ID: 1062623168

View in Genome Browser
Species Human (GRCh38)
Location 9:137431635-137431657
Sequence CGCACCCCAGTGGGAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 277}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623168_1062623187 29 Left 1062623168 9:137431635-137431657 CCCTCCCCTCCCACTGGGGTGCG 0: 1
1: 0
2: 5
3: 25
4: 277
Right 1062623187 9:137431687-137431709 GGCGGGAGGCAGGACAGCTCTGG No data
1062623168_1062623182 12 Left 1062623168 9:137431635-137431657 CCCTCCCCTCCCACTGGGGTGCG 0: 1
1: 0
2: 5
3: 25
4: 277
Right 1062623182 9:137431670-137431692 TGACCCAGCTGGGGACAGGCGGG No data
1062623168_1062623184 15 Left 1062623168 9:137431635-137431657 CCCTCCCCTCCCACTGGGGTGCG 0: 1
1: 0
2: 5
3: 25
4: 277
Right 1062623184 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG No data
1062623168_1062623178 3 Left 1062623168 9:137431635-137431657 CCCTCCCCTCCCACTGGGGTGCG 0: 1
1: 0
2: 5
3: 25
4: 277
Right 1062623178 9:137431661-137431683 GACCAGGAGTGACCCAGCTGGGG No data
1062623168_1062623181 11 Left 1062623168 9:137431635-137431657 CCCTCCCCTCCCACTGGGGTGCG 0: 1
1: 0
2: 5
3: 25
4: 277
Right 1062623181 9:137431669-137431691 GTGACCCAGCTGGGGACAGGCGG No data
1062623168_1062623186 19 Left 1062623168 9:137431635-137431657 CCCTCCCCTCCCACTGGGGTGCG 0: 1
1: 0
2: 5
3: 25
4: 277
Right 1062623186 9:137431677-137431699 GCTGGGGACAGGCGGGAGGCAGG No data
1062623168_1062623176 1 Left 1062623168 9:137431635-137431657 CCCTCCCCTCCCACTGGGGTGCG 0: 1
1: 0
2: 5
3: 25
4: 277
Right 1062623176 9:137431659-137431681 GTGACCAGGAGTGACCCAGCTGG No data
1062623168_1062623180 8 Left 1062623168 9:137431635-137431657 CCCTCCCCTCCCACTGGGGTGCG 0: 1
1: 0
2: 5
3: 25
4: 277
Right 1062623180 9:137431666-137431688 GGAGTGACCCAGCTGGGGACAGG No data
1062623168_1062623177 2 Left 1062623168 9:137431635-137431657 CCCTCCCCTCCCACTGGGGTGCG 0: 1
1: 0
2: 5
3: 25
4: 277
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623168 Original CRISPR CGCACCCCAGTGGGAGGGGA GGG (reversed) Intronic
900114910 1:1024297-1024319 CACCACCCAGTGTGAGGGGAGGG - Intronic
900189401 1:1346937-1346959 AGAACCCCCGTGGGAGGGGCTGG - Intronic
900568429 1:3346737-3346759 CCCACCCCACTGTGAGGTGAGGG + Intronic
900606064 1:3524059-3524081 CACACCCCAGAGGGTAGGGATGG + Intronic
901332336 1:8420462-8420484 CACAGCCCACAGGGAGGGGAGGG - Intronic
901919784 1:12527884-12527906 CGGAGCCCTGTGGGAAGGGAAGG + Intergenic
902142090 1:14365349-14365371 CCCACCCCGGGGGGAGGGGGTGG - Intergenic
902385127 1:16072063-16072085 TGCAGCCTAGCGGGAGGGGAAGG - Intronic
903231886 1:21927186-21927208 CCCATCCCAGTCGGTGGGGAAGG - Intronic
905210329 1:36369691-36369713 TGCAGCACAGTGGGAGGGGACGG - Intronic
906033960 1:42739654-42739676 TGCTGCCCTGTGGGAGGGGAGGG - Intronic
906051752 1:42880302-42880324 GGCAAGCCAGTGGGAGGGGGTGG + Intergenic
915087194 1:153396829-153396851 CACTGCCCACTGGGAGGGGATGG + Intergenic
915934676 1:160083631-160083653 CACACCCCAGCTGGAGGTGATGG + Intronic
916079621 1:161224294-161224316 AGCCCTCCATTGGGAGGGGACGG - Intergenic
916497208 1:165356599-165356621 CGCTCCTCAGCGGGAGGAGAGGG + Exonic
918113380 1:181477262-181477284 CTGCCTCCAGTGGGAGGGGATGG + Intronic
919310501 1:195900980-195901002 CCCACCTCAGAGGGAGGAGAAGG - Intergenic
920002866 1:202811425-202811447 CGGCGCCCAGGGGGAGGGGAGGG - Intergenic
920175991 1:204102303-204102325 CCAACCCCAGAGGGAGAGGAAGG - Intronic
920372788 1:205490098-205490120 CTCACCCTAGTGGGCGGGGAGGG + Intergenic
923035866 1:230284841-230284863 TGAACCACGGTGGGAGGGGATGG - Intergenic
923659369 1:235945170-235945192 AGCACCTCACTGGGATGGGATGG + Intergenic
1063407621 10:5812821-5812843 AGCACCCGAGGCGGAGGGGACGG - Intronic
1065447551 10:25818982-25819004 CGCATTCCAGGAGGAGGGGATGG - Intergenic
1066026317 10:31363017-31363039 CACACCTCAGTTGCAGGGGAGGG + Intronic
1067095800 10:43298757-43298779 GGCACGCCAGTGGGAGGTGGGGG - Intergenic
1069780594 10:70953002-70953024 TGCAGGGCAGTGGGAGGGGAGGG + Intergenic
1070018522 10:72559997-72560019 CAGACCAGAGTGGGAGGGGATGG - Intronic
1070250130 10:74766161-74766183 CAGACCCCAGTGCAAGGGGAGGG - Intergenic
1072756354 10:98023792-98023814 CGCTCCCATGTGGGAAGGGAGGG + Intronic
1074074048 10:110104118-110104140 TGCTCCCCAGTGGCAGGAGAGGG + Intronic
1074823511 10:117198669-117198691 CACACCAGAGTGGGAGGGGAGGG - Intronic
1075321125 10:121492582-121492604 GGCTCCCCATTGTGAGGGGATGG + Intronic
1075499432 10:122959040-122959062 CACAGCCCAGTGGCAGGGGCTGG - Intronic
1075590524 10:123687955-123687977 CACCCCCCAGTGGGAGCCGATGG - Exonic
1075655718 10:124159811-124159833 CCAGCCCCAGTGGGAGGGCAGGG + Intergenic
1076405951 10:130212673-130212695 GGGTCCCCAGTGGGAGGGGAGGG - Intergenic
1077432008 11:2520373-2520395 CTCACCCCTTTGGGAGGGGTCGG + Intronic
1077453690 11:2665453-2665475 GGCACGACAGTGGGTGGGGACGG + Intronic
1079258206 11:18851732-18851754 CACCCCACAGTGGGAGGGGAGGG - Intergenic
1080558851 11:33443248-33443270 CGCACCACTGTGGGAGGCCAAGG - Intergenic
1081527022 11:43934330-43934352 TGCGCACCAGTGGGAGGTGAGGG + Intronic
1083304105 11:61753840-61753862 GGGACCGCAGTGGGAGGGGGAGG + Intronic
1084737610 11:71115837-71115859 TACACTCCAGTGGGAGGTGATGG - Intronic
1084742578 11:71149231-71149253 GGCACACCAGTGGCGGGGGAAGG - Intronic
1085053587 11:73391952-73391974 CTGACCCCAGCGTGAGGGGAGGG + Intronic
1086424282 11:86669127-86669149 GGCACTCCAGTGGGAAGAGAAGG + Intronic
1088058094 11:105610065-105610087 CGCAGCCCAGTGGCAGAAGAGGG + Exonic
1088504218 11:110513241-110513263 CTCAGCCAAGTGGGAGAGGATGG - Intergenic
1089609428 11:119661180-119661202 CGCATCACGCTGGGAGGGGAGGG + Exonic
1089622610 11:119730161-119730183 CCTCCCCCAGGGGGAGGGGATGG - Intergenic
1091410799 12:237892-237914 CGGCCCACAGTGGGTGGGGAAGG + Intronic
1091596674 12:1883173-1883195 CGCAGGCCAGTGGGAGGCCAAGG + Intronic
1091727615 12:2856732-2856754 ATCACCCCAGTGGGTGGGGCTGG + Intronic
1091798519 12:3310548-3310570 TGCACCACAGTGGGAGGGGAGGG - Intergenic
1092126913 12:6080943-6080965 TGCACACCAGTGGGTGGGGTGGG + Intronic
1093288779 12:17298283-17298305 CTCTTCCCAGTGGGTGGGGAGGG - Intergenic
1095586817 12:43858936-43858958 AGCACTGCAGTGGGAGTGGAAGG + Intronic
1095962341 12:47843671-47843693 CGCACCCCAGAGTGTGGGAAGGG - Exonic
1095967506 12:47878927-47878949 CTCTCCCCAGTGGAAAGGGAGGG - Intronic
1096178763 12:49539375-49539397 CGCACCCCGGAGGGATGGGGCGG + Exonic
1096182879 12:49560147-49560169 AAGGCCCCAGTGGGAGGGGAGGG + Intronic
1096354413 12:50928234-50928256 GGAACCCCAGTGGTAGGAGATGG - Intronic
1098230776 12:68370120-68370142 CATTCCCCAGTGGGAAGGGAAGG + Intergenic
1100406421 12:94276364-94276386 CCCACACCAGTGGGAGGGGTGGG - Intronic
1102347030 12:112167064-112167086 AGCACCAATGTGGGAGGGGAGGG + Intronic
1104591868 12:130090536-130090558 AGGAACCCAGTGGGAGGTGATGG - Intergenic
1104957725 12:132474621-132474643 GGCACCGCGGAGGGAGGGGAAGG - Intergenic
1105481340 13:20779541-20779563 CAAACCACAGTGGGAGAGGAGGG + Exonic
1107084019 13:36405961-36405983 CGCAGCCTAGGGTGAGGGGAAGG + Intergenic
1107633711 13:42370419-42370441 AGGAACCCAGTGGGAGGTGATGG + Intergenic
1110626676 13:77661594-77661616 CCCACCTCAGTTGCAGGGGAGGG + Intergenic
1114258596 14:21022307-21022329 TGAAACCCAGAGGGAGGGGAGGG - Intronic
1114278796 14:21170702-21170724 AGCACTCAAGTGGGAGAGGAGGG + Intergenic
1114642407 14:24232398-24232420 CGGAACCCAGTGGGGGGGGGGGG - Exonic
1116591459 14:46781163-46781185 AGCACTCCAGTGGGATGGCAGGG - Intergenic
1117135968 14:52734391-52734413 CACACCTCTATGGGAGGGGATGG - Intronic
1117956844 14:61129698-61129720 GGGACCCCTGTGTGAGGGGAGGG - Intergenic
1119473217 14:74911940-74911962 CTCACTCCAGTGGCAGGGCAGGG + Intronic
1119574181 14:75703250-75703272 CTCACTCCAGTGGGAAGAGAGGG - Intronic
1119853700 14:77884003-77884025 AGCACCCCACAGGGAGGTGAGGG - Intronic
1121313962 14:92950204-92950226 GGCATCCCACTGGGAAGGGAGGG + Intronic
1121555252 14:94831655-94831677 CCCACCACAGTGGGAATGGAGGG + Intergenic
1121950612 14:98167851-98167873 CGCACACTGGTGGGAGGGCAGGG - Intergenic
1124240182 15:28021824-28021846 CTTACCCCAGTGGGAGGGGTGGG + Intronic
1124257201 15:28153865-28153887 CGGAGCCCGGTGGGAGGGGCGGG + Intronic
1124377202 15:29135850-29135872 CCCACCCCAGAGGGCGGTGATGG + Intronic
1124567132 15:30826632-30826654 GGGAGCCCAGTGGGAGGGGCGGG - Intergenic
1124783496 15:32658102-32658124 CGCACCCCAGTGAGGTGGGCTGG + Intronic
1124881812 15:33649770-33649792 AGCAGACCAGTGGGAGGGTATGG - Intronic
1126342998 15:47664557-47664579 CACACCCCAGTGAGGAGGGACGG - Intronic
1126746437 15:51830127-51830149 CGCGGCTCAGCGGGAGGGGAGGG - Intronic
1129089209 15:73130764-73130786 ACCACCCCAGTGTGAAGGGAAGG - Intronic
1129423816 15:75451075-75451097 CCCACCCCAGGAGGAGGGGAGGG + Intronic
1129682337 15:77664809-77664831 CTGACTCCAGTGGGAGGGGAAGG + Intronic
1129798347 15:78395128-78395150 CCCACCCCAGTGAGAGGGTTAGG + Intergenic
1130076429 15:80694781-80694803 GGAATCCCAGGGGGAGGGGAGGG + Intronic
1130551405 15:84891978-84892000 CCCACCCCACCGGGAGGGGTGGG + Intronic
1130875654 15:88011796-88011818 GTCACCCCAGTGGCAGGCGAAGG - Intronic
1131151375 15:90049391-90049413 CGCACCGCAGGCAGAGGGGACGG + Intronic
1131370273 15:91875322-91875344 TGATCCACAGTGGGAGGGGAGGG - Intronic
1132603241 16:783135-783157 AGGGCCCCAGTGGGTGGGGAGGG - Intronic
1132983087 16:2749255-2749277 TGCAGCCCTGTGGGAGGGGTTGG + Intergenic
1133031645 16:3013964-3013986 TGCACCCGAGCGGGAGGGGATGG - Exonic
1133225838 16:4339992-4340014 CGCCACCCCGTGGGAGGGGCAGG + Intronic
1133269211 16:4602418-4602440 CTCACTGCAGTGGGAGGGGGTGG - Intergenic
1134246983 16:12547422-12547444 GGCACCCCGGGGAGAGGGGATGG + Intronic
1136126095 16:28181901-28181923 TGAACCCCAAAGGGAGGGGATGG - Intronic
1136605652 16:31331559-31331581 CGCAGACCAGGGGGAGGGGGCGG - Intronic
1136995640 16:35186697-35186719 CACAGCCCAGTGGGAGGGGAGGG + Intergenic
1138458274 16:57133422-57133444 CCCACCCCCAGGGGAGGGGAGGG + Intronic
1138829327 16:60358673-60358695 CCCACCTCAGTTGCAGGGGAGGG + Exonic
1141720623 16:85753291-85753313 CTCAGCCCTGGGGGAGGGGACGG + Intergenic
1142697753 17:1643235-1643257 CGGACACCGGTGGGCGGGGAGGG - Intronic
1142747792 17:1968655-1968677 GGCATCCCAGGGAGAGGGGATGG - Intronic
1142747813 17:1968712-1968734 GGCATCCCAGGGAGAGGGGACGG - Intronic
1142783875 17:2204486-2204508 TGCACCACAGTGGGTGGGGTTGG - Intronic
1144891322 17:18495935-18495957 GGCATCCCAGTGGGAGGAGGTGG + Intergenic
1145007306 17:19344888-19344910 CGCTCCCCAAGGGGAAGGGATGG + Intronic
1145140901 17:20448382-20448404 GGCATCCCAGTGGGAGGAGGTGG - Intergenic
1145259119 17:21344163-21344185 CGCAGCCCTGTGGGAGTGGGAGG + Intergenic
1145317499 17:21743840-21743862 CGCAGCCCTGTGGGAGTGGGAGG - Intergenic
1146684004 17:34828150-34828172 CCCTTCCCAGTGGAAGGGGAGGG + Intergenic
1146880847 17:36441399-36441421 AGCAACCTGGTGGGAGGGGATGG - Intergenic
1146937902 17:36824025-36824047 CACACTCACGTGGGAGGGGAGGG - Intergenic
1147320425 17:39642624-39642646 CGCATGCCAGTGGGAGACGATGG + Intronic
1147466077 17:40612052-40612074 CTCTCCCCAGCTGGAGGGGAAGG + Intergenic
1147692196 17:42323190-42323212 AGCAAGCCAGTGGCAGGGGATGG - Intronic
1147893937 17:43738094-43738116 GGCAACCCAGTGGGAAGGGTGGG - Intergenic
1148031939 17:44627838-44627860 CTCAGCCCTGTGGGAGGGGAGGG - Intergenic
1148157585 17:45432548-45432570 CGCATCCCACGGGGAGGAGAAGG - Intronic
1148160219 17:45445541-45445563 TGCACCTCATTGGGAGGAGACGG - Exonic
1150389267 17:64781239-64781261 CGCATCCCACGGGGAGGAGAAGG - Intergenic
1151365561 17:73614112-73614134 AGTACAGCAGTGGGAGGGGAGGG - Intronic
1152318086 17:79592642-79592664 CTCAACTCAGTGGGAGAGGAGGG - Intergenic
1152433694 17:80262798-80262820 CCCACCCCAGTGGGAGGAGAGGG + Intronic
1152433978 17:80264051-80264073 CCCACCCGAGTGGGAGGAGAGGG + Intronic
1152465586 17:80464408-80464430 AGCAGCTCAGTGGGTGGGGAGGG + Intergenic
1152814207 17:82397868-82397890 CGCACTCCAGAGGGGAGGGAGGG + Intronic
1153229155 18:2920267-2920289 GGCACCTCAGTGGGTGGGCAGGG - Exonic
1156488651 18:37483354-37483376 CGCCCACCAGAGGGAGGGGCAGG - Intronic
1157009428 18:43628365-43628387 CTCACCACAGTGGGTGGGAAGGG + Intergenic
1159654245 18:71012618-71012640 CACACACCAGGGGGAGGGGGAGG - Intergenic
1159882393 18:73870882-73870904 CAAGCCCCAGTGGGAGGTGACGG + Intergenic
1160151959 18:76402062-76402084 TGCATCCCACAGGGAGGGGAGGG + Intronic
1160543428 18:79637978-79638000 CGGACACGAGTGGGCGGGGAGGG + Intergenic
1160789956 19:918721-918743 CGCTCCGCAGTGGGAGGGGAGGG + Intronic
1160789971 19:918770-918792 CGCTCCGCAGTGGGAGGGGAGGG + Intronic
1160891397 19:1380577-1380599 CTCAGGCCAGTGAGAGGGGAAGG - Intergenic
1160990509 19:1858470-1858492 TGCACTCCAGTGGGAGCAGAAGG + Intronic
1161266149 19:3365779-3365801 AGCACCCAAGGGGCAGGGGAGGG - Intronic
1161446850 19:4323450-4323472 CGCGGCCCAGGGGGAGGAGAGGG + Intronic
1163675129 19:18651924-18651946 CTCACCTCAGTGGGAGGGAATGG + Intronic
1163809067 19:19419085-19419107 CACAGACCAGGGGGAGGGGACGG - Intronic
1164774439 19:30842101-30842123 GGCACCCCAGTGTGAGCAGATGG - Intergenic
1166219172 19:41354001-41354023 CGGCCCCCAGGGGGAGGGCATGG + Intronic
1166568357 19:43778805-43778827 TGCTCCCCAGGGGGAGGGGCTGG - Intronic
1167439742 19:49501109-49501131 TGGACTCCAGAGGGAGGGGACGG + Intergenic
1167549981 19:50153854-50153876 CCCCCGCCAGTGGGAGGTGATGG + Intronic
1168136910 19:54357747-54357769 CTCAGCCCCGGGGGAGGGGAGGG - Intronic
927554275 2:24021547-24021569 TGCCTCCCAGTGGGAGCGGAGGG - Intronic
927754477 2:25697774-25697796 TGCAACTCGGTGGGAGGGGAGGG + Intergenic
928342406 2:30456226-30456248 CTGACACCACTGGGAGGGGATGG + Intronic
930532947 2:52613303-52613325 AGCACCCCAATAGTAGGGGATGG + Intergenic
931426841 2:62179140-62179162 CTGACCCCTGGGGGAGGGGAAGG + Intergenic
931467583 2:62505421-62505443 CACATGCCAGTGGGAGTGGATGG + Intronic
932063232 2:68528432-68528454 CCCACCTCAGTTGCAGGGGAGGG + Intronic
932365660 2:71151650-71151672 CTCACCCCAGTGTGACTGGAAGG - Intergenic
932874214 2:75433453-75433475 GGCACCCCAGTGAGGAGGGATGG - Intergenic
934060289 2:88286140-88286162 AGGACCCCAGTGGGTAGGGAAGG + Intergenic
935333456 2:101994323-101994345 TGCTCTCCAGGGGGAGGGGAGGG - Intronic
935842575 2:107129331-107129353 GACACCCCAGTTGTAGGGGAAGG + Intergenic
937917124 2:127104810-127104832 TGCAACCCAAAGGGAGGGGAAGG + Intronic
941476155 2:165953811-165953833 CGGGCCCCAGCGGGAGGGGCGGG + Exonic
942547637 2:177081125-177081147 CACACCCCAGTGGAGTGGGAAGG - Intergenic
943167528 2:184349431-184349453 CCCACCTAAGTGGGATGGGAGGG - Intergenic
944433258 2:199659495-199659517 CAACCCCCAGAGGGAGGGGAGGG + Intergenic
944674035 2:202020260-202020282 CTCACCCCAGAGGTAGGGGAGGG - Intergenic
947187088 2:227465051-227465073 GGCACCGCAGGGGCAGGGGAAGG + Intergenic
948843674 2:240672736-240672758 CGCGCGCCAGTGGGCGGGGACGG - Intergenic
948850090 2:240701574-240701596 CGCACGCCACTGGACGGGGAAGG + Intergenic
1170509342 20:17060514-17060536 CACACAGCAGTGGGAGGGGAAGG + Intergenic
1173430818 20:42985806-42985828 CGCCCCCCAGAGCCAGGGGAAGG + Intronic
1173583711 20:44165980-44166002 CGCATGCCAGTGAGGGGGGATGG - Intronic
1173596821 20:44263945-44263967 GGGACCCCAGAGGGATGGGAGGG + Intronic
1175835548 20:61991837-61991859 CGCACTCCAGTGGGATGAGCCGG + Intronic
1176150390 20:63587932-63587954 CACACTGCAGTGGGTGGGGAAGG - Exonic
1176385047 21:6134966-6134988 CTCAGCCCAGTGGGCGGTGATGG + Intergenic
1176409445 21:6440162-6440184 CGCTCCAGAGTGGGAAGGGAAGG - Intergenic
1178337440 21:31756025-31756047 AGCAGCTCAATGGGAGGGGAAGG - Intergenic
1178961775 21:37072797-37072819 GGCCTCCCTGTGGGAGGGGAGGG + Exonic
1179684938 21:43048484-43048506 CGCTCCAGAGTGGGAAGGGAAGG - Intergenic
1179711173 21:43264069-43264091 CCCTCCCCAGGGGAAGGGGAGGG - Intergenic
1179738426 21:43403286-43403308 CTCAGCCCAGTGGGCGGTGATGG - Intergenic
1179959392 21:44759577-44759599 CCCACCACAGTGGGAGGGCCCGG + Intergenic
1180026342 21:45164461-45164483 CGCAGCCCACTGGGAGAGGCAGG + Intronic
1181711826 22:24696062-24696084 GGCACCCCAGAGGGAGGGAGGGG - Intergenic
1181774123 22:25147542-25147564 GGCATCCCAGGGGGAGGGCATGG - Intronic
1182148062 22:28009570-28009592 CGCTGCCCAGGTGGAGGGGAAGG - Intronic
1183472424 22:38016724-38016746 CGCACCGCGGGGGGAGGGGGCGG + Intronic
1185197699 22:49482746-49482768 GTCACCCCAGTGTGAGAGGAAGG + Intronic
950452538 3:13073343-13073365 CGCACCCCGGATGGACGGGAGGG - Intergenic
950533783 3:13568118-13568140 GGCACCTCAGTGTGAGGGCAGGG + Intronic
950550162 3:13661444-13661466 GGCACCCAAGTGGGTGCGGAGGG + Intergenic
954400598 3:50317605-50317627 GCCACCCCAGTGGGAGTGGAGGG - Intergenic
954906519 3:54067747-54067769 CTCTGCCCAGAGGGAGGGGATGG + Intergenic
956487597 3:69739409-69739431 CGCACCCGGGCGGGAGGGGCTGG - Intergenic
957898255 3:86451884-86451906 GCCACCCCAGTGGAAGGGTAAGG - Intergenic
959653648 3:108776365-108776387 CCCAACCCAGTGGGGGGAGAAGG + Intergenic
960657733 3:120024546-120024568 CTTTACCCAGTGGGAGGGGAAGG - Intronic
961803543 3:129471503-129471525 CACACTGCAGTGGGAGGGAATGG + Intronic
962454088 3:135549156-135549178 CGCATGCCAGTTAGAGGGGAGGG + Intergenic
962809159 3:138946891-138946913 CGCTCCCTAGGGGAAGGGGAAGG - Exonic
966152168 3:176877111-176877133 CTCCCCCCAGAGGGAGGGGCAGG + Intergenic
968599499 4:1502409-1502431 GGGACTGCAGTGGGAGGGGAGGG - Intergenic
968624639 4:1621651-1621673 CCCAGTCCAGTGGGAGGGGCTGG - Intronic
969238153 4:5881462-5881484 CACACTGCAGTGGGAGGGCATGG - Intronic
969544785 4:7818626-7818648 GGCACAGCAGTGGGCGGGGATGG - Intronic
975132366 4:70842122-70842144 CTCACCCCAAAGGGAGGTGAGGG - Intergenic
976472039 4:85440191-85440213 AGGAACCCAGTGGGAGGTGATGG - Intergenic
979314150 4:119240322-119240344 AACACCACAGTGGGAGGTGAAGG - Intronic
983908058 4:173205656-173205678 CCCAGCCCAGTGACAGGGGATGG - Intronic
984701872 4:182823573-182823595 TGCAGCTCAGTGGGTGGGGATGG - Intergenic
985650700 5:1105911-1105933 TGCCCCACAGTGGGAGGGGGAGG + Intronic
985992481 5:3574962-3574984 GGCACCCTAGGGAGAGGGGAGGG - Intergenic
986123328 5:4863418-4863440 CGAACCCCAAGGAGAGGGGAGGG + Intergenic
987226969 5:15852364-15852386 CACACTCCAGAGGGAGGGGCTGG - Intronic
988517890 5:31920391-31920413 ACCACCCCAGTGGGGGGGGGGGG - Intronic
992486809 5:77205069-77205091 AGCACCCCACAGGGAGGGGCTGG - Intergenic
993915801 5:93741646-93741668 CGCCCCCCAGTGGGCGGAGAAGG + Intronic
996255286 5:121394330-121394352 CACACCCCGATGGAAGGGGATGG + Intergenic
997581716 5:135021525-135021547 GGCACCTCAGTGGGAGGACAGGG + Intergenic
997977403 5:138448427-138448449 CGGAACCCAGGGGGAGGGAAAGG + Intergenic
1000193127 5:158932052-158932074 CTCTCACCCGTGGGAGGGGAGGG + Intronic
1001953198 5:175830420-175830442 CGCACCTCCGGGGGCGGGGAAGG - Intronic
1002544423 5:179929796-179929818 CACACCCCAGTGGGTGGGTGTGG - Intronic
1005243308 6:23855220-23855242 CCCACCTCAGTTGCAGGGGAGGG - Intergenic
1005883348 6:30076020-30076042 CGTACCACAGGCGGAGGGGAAGG - Intergenic
1009398535 6:63229304-63229326 CCCACCTCAGTTGCAGGGGAGGG + Intergenic
1010123989 6:72411787-72411809 CGCAGCCCTTTGGGAGGGCAAGG - Intergenic
1017758654 6:157551214-157551236 AGCACCCCAGGAGGAAGGGAGGG - Intronic
1019034314 6:169041659-169041681 CAAACCACAGTGGGAGGGGAGGG + Intergenic
1019288491 7:235635-235657 CCCACCCGAGCGGGAGGAGACGG - Intronic
1019344099 7:521208-521230 CGCGACCCACTGGGAGCGGAGGG - Intergenic
1019488160 7:1298938-1298960 TGCACCCCAGGGGGAGAGGGGGG + Intergenic
1019498646 7:1353133-1353155 CAGAGCCCAGTGGGTGGGGAAGG - Intergenic
1019934933 7:4247904-4247926 CCCACACCAGAGGAAGGGGAGGG + Intronic
1020130415 7:5556089-5556111 CGCTCCCCAGTGGGGTGGGGCGG - Intronic
1023377955 7:39577418-39577440 CACACCTCCCTGGGAGGGGAGGG - Intronic
1023798849 7:43815468-43815490 CCCTCCCCAGGGGAAGGGGAAGG + Intergenic
1024702632 7:51920939-51920961 AGCTCCACAGTGGGAGGGCAGGG + Intergenic
1027220279 7:76209566-76209588 GGCAGCCCAGTGGGAGTGGTTGG + Intronic
1028169149 7:87574847-87574869 CTCACACCAGTGGGAGTGGGAGG - Intronic
1028455978 7:91038717-91038739 AGGAACCCAGTGGGAGGTGATGG + Intronic
1029831682 7:103267042-103267064 AGAATCCCAGTGGGAGAGGAAGG - Intergenic
1031983756 7:128148788-128148810 CCTACCCCAGTGGGATAGGAAGG - Intergenic
1032869225 7:135964134-135964156 GGCTCCACAGTTGGAGGGGAGGG + Intronic
1033414691 7:141151657-141151679 AGGACCTCAGTGGGAGGGGAAGG + Intronic
1034151921 7:148923493-148923515 GGCCCCACAGTGGGAGAGGAGGG - Intergenic
1034235992 7:149569906-149569928 CACTCCCTAGCGGGAGGGGAAGG + Intergenic
1034338279 7:150337286-150337308 TGCAGCCCAGTAGGAGGGGTTGG - Exonic
1034411039 7:150942329-150942351 CCCAGCCCTGCGGGAGGGGAGGG + Intergenic
1034882130 7:154770798-154770820 AGCATCCCAGTGTGAGTGGAGGG + Intronic
1035255356 7:157622470-157622492 CGGGCCCCAGTGGGCAGGGAGGG - Intronic
1035280970 7:157777717-157777739 CACATCCCAGTGGGAAGGGCAGG + Intronic
1035355005 7:158271115-158271137 CACACCCCAGGTGGAGGGGGTGG - Intronic
1036185112 8:6615830-6615852 GGCACCGCAATTGGAGGGGAAGG + Intronic
1037751390 8:21684622-21684644 GCCACCCCAGTGGCTGGGGAGGG - Intergenic
1037822272 8:22140760-22140782 TGCACCCCAGTGGGGGGAAATGG - Intronic
1038257543 8:25964125-25964147 CACACCCCAGTACAAGGGGAGGG + Intronic
1038372912 8:27011339-27011361 CCCACCTCAGTTGCAGGGGAGGG + Intergenic
1039021154 8:33208305-33208327 AGCACCCCACTGGGAGGGGCAGG + Intergenic
1039537301 8:38328670-38328692 CTCAACACAGTGGGATGGGATGG + Intronic
1039878650 8:41609402-41609424 GGTAGCCCACTGGGAGGGGAAGG - Exonic
1042021875 8:64377836-64377858 CGCAGCCCGGGGGGAGGGGGTGG - Intergenic
1043218008 8:77620633-77620655 TGCACCCAAATGGGAGTGGAGGG - Intergenic
1044541991 8:93418687-93418709 CCCACCCCAGGGAGAGGGGCAGG - Intergenic
1046338887 8:112826061-112826083 CCCAACCCAGTGGGGAGGGATGG + Intronic
1047702885 8:127467693-127467715 CACATGCCAGTGGGTGGGGATGG - Intergenic
1049241086 8:141537690-141537712 CCCAGCCCAGGGGGAGGGCAGGG - Intergenic
1049761673 8:144334481-144334503 AGAACCCGAGGGGGAGGGGAGGG - Intronic
1051697962 9:19789086-19789108 CACAGCCCAGAGGGAGGGGCCGG - Intergenic
1051742822 9:20267951-20267973 GGCAACCCAGTGGGATGGGGAGG - Intergenic
1052413427 9:28148996-28149018 CCCACCTCAGTTGCAGGGGAGGG - Intronic
1055584653 9:77745385-77745407 CGCACCGCAGTGAGTAGGGAAGG + Intronic
1056020180 9:82432107-82432129 CCCACCTCAGTTGCAGGGGAGGG + Intergenic
1056576321 9:87858243-87858265 CCCACCTCAGTTGCAGGGGAGGG + Intergenic
1057071720 9:92105211-92105233 CCCACCTCAGTTGCAGGGGAGGG - Intronic
1058919976 9:109604027-109604049 CACTTCCCAGTGGGAAGGGAGGG + Intergenic
1059651245 9:116318299-116318321 CCCACCCCCATGGGAGGAGAAGG + Intronic
1060182757 9:121545663-121545685 CGACCCCCAGTGCGAGGGGAGGG + Intergenic
1060224452 9:121782695-121782717 CGCACCCCACAGGGAGCGGCTGG - Intronic
1061059410 9:128243160-128243182 TGCACCCTAGTGGGCGGGGAGGG - Intronic
1061330736 9:129890636-129890658 TGCACCGCCCTGGGAGGGGAGGG + Intronic
1061482123 9:130902544-130902566 CAAACTTCAGTGGGAGGGGAAGG + Exonic
1062009926 9:134261431-134261453 CAAACCCCAGTGGGAGGTGAGGG + Intergenic
1062385858 9:136311282-136311304 GGCAGCCCAGTGGGTGGGGAAGG + Intergenic
1062573174 9:137194768-137194790 GTCCCCACAGTGGGAGGGGAGGG - Intronic
1062623168 9:137431635-137431657 CGCACCCCAGTGGGAGGGGAGGG - Intronic
1185815824 X:3154290-3154312 GGCACCCCAGTGCAAGGGGTGGG + Intergenic
1185872497 X:3675580-3675602 TGCACCCCAGTGGGAGGAAGAGG - Intronic
1187604627 X:20870068-20870090 CTCATCCCAGTGGTGGGGGAGGG + Intergenic
1189775247 X:44464748-44464770 AGAAACCCAGTGAGAGGGGAAGG - Intergenic
1190160724 X:48029727-48029749 AGCACCTCACTGCGAGGGGATGG + Intronic
1192908804 X:75581289-75581311 CCCACCCCAGTGATAGGGGTGGG + Intergenic
1200136058 X:153875390-153875412 CACACCCCTGTGGTGGGGGATGG + Intronic
1200791418 Y:7303122-7303144 TGCACCCCAGTGGGAGGAAGAGG + Intergenic