACCCAGTGGGAGGCCAGGGG - Intronic
1184792505 22:46708744-46708766 GCAGCCCAGAGGGAAGGCAGAGG + Intronic
1185002843 22:48256778-48256800 CATCCACAGTGGGAGGGGAGGGG + Intergenic
1185014139 22:48333665-48333687 ACACCCCTCTGGGAGGGCAGTGG + Intergenic
1185297089 22:50059727-50059749 GCGCCACCGTGGGAGAGGAGAGG - Exonic
949279734 3:2331875-2331897 GCAGCCCAGCGGCAGGGGACTGG - Intronic
950459951 3:13115285-13115307 GCCCCAGAGTGAGAGGGGAGAGG - Intergenic
950533784 3:13568119-13568141 GCACCTCAGTGTGAGGGCAGGGG + Intronic
950550163 3:13661445-13661467 GCACCCAAGTGGGTGCGGAGGGG + Intergenic
951208351 3:19947372-19947394 ACAGTCCAGTGTGAGGGGAGCGG + Exonic
951486348 3:23215750-23215772 GGACCCCACTGGGTGGGTAGGGG - Intronic
951508639 3:23477809-23477831 GGAACCCAGTGGGAGGTGATTGG + Intronic
952342546 3:32458061-32458083 TGGCCTCAGTGGGAGGGGAGTGG - Intronic
954178388 3:48862300-48862322 GCATCACAGTTGGAGGGGAGTGG - Intronic
954259715 3:49429712-49429734 GAACTTCAGTGGGAGGGGCGCGG - Intergenic
954409520 3:50364389-50364411 TCCCCCCAGTGGGATGGGACAGG - Intronic
954424943 3:50438317-50438339 CCAGCCCTGGGGGAGGGGAGAGG - Intronic
955094296 3:55782035-55782057 ACACCCTGGTGGGAGAGGAGTGG - Intronic
955196298 3:56807576-56807598 TCACCCAAATGGAAGGGGAGGGG - Intronic
956195444 3:66649692-66649714 GCACCTCTGTGGGAGGGGGCAGG - Intergenic
956837576 3:73107985-73108007 GCACCACCTTGGCAGGGGAGAGG - Intergenic
957997803 3:87712246-87712268 GGAACCCAGTGGGAGGTGACTGG - Intergenic
958688702 3:97432868-97432890 GAAACCCAGTGGGAGGTGATTGG - Intronic
959412011 3:106036141-106036163 TCACCCAAGTGGGAGTGCAGTGG + Intergenic
959631940 3:108516925-108516947 ACATCCCAGTGGGAGGGGAGCGG - Intronic
959941609 3:112086730-112086752 GGACCCCAGGGGCTGGGGAGGGG - Intronic
960728894 3:120702466-120702488 GCCACACAGTGGGAGGTGAGTGG - Intronic
961125576 3:124414756-124414778 GGACCCCGGTAGGAGGGCAGTGG - Intronic
961643310 3:128378798-128378820 GCCTCCCTGTGGGACGGGAGTGG - Intronic
962328374 3:134455224-134455246 GAACCACAGTGGCAGGGCAGAGG - Intergenic
962374688 3:134850328-134850350 GCTCCCCAGAGAGAGAGGAGAGG + Intronic
962465224 3:135651175-135651197 TCACCCCAGTTGGAGTGCAGTGG - Intergenic
962618019 3:137148131-137148153 GCAACCCACTGAGAGGGGAAAGG - Intergenic
962649889 3:137477821-137477843 GCAGGGCAATGGGAGGGGAGGGG + Intergenic
963199035 3:142568476-142568498 GCAGCCCAGTTGGAGCGGTGAGG + Intronic
964878129 3:161392928-161392950 GGACTCCAGTGCCAGGGGAGAGG + Intergenic
966825324 3:183960276-183960298 GGACACCAGTGAGATGGGAGAGG - Intronic
966999231 3:185316181-185316203 GCATCCCAGGAGGTGGGGAGTGG - Intronic
967971524 3:195003122-195003144 GGTCCCCAGTGGGAGGAGCGAGG + Intergenic
968078418 3:195829860-195829882 GCCCCCCATTGGGTGGGGTGAGG + Intergenic
968472455 4:788303-788325 GCAGCCCTAGGGGAGGGGAGAGG - Intronic
968599498 4:1502408-1502430 GGACTGCAGTGGGAGGGGAGGGG - Intergenic
968610094 4:1552914-1552936 GCACCCGGGTGGGAGTGGGGAGG - Intergenic
968688477 4:1977087-1977109 GCACTACAGTGGGAATGGAGGGG + Intronic
968962707 4:3753452-3753474 GCACCCTTGTGGGAGGGCACTGG + Intergenic
969363865 4:6682578-6682600 GCACCCCACTGGCAGATGAGTGG + Intergenic
970539267 4:17060904-17060926 GGAACCCAGTGGGAGGTGATTGG - Intergenic
971502701 4:27333715-27333737 ACATTCCAGTGGGATGGGAGTGG + Intergenic
972371640 4:38429800-38429822 GAGCCCCAGAGGGAGGGCAGAGG + Intergenic
975335953 4:73175351-73175373 GGAGCCCAGTGGGAGGTGATTGG - Intronic
976015072 4:80542762-80542784 GCACTCCAGTGGTATGGTAGTGG - Intronic
977206418 4:94169603-94169625 GGAGCCCAGTGGGAGGTGATTGG + Intergenic
977619378 4:99119327-99119349 TCACCCAAGTTGGAGGGCAGTGG - Intergenic
979314149 4:119240321-119240343 ACACCACAGTGGGAGGTGAAGGG - Intronic
980716662 4:136637520-136637542 GAAACAGAGTGGGAGGGGAGAGG - Intergenic
980933732 4:139206501-139206523 GCTCACCAGAGGGAGGGGAGAGG - Intergenic
984701871 4:182823572-182823594 GCAGCTCAGTGGGTGGGGATGGG - Intergenic
986123329 5:4863419-4863441 GAACCCCAAGGAGAGGGGAGGGG + Intergenic
986295362 5:6433168-6433190 ACACCCCAGTGGGCAAGGAGCGG + Intergenic
988006136 5:25413590-25413612 TCACCCAAGTTGGAGGGCAGTGG + Intergenic
988509017 5:31849802-31849824 TCACCCAAGTTGGAGGGCAGTGG - Intronic
991271455 5:64787120-64787142 GGACCCTAGTGGGAGGTGACTGG - Intronic
991975027 5:72177095-72177117 GCACCTCTGTGGCAGGGGTGAGG + Intronic
992269473 5:75051163-75051185 GCAGCCATGGGGGAGGGGAGAGG - Intergenic
992334334 5:75749852-75749874 GGACACCAGTGGGGAGGGAGTGG + Intergenic
992704150 5:79370944-79370966 GTATTCCTGTGGGAGGGGAGGGG - Intergenic
993438530 5:87926283-87926305 GCACCCCAGAGGGTTGGCAGGGG - Intergenic
994196616 5:96929543-96929565 GCACCCCGGCGGGAGTGTAGTGG + Intronic
995582477 5:113616525-113616547 CCACTTTAGTGGGAGGGGAGGGG - Intergenic
995854110 5:116574760-116574782 GCAGCCGAGTGCGCGGGGAGCGG + Exonic
996429574 5:123357716-123357738 TCACCCAAGTTGGAGGGCAGTGG - Intronic
996823302 5:127654193-127654215 GCACCACAGTGTGCTGGGAGAGG + Intronic
997581717 5:135021526-135021548 GCACCTCAGTGGGAGGACAGGGG + Intergenic
997645993 5:135482507-135482529 GCTCAGCTGTGGGAGGGGAGGGG + Intergenic
997647123 5:135489084-135489106 GCAGCGCAGGGGGAGGGGAGAGG + Intergenic
997862055 5:137427195-137427217 GCACCTCAGTGGGTTGGGGGAGG - Intronic
997977053 5:138446702-138446724 GGACCCCAGGGGCAGAGGAGAGG - Exonic
998614787 5:143728002-143728024 GCACTCCAATGGGATGGCAGTGG + Intergenic
999024842 5:148217265-148217287 TCACCCAAGTTGGAGGGCAGTGG + Intergenic
999138263 5:149338380-149338402 TGAGCCCAGTGGGAGGGGTGAGG + Intronic
999358175 5:150956878-150956900 CTACCCCAGTGGGAAAGGAGTGG + Intergenic
999603255 5:153290122-153290144 GCACTATACTGGGAGGGGAGGGG + Intergenic
999633239 5:153593225-153593247 TCACCCAGGTGGGAGGGCAGTGG - Intronic
1000172116 5:158712435-158712457 GCAACCCAGAGGGAAGGGATTGG + Intronic
1000281027 5:159782200-159782222 GGACCCCTGTGGCAGGGGACAGG + Intergenic
1001015457 5:168136944-168136966 GCATCCCAGTTGGAATGGAGAGG + Intronic
1001211103 5:169811091-169811113 GAATCCCGATGGGAGGGGAGGGG + Intronic
1001294511 5:170489528-170489550 GCACACCAGTGGGAGGAGGCAGG - Intronic
1002105395 5:176877347-176877369 GCACAACAGTGGGTGGGCAGGGG - Intronic
1002197326 5:177508537-177508559 GCACTTCTGCGGGAGGGGAGCGG + Exonic
1002767833 6:258021-258043 GCACACCAAGGAGAGGGGAGTGG + Intergenic
1002875226 6:1204151-1204173 CCACCCCAGGGAGAGGGCAGGGG + Intergenic
1004203971 6:13574570-13574592 GCACCCCGGGGGGCGGGGCGTGG + Intronic
1004590895 6:17050575-17050597 CCAACCTAGAGGGAGGGGAGAGG + Intergenic
1005243306 6:23855219-23855241 CCACCTCAGTTGCAGGGGAGGGG - Intergenic
1005694964 6:28343322-28343344 GCATCCCAATGGGAGTGGAAAGG + Intronic
1006313438 6:33277267-33277289 GCACCCTGGGGGGCGGGGAGAGG - Exonic
1006341950 6:33452099-33452121 GCACCCCAATGGGAAGGAAAAGG - Exonic
1006433014 6:34009751-34009773 GCATTCCAGCAGGAGGGGAGAGG + Intergenic
1006717802 6:36131186-36131208 GCTGCCCAGTGGGAGGGGTCAGG + Intronic
1007105531 6:39280830-39280852 GAACCCTAGTCTGAGGGGAGTGG - Intergenic
1007346410 6:41232888-41232910 GCTGCACAGCGGGAGGGGAGTGG - Intronic
1007854475 6:44840404-44840426 GCAGACCCGTGGGAGGTGAGAGG + Intronic
1009398537 6:63229305-63229327 CCACCTCAGTTGCAGGGGAGGGG + Intergenic
1010225696 6:73486915-73486937 TCACCCCAGCTGGAGGGCAGTGG - Intronic
1010266617 6:73875021-73875043 GCAGCCCAGTGGGAGGTGTTTGG - Intergenic
1010473698 6:76261527-76261549 GGAACCCAGTGGGAGGTGACTGG + Intergenic
1015840650 6:137473409-137473431 GTGCCTCAGAGGGAGGGGAGGGG + Intergenic
1016429188 6:143964893-143964915 ACACCCAAGTGGGGGGGGAACGG + Exonic
1017571902 6:155754201-155754223 GGAACCCAGTGGGAGGTGATTGG + Intergenic
1017717753 6:157224191-157224213 GAAGGCCAGCGGGAGGGGAGGGG + Intergenic
1017758653 6:157551213-157551235 GCACCCCAGGAGGAAGGGAGGGG - Intronic
1018110088 6:160528119-160528141 GGAGCCCAGTGGGAGGGGATTGG + Intergenic
1018352812 6:162979211-162979233 TCACCCCAGGAGGAAGGGAGTGG - Intronic
1018747822 6:166776038-166776060 GCACCGCTGTGGCTGGGGAGAGG - Intronic
1018890183 6:167977273-167977295 GGTCCCTGGTGGGAGGGGAGAGG - Intergenic
1018890233 6:167977384-167977406 GGTCCCGGGTGGGAGGGGAGAGG - Intergenic
1018890275 6:167977479-167977501 GGTCCCGGGTGGGAGGGGAGAGG - Intergenic
1018890296 6:167977527-167977549 GGTCCCGGGTGGGAGGGGAGAGG - Intergenic
1018890317 6:167977575-167977597 GGTCCCGGGTGGGAGGGGAGAGG - Intergenic
1018890338 6:167977623-167977645 GGTCCCGGGTGGGAGGGGAGAGG - Intergenic
1018890359 6:167977671-167977693 GGTCCCGGGTGGGAGGGGAGAGG - Intergenic
1018890419 6:167977815-167977837 GGTCCCGGGTGGGAGGGGAGAGG - Intergenic
1018890441 6:167977863-167977885 GGCCCCGGGTGGGAGGGGAGAGG - Intergenic
1019034315 6:169041660-169041682 AAACCACAGTGGGAGGGGAGGGG + Intergenic
1019275262 7:172751-172773 TCAGCCCAGTGCGGGGGGAGAGG + Intergenic
1019275274 7:172781-172803 TCAGCCCAGTGCGGGGGGAGAGG + Intergenic
1019275286 7:172811-172833 TCAGCCCAGTGCGGGGGGAGAGG + Intergenic
1019275311 7:172871-172893 TCAGCCCAGTGCGGGGGGAGAGG + Intergenic
1019275323 7:172901-172923 TCAGCCCAGTGCGGGGGGAGAGG + Intergenic
1019275335 7:172931-172953 TCAGCCCAGTGCGGGGGGAGAGG + Intergenic
1019275347 7:172961-172983 TCAGCCCAGTGCGGGGGGAGAGG + Intergenic
1019306846 7:339705-339727 GTGCACCAGTGAGAGGGGAGTGG - Intergenic
1019427611 7:984804-984826 CCAGCCCAGGGGGACGGGAGTGG + Intronic
1019463239 7:1172565-1172587 GCACCTGAGTGAGTGGGGAGGGG - Intergenic
1019719550 7:2559756-2559778 GCATTCCAGTGGGGGGGGGGGGG + Intronic
1020085075 7:5305886-5305908 TCACCCCAGCTGGAGGGCAGTGG + Exonic
1021723939 7:23531944-23531966 GCGACCGAGTGGGAGTGGAGTGG - Exonic
1021731402 7:23598532-23598554 ACACCTGAGGGGGAGGGGAGAGG - Intronic
1022111742 7:27236284-27236306 GAAGCTCAGTAGGAGGGGAGTGG + Intergenic
1022361614 7:29665131-29665153 GAATCCCAGTGGGAGAGGAAAGG + Intergenic
1022699772 7:32748590-32748612 GAATCCCAGTGGGAGAGGAAAGG - Intergenic
1023062912 7:36346099-36346121 ACATCCCAGTGGGAGTGAAGTGG - Intronic
1023393674 7:39733170-39733192 GCACGTGAGGGGGAGGGGAGAGG + Intergenic
1023871382 7:44264721-44264743 CCACTTCAGTGGGAGGGGAGAGG - Intronic
1024702633 7:51920940-51920962 GCTCCACAGTGGGAGGGCAGGGG + Intergenic
1024985240 7:55188376-55188398 GTACCCCAGAGTGAGGGGCGGGG - Intronic
1026260144 7:68747990-68748012 GCTGCACAGTGGGAGGTGAGCGG - Intergenic
1026974746 7:74490461-74490483 GCTCCCCAGTGGGGGTAGAGTGG - Intronic
1027006766 7:74700937-74700959 GCACAGCATTGGGTGGGGAGGGG + Intronic
1028899826 7:96084922-96084944 CTACCCCAGTTGGAGTGGAGCGG + Intronic
1029126005 7:98295641-98295663 TGACTCCAGTGGGAGAGGAGGGG - Intronic
1029350846 7:100011847-100011869 CCACCCCAGGGAGAGGGAAGGGG + Intergenic
1029831681 7:103267041-103267063 GAATCCCAGTGGGAGAGGAAGGG - Intergenic
1031520095 7:122753810-122753832 ACACCCCAGTGGGTGAGTAGGGG - Intronic
1032414549 7:131726152-131726174 GCACCCCAGTGGGTGTCCAGGGG + Intergenic
1033656269 7:143376719-143376741 GCAGGCCAGTGGGATGAGAGGGG + Intergenic
1035171122 7:157018003-157018025 GCAGCCCGGGAGGAGGGGAGCGG + Intergenic
1035463628 7:159061914-159061936 GGATCCCGGTGGGAGGGGAGCGG + Intronic
1035781726 8:2233196-2233218 CCACCGCAGTGGGTGGAGAGAGG + Intergenic
1036444389 8:8808910-8808932 GCAGCACAGAGGGAGGTGAGTGG + Intronic
1036794872 8:11748588-11748610 GGACCTCAGTGTGAGGTGAGAGG + Intronic
1037751388 8:21684621-21684643 CCACCCCAGTGGCTGGGGAGGGG - Intergenic
1037845037 8:22275503-22275525 TCCCCGAAGTGGGAGGGGAGAGG - Intronic
1038372914 8:27011340-27011362 CCACCTCAGTTGCAGGGGAGGGG + Intergenic
1038612000 8:29066811-29066833 TCACCCCAGTTTGAGGGGAGAGG + Intergenic
1038716066 8:29992373-29992395 TCACCCCAGTTGGAGTGAAGTGG + Intergenic
1039426662 8:37492186-37492208 GCGCACCAGTGGGAAGGTAGGGG - Intergenic
1039440923 8:37594961-37594983 GCTCGCCATTGGGAGGGGCGTGG - Intergenic
1040655263 8:49500399-49500421 CCACCCCTTGGGGAGGGGAGAGG + Intergenic
1040966470 8:53086313-53086335 ACACCCTAGAGGGAGGGAAGGGG - Intergenic
1041089857 8:54291930-54291952 GCTCCCAGGTGGGAGTGGAGTGG + Intergenic
1042431130 8:68707613-68707635 TCACCCCAGTTGGAGTGCAGTGG + Intronic
1043218007 8:77620632-77620654 GCACCCAAATGGGAGTGGAGGGG - Intergenic
1044766080 8:95575864-95575886 GCTACACAGTGGGAGAGGAGAGG + Intergenic
1047902376 8:129437106-129437128 TCACCTCCTTGGGAGGGGAGAGG + Intergenic
1048767729 8:137862880-137862902 GCATCCCACTTGGTGGGGAGAGG - Intergenic
1049281194 8:141746094-141746116 TAACCCCAGTGGGAGTGCAGTGG - Intergenic
1049398178 8:142411649-142411671 GGACCCCAAAGGCAGGGGAGAGG - Intergenic
1049865736 8:144934333-144934355 GCAGCTCTGTGGGAGAGGAGAGG - Intronic
1050006942 9:1141618-1141640 TCACCCAAGTGGGAGTGCAGTGG - Intergenic
1050320281 9:4445592-4445614 TCACCCAGGTGGGAGGGCAGTGG - Intergenic
1051410440 9:16784806-16784828 GCTCCGCAGTTGGAGGGCAGGGG - Intronic
1051594567 9:18811353-18811375 CCACCCCAGTGGGGAGGGAAAGG - Intronic
1052413425 9:28148995-28149017 CCACCTCAGTTGCAGGGGAGGGG - Intronic
1052851630 9:33381706-33381728 GGGCGCCAGGGGGAGGGGAGGGG - Intergenic
1052864995 9:33459536-33459558 GAACCCCAGGGGAAGGGAAGGGG - Intergenic
1052868488 9:33481188-33481210 GCCACACAGTGGGAGGTGAGCGG + Intergenic
1054738400 9:68779950-68779972 GCGCGGCAGTGGTAGGGGAGGGG - Intronic
1055381872 9:75716206-75716228 GCACCCCACAGAGGGGGGAGTGG - Intergenic
1055912783 9:81371308-81371330 GCAGACCAAGGGGAGGGGAGTGG + Intergenic
1056020182 9:82432108-82432130 CCACCTCAGTTGCAGGGGAGGGG + Intergenic
1056435342 9:86570333-86570355 GCAGCTCACTGGGAGGGGACTGG + Intergenic
1056576323 9:87858244-87858266 CCACCTCAGTTGCAGGGGAGGGG + Intergenic
1057066707 9:92059940-92059962 ACACCACAGTGGGGGTGGAGGGG - Intronic
1057071718 9:92105210-92105232 CCACCTCAGTTGCAGGGGAGGGG - Intronic
1059213653 9:112538998-112539020 CCACCCCAGTGGGTGTGAAGTGG - Intronic
1059305060 9:113347477-113347499 GCATCCCAGTGGGAGGGTGATGG - Intergenic
1059349904 9:113657060-113657082 GCATCCAGGTGAGAGGGGAGGGG + Intergenic
1059749904 9:117238088-117238110 GCTCCCTAGAAGGAGGGGAGAGG + Intronic
1060146930 9:121261129-121261151 GGCCACCAGTGGGATGGGAGGGG - Intronic
1060479784 9:124011469-124011491 AGACCCAAGAGGGAGGGGAGAGG - Intronic
1060922654 9:127433217-127433239 GCAAAGCAGTGGTAGGGGAGTGG + Intronic
1061059409 9:128243159-128243181 GCACCCTAGTGGGCGGGGAGGGG - Intronic
1061745148 9:132734043-132734065 GGACTCCAGTGGGTGGGCAGTGG - Intronic
1062064784 9:134520630-134520652 CCAGGCCAGTGGGAGGGCAGAGG - Intergenic
1062111355 9:134783736-134783758 GCACCTCTGTGGGAAGGAAGGGG + Intronic
1062117627 9:134817879-134817901 GGAGCCCAGAGGGTGGGGAGTGG + Intronic
1062312864 9:135948657-135948679 GAGACCCAGTGGCAGGGGAGCGG + Intronic
1062623167 9:137431634-137431656 GCACCCCAGTGGGAGGGGAGGGG - Intronic
1186999780 X:15164400-15164422 TCAGCCCAGTTGGAGGAGAGAGG - Intergenic
1187390826 X:18885712-18885734 GTACCCCAGCCGGTGGGGAGAGG - Intergenic
1188753363 X:33930627-33930649 TCACCCAAGTGGGAGTGCAGTGG + Intergenic
1192156000 X:68747067-68747089 GCAGCCCAGTGCAAAGGGAGAGG + Intergenic
1192177592 X:68895509-68895531 CTAGCTCAGTGGGAGGGGAGTGG + Intergenic
1192908806 X:75581290-75581312 CCACCCCAGTGATAGGGGTGGGG + Intergenic
1194598464 X:95889442-95889464 GGAGCCCAGTGGGAGTGGAATGG - Intergenic
1195112049 X:101658800-101658822 GCAACGAAGCGGGAGGGGAGCGG + Intronic
1195690086 X:107617171-107617193 ACACCCCATGGGGTGGGGAGAGG + Intergenic
1196698176 X:118636197-118636219 ACTGCGCAGTGGGAGGGGAGAGG + Intronic
1199630240 X:149772148-149772170 GCACCCCACGGGGGGGGGGGGGG - Intergenic
1200017814 X:153179622-153179644 GCACCCAAGAGGGAGGGCTGTGG + Intronic
1200612842 Y:5344706-5344728 TCACCCCAGTTGGAGTGCAGTGG + Intronic
1201139751 Y:11018571-11018593 TCACCCCAGTTGGAGTGCAGTGG + Intergenic
1201584491 Y:15545967-15545989 TCACCCCAGTTGGAGTGCAGTGG + Intergenic
1202369074 Y:24185313-24185335 GCACCCCAGTAGCTGGTGAGGGG - Intergenic
1202501711 Y:25484804-25484826 GCACCCCAGTAGCTGGTGAGGGG + Intergenic