ID: 1062623169

View in Genome Browser
Species Human (GRCh38)
Location 9:137431636-137431658
Sequence TCGCACCCCAGTGGGAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 182}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623169_1062623177 1 Left 1062623169 9:137431636-137431658 CCTCCCCTCCCACTGGGGTGCGA 0: 1
1: 0
2: 2
3: 11
4: 182
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623169_1062623186 18 Left 1062623169 9:137431636-137431658 CCTCCCCTCCCACTGGGGTGCGA 0: 1
1: 0
2: 2
3: 11
4: 182
Right 1062623186 9:137431677-137431699 GCTGGGGACAGGCGGGAGGCAGG No data
1062623169_1062623187 28 Left 1062623169 9:137431636-137431658 CCTCCCCTCCCACTGGGGTGCGA 0: 1
1: 0
2: 2
3: 11
4: 182
Right 1062623187 9:137431687-137431709 GGCGGGAGGCAGGACAGCTCTGG No data
1062623169_1062623181 10 Left 1062623169 9:137431636-137431658 CCTCCCCTCCCACTGGGGTGCGA 0: 1
1: 0
2: 2
3: 11
4: 182
Right 1062623181 9:137431669-137431691 GTGACCCAGCTGGGGACAGGCGG No data
1062623169_1062623182 11 Left 1062623169 9:137431636-137431658 CCTCCCCTCCCACTGGGGTGCGA 0: 1
1: 0
2: 2
3: 11
4: 182
Right 1062623182 9:137431670-137431692 TGACCCAGCTGGGGACAGGCGGG No data
1062623169_1062623180 7 Left 1062623169 9:137431636-137431658 CCTCCCCTCCCACTGGGGTGCGA 0: 1
1: 0
2: 2
3: 11
4: 182
Right 1062623180 9:137431666-137431688 GGAGTGACCCAGCTGGGGACAGG No data
1062623169_1062623176 0 Left 1062623169 9:137431636-137431658 CCTCCCCTCCCACTGGGGTGCGA 0: 1
1: 0
2: 2
3: 11
4: 182
Right 1062623176 9:137431659-137431681 GTGACCAGGAGTGACCCAGCTGG No data
1062623169_1062623178 2 Left 1062623169 9:137431636-137431658 CCTCCCCTCCCACTGGGGTGCGA 0: 1
1: 0
2: 2
3: 11
4: 182
Right 1062623178 9:137431661-137431683 GACCAGGAGTGACCCAGCTGGGG No data
1062623169_1062623184 14 Left 1062623169 9:137431636-137431658 CCTCCCCTCCCACTGGGGTGCGA 0: 1
1: 0
2: 2
3: 11
4: 182
Right 1062623184 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623169 Original CRISPR TCGCACCCCAGTGGGAGGGG AGG (reversed) Intronic
901332337 1:8420463-8420485 TCACAGCCCACAGGGAGGGGAGG - Intronic
902042047 1:13499673-13499695 GCTCAGGCCAGTGGGAGGGGTGG + Intronic
903219223 1:21859780-21859802 AGCCATCCCAGTGGGAGGGGAGG - Intronic
903691134 1:25174461-25174483 TCGACTCCCAGTGGGAGGGGAGG + Intergenic
913188364 1:116391129-116391151 TCTGACCAAAGTGGGAGGGGAGG + Intronic
913498979 1:119453252-119453274 TCTCTGCCCCGTGGGAGGGGAGG - Intergenic
915328034 1:155091476-155091498 TCTCACCCCGAAGGGAGGGGCGG - Intergenic
916497207 1:165356598-165356620 TCGCTCCTCAGCGGGAGGAGAGG + Exonic
920372787 1:205490097-205490119 CCTCACCCTAGTGGGCGGGGAGG + Intergenic
921177324 1:212606857-212606879 GCGCACTCCAGCGGGAGGGCGGG + Intronic
922675622 1:227547287-227547309 TCACATCCCAGTGGAAGGGGAGG + Intergenic
1063725755 10:8635673-8635695 TCCCACCCCAATAGGAGGCGGGG - Intergenic
1064703614 10:18047766-18047788 TCTCTCCCCAGTGGAAGGGGTGG + Intergenic
1066026316 10:31363016-31363038 TCACACCTCAGTTGCAGGGGAGG + Intronic
1067095801 10:43298758-43298780 GGGCACGCCAGTGGGAGGTGGGG - Intergenic
1070657285 10:78280007-78280029 TCACAGCCCACTTGGAGGGGAGG - Intergenic
1074823512 10:117198670-117198692 CCACACCAGAGTGGGAGGGGAGG - Intronic
1074974932 10:118572527-118572549 TCCCACCCCGGTGGGAGTGTTGG - Intergenic
1075574917 10:123571211-123571233 TCCCACTCCAGTGGGAAGAGAGG - Intergenic
1075795920 10:125119308-125119330 TTCCACCGCAGTGGGAGTGGGGG - Intronic
1076405952 10:130212674-130212696 GGGGTCCCCAGTGGGAGGGGAGG - Intergenic
1078517273 11:12033575-12033597 ACTCACACCAGTGGGAGTGGTGG - Intergenic
1079258207 11:18851733-18851755 ACACCCCACAGTGGGAGGGGAGG - Intergenic
1079314540 11:19396590-19396612 TGGCACCTCACTGGGTGGGGAGG + Intronic
1079408793 11:20167392-20167414 TCTCTCTGCAGTGGGAGGGGAGG - Intergenic
1079639257 11:22783665-22783687 TAGCACCCCTTTGGGAGGAGGGG + Intronic
1085776994 11:79375900-79375922 GATCACCACAGTGGGAGGGGAGG + Intronic
1091289707 11:134431309-134431331 TGGCAACTCAGTGGGAGGGAGGG + Intergenic
1091798520 12:3310549-3310571 GTGCACCACAGTGGGAGGGGAGG - Intergenic
1092126912 12:6080942-6080964 ATGCACACCAGTGGGTGGGGTGG + Intronic
1092758118 12:11783963-11783985 TCGCCTCCCAGTGGGAGGCCTGG + Intronic
1093288780 12:17298284-17298306 TCTCTTCCCAGTGGGTGGGGAGG - Intergenic
1096721292 12:53524723-53524745 TCGCCCCCCAGTACTAGGGGTGG + Exonic
1097189531 12:57212831-57212853 ACGCACCCCACTGGGAGAGCTGG + Exonic
1097277280 12:57822095-57822117 TCCCACCCCAGGAGGAGGGAGGG + Exonic
1098860849 12:75708362-75708384 TTGCACCGCAGTGGCAGGGTTGG + Intergenic
1098915951 12:76257019-76257041 TCAAACCCCAGTTGGTGGGGGGG + Intergenic
1100406423 12:94276365-94276387 CCCCACACCAGTGGGAGGGGTGG - Intronic
1101427313 12:104598821-104598843 TCCCACCCTGGTGGGTGGGGTGG + Intronic
1103394793 12:120599256-120599278 TCGCTCCTCAGTGGGCAGGGAGG - Intergenic
1105270565 13:18871016-18871038 TCATACCCCAGTGGGACAGGAGG - Intergenic
1105481339 13:20779540-20779562 TCAAACCACAGTGGGAGAGGAGG + Exonic
1110626674 13:77661593-77661615 TCCCACCTCAGTTGCAGGGGAGG + Intergenic
1114642408 14:24232399-24232421 CCGGAACCCAGTGGGGGGGGGGG - Exonic
1118994149 14:70821944-70821966 TCTCTCCCCAGGGGGAGGAGGGG + Intergenic
1119410412 14:74426467-74426489 GCGCACCCCAGAGCGATGGGAGG + Intergenic
1119574182 14:75703251-75703273 TCTCACTCCAGTGGGAAGAGAGG - Intronic
1121439505 14:93939835-93939857 TCTCACCCCACTGGGCAGGGTGG + Intronic
1124240181 15:28021823-28021845 TCTTACCCCAGTGGGAGGGGTGG + Intronic
1124257200 15:28153864-28153886 ACGGAGCCCGGTGGGAGGGGCGG + Intronic
1124567133 15:30826633-30826655 AGGGAGCCCAGTGGGAGGGGCGG - Intergenic
1124573424 15:30886139-30886161 TCCCACCCCAGTGGGCCTGGAGG + Intergenic
1129423814 15:75451074-75451096 GCCCACCCCAGGAGGAGGGGAGG + Intronic
1129820982 15:78601828-78601850 TCTCACCGCAGTCGGAGGGCAGG + Exonic
1130551403 15:84891977-84891999 CCCCACCCCACCGGGAGGGGTGG + Intronic
1130661391 15:85833854-85833876 TGGCACCCCTGTGGGTGGGTGGG + Intergenic
1131851766 15:96550919-96550941 TCCCACAGCAGTGGGTGGGGTGG + Intergenic
1132665648 16:1080272-1080294 TCGCTCCCCAGAGGGAAGGCCGG - Intergenic
1132828337 16:1915904-1915926 TCACAGCCCAGTGGGAGCCGTGG + Intronic
1132973260 16:2699205-2699227 CTGCTCCCCAGTGGGCGGGGTGG - Intronic
1136459050 16:30398571-30398593 TCGCCCGCCAGTGGTGGGGGTGG - Exonic
1136995639 16:35186696-35186718 TCACAGCCCAGTGGGAGGGGAGG + Intergenic
1137584716 16:49657527-49657549 TCTGACCCCAAAGGGAGGGGAGG + Intronic
1138458272 16:57133421-57133443 TCCCACCCCCAGGGGAGGGGAGG + Intronic
1138829325 16:60358672-60358694 TCCCACCTCAGTTGCAGGGGAGG + Exonic
1142518127 17:446605-446627 TCTCACCGCAGGGCGAGGGGTGG - Intergenic
1144816997 17:18041204-18041226 TCACACCCCGGGGGGTGGGGCGG - Intronic
1146376632 17:32298915-32298937 CCCCTCCCCAGTGGGAGGTGAGG + Intronic
1146937903 17:36824026-36824048 TCACACTCACGTGGGAGGGGAGG - Intergenic
1147157400 17:38551160-38551182 ACGGAGCCCAGTGGGAGGAGGGG - Exonic
1147212023 17:38877409-38877431 TCCCACCCCAGGAGGAGGGCAGG - Intronic
1147893938 17:43738095-43738117 AGGCAACCCAGTGGGAAGGGTGG - Intergenic
1148031940 17:44627839-44627861 CCTCAGCCCTGTGGGAGGGGAGG - Intergenic
1149020890 17:51962686-51962708 TCACACCCCACAGGGAGTGGGGG + Intronic
1149997818 17:61414034-61414056 TCGCACCCCACAGGGAATGGAGG - Intergenic
1152433692 17:80262797-80262819 GCCCACCCCAGTGGGAGGAGAGG + Intronic
1152433976 17:80264050-80264072 GCCCACCCGAGTGGGAGGAGAGG + Intronic
1152502888 17:80724885-80724907 TTGCATCCCAGTGGGTGAGGTGG - Intronic
1156478627 18:37422224-37422246 TCCCATCTCAGTGGGAGGAGAGG - Intronic
1157622159 18:49022889-49022911 GGGCACGCCTGTGGGAGGGGAGG - Intergenic
1159263531 18:66048538-66048560 TCCCATCCCTGTGGGAGGGTAGG + Intergenic
1160548575 18:79679105-79679127 TCGGACCGCAGCGGGAGGGCGGG - Intergenic
1160789955 19:918720-918742 GCGCTCCGCAGTGGGAGGGGAGG + Intronic
1160789970 19:918769-918791 GCGCTCCGCAGTGGGAGGGGAGG + Intronic
1163035598 19:14567216-14567238 GGGCATCCCTGTGGGAGGGGAGG - Intronic
1163630249 19:18414781-18414803 TCGCAGCCCTGTGGGATTGGTGG + Intergenic
1164489098 19:28690417-28690439 TTCCACCCCAGTGGGAGTGTTGG - Intergenic
1165022754 19:32937290-32937312 TGGGATCCCAGTGGGAGGAGTGG - Intronic
1166765525 19:45250712-45250734 TCTCTCCCCAGTTGGCGGGGGGG - Intronic
1166831673 19:45643231-45643253 TCGAACCCCAGGGTGAGGAGAGG - Intronic
1166907223 19:46119777-46119799 TTGCTCACCAGTGGGTGGGGTGG + Intergenic
1167077735 19:47259450-47259472 TGGAACCCTAGTGGGAGAGGAGG + Intronic
1168452218 19:56475528-56475550 TCACAACCCAGAGGGAGGCGCGG + Intronic
926193030 2:10742520-10742542 TTGCACCCCAGCAGGAGGGCTGG - Intronic
927289267 2:21388777-21388799 TGGCAGCCCAGTGTGAGGTGTGG + Intergenic
927754476 2:25697773-25697795 TTGCAACTCGGTGGGAGGGGAGG + Intergenic
929832492 2:45358310-45358332 TCACACCAAAGTGGGAGTGGGGG + Intergenic
932063230 2:68528431-68528453 TCCCACCTCAGTTGCAGGGGAGG + Intronic
940592627 2:155748745-155748767 TAAACCCCCAGTGGGAGGGGTGG + Intergenic
941476154 2:165953810-165953832 CCGGGCCCCAGCGGGAGGGGCGG + Exonic
943167530 2:184349432-184349454 TCCCACCTAAGTGGGATGGGAGG - Intergenic
944674036 2:202020261-202020283 CCTCACCCCAGAGGTAGGGGAGG - Intergenic
946029744 2:216694639-216694661 TCGCAGCCCAGGGGGCTGGGGGG + Exonic
1172009482 20:31838031-31838053 TGGAACCCCAGTGGGAGGATGGG + Intergenic
1175934105 20:62507287-62507309 TCCAACCCCAGAGGGAGGAGGGG - Intergenic
1178961774 21:37072796-37072818 TGGCCTCCCTGTGGGAGGGGAGG + Exonic
1179500922 21:41808195-41808217 TGGCACCCCAGGGGCAGGGCAGG - Intronic
1179887442 21:44320243-44320265 TCGGACCCCAGCAGGAGGGAAGG - Intronic
1180159725 21:45993626-45993648 TGGCTCCCCAGTGGGGGGTGGGG + Intronic
1181711827 22:24696063-24696085 AGGCACCCCAGAGGGAGGGAGGG - Intergenic
1182422142 22:30253860-30253882 TCCCATCCCACTGGGTGGGGAGG + Intergenic
1184152030 22:42644914-42644936 TTGCACCACTGTGGGAGGGCCGG - Intronic
1184342447 22:43893441-43893463 GCCCACCTCTGTGGGAGGGGAGG - Intergenic
950533782 3:13568117-13568139 TGGCACCTCAGTGTGAGGGCAGG + Intronic
950958139 3:17077082-17077104 TCTCACCCCAGTGGGACTGCTGG + Intronic
954400599 3:50317606-50317628 AGCCACCCCAGTGGGAGTGGAGG - Intergenic
961362823 3:126378796-126378818 TGACATCCCAGTGGTAGGGGAGG - Intergenic
961382130 3:126501837-126501859 TTGCACCCCTGGGGGAGGGGAGG - Exonic
962404714 3:135091142-135091164 TTGCATCCCAGTTGGAGAGGAGG + Intronic
962454087 3:135549155-135549177 TCGCATGCCAGTTAGAGGGGAGG + Intergenic
962875668 3:139534400-139534422 TCTCTCCCCAGGTGGAGGGGTGG - Intronic
966152220 3:176877381-176877403 CAGAGCCCCAGTGGGAGGGGTGG + Intergenic
966592579 3:181698593-181698615 TGGGAGCCCAGTGGGAGGAGTGG - Intergenic
968484614 4:853079-853101 TCCCAGCCCTGTGGGAGGTGAGG - Intronic
968599500 4:1502410-1502432 TGGGACTGCAGTGGGAGGGGAGG - Intergenic
969362961 4:6676895-6676917 TGAAACCCCAGTGGGAAGGGAGG + Intergenic
974674760 4:65076009-65076031 TTCCACCTCAGTGGGAGGGCTGG - Intergenic
975132367 4:70842123-70842145 TCTCACCCCAAAGGGAGGTGAGG - Intergenic
978846304 4:113276919-113276941 TGGCACTACAGTGGGAGTGGGGG - Intronic
986708527 5:10470914-10470936 TCTCATCCCAGTGGCAGGGAAGG + Intronic
988517891 5:31920392-31920414 CACCACCCCAGTGGGGGGGGGGG - Intronic
997581715 5:135021524-135021546 TGGCACCTCAGTGGGAGGACAGG + Intergenic
997697312 5:135871795-135871817 TCTCAGCCCAGGGGGAGGGCAGG + Intronic
998400348 5:141845625-141845647 TCGCCACCCAGTGGATGGGGTGG - Intergenic
998506308 5:142675168-142675190 TCAGACCTCAGTGGGAGGTGGGG + Intronic
1003405193 6:5822088-5822110 TGGAACCCCAGCAGGAGGGGAGG + Intergenic
1004044886 6:12013209-12013231 TCGCATGCCAGGAGGAGGGGGGG - Intronic
1005243310 6:23855221-23855243 TCCCACCTCAGTTGCAGGGGAGG - Intergenic
1005650328 6:27879569-27879591 TCCCACCCCAGGAGGAGGGAGGG + Intergenic
1006638960 6:35479270-35479292 GCCCTCCCCAGTGGGAGTGGGGG - Intronic
1009398533 6:63229303-63229325 TCCCACCTCAGTTGCAGGGGAGG + Intergenic
1014174761 6:118320040-118320062 TGGCCTCCCAGTGGGAGGGCTGG - Intergenic
1016039943 6:139422583-139422605 TCCTACCCCAAAGGGAGGGGTGG + Intergenic
1019034313 6:169041658-169041680 GCAAACCACAGTGGGAGGGGAGG + Intergenic
1019113498 6:169737944-169737966 TGAGACCCTAGTGGGAGGGGTGG - Intergenic
1019488159 7:1298937-1298959 CTGCACCCCAGGGGGAGAGGGGG + Intergenic
1023867527 7:44245303-44245325 TCTCACCCCACTGGGGAGGGTGG - Intronic
1029099519 7:98117109-98117131 TCGTACACCATGGGGAGGGGAGG - Intronic
1029727027 7:102413228-102413250 ATGCACCCCAGTGGGGGAGGAGG + Intronic
1030759394 7:113331956-113331978 TGAGCCCCCAGTGGGAGGGGTGG + Intergenic
1031242974 7:119270014-119270036 TCACACCCCATAGGGAGGGATGG - Intergenic
1032113997 7:129101490-129101512 TCCCAGCCCAGTGGGTGGAGAGG + Intergenic
1032475928 7:132211475-132211497 TCAGTCCCCAGTGGGAGGGGAGG - Intronic
1032869224 7:135964133-135964155 TGGCTCCACAGTTGGAGGGGAGG + Intronic
1035090686 7:156307567-156307589 TAGCACCCCAGAGAAAGGGGCGG + Intergenic
1035171702 7:157020982-157021004 TCGCACCGCAGAGGGATGGCTGG + Intergenic
1037751391 8:21684623-21684645 TGCCACCCCAGTGGCTGGGGAGG - Intergenic
1037802773 8:22044267-22044289 CCTCACCCCCCTGGGAGGGGGGG + Intronic
1038151110 8:24942731-24942753 TTGCACCTTAGGGGGAGGGGCGG + Intergenic
1038372910 8:27011338-27011360 TCCCACCTCAGTTGCAGGGGAGG + Intergenic
1040107664 8:43549617-43549639 TCCCACCCCAGTGTGGGTGGGGG - Intergenic
1040110815 8:43566536-43566558 TCCCACCCCAGGGTGAGTGGGGG - Intergenic
1049621415 8:143599904-143599926 GGCCACCCCAGGGGGAGGGGAGG - Exonic
1052413429 9:28148997-28149019 TCCCACCTCAGTTGCAGGGGAGG - Intronic
1056020178 9:82432106-82432128 TCCCACCTCAGTTGCAGGGGAGG + Intergenic
1056576319 9:87858242-87858264 TCCCACCTCAGTTGCAGGGGAGG + Intergenic
1057071722 9:92105212-92105234 TCCCACCTCAGTTGCAGGGGAGG - Intronic
1058428266 9:104895166-104895188 TCCCACCCCATGGGGAGGTGTGG - Intronic
1058901481 9:109446243-109446265 CAGCACCCCAGTGGGAAGTGGGG + Intronic
1060182756 9:121545662-121545684 GCGACCCCCAGTGCGAGGGGAGG + Intergenic
1060920094 9:127414438-127414460 TGCCACCCCGGTGGGGGGGGGGG - Intergenic
1061059411 9:128243161-128243183 GTGCACCCTAGTGGGCGGGGAGG - Intronic
1061879662 9:133562453-133562475 TCGCACCGCCGTGGGCGGCGTGG + Intronic
1061879676 9:133562498-133562520 TCGCACCGCCGTGGGCGGCGTGG + Intronic
1061879692 9:133562543-133562565 TCGCACCGCCGTGGGCGGCGTGG + Intronic
1061879707 9:133562588-133562610 TCGCACCGCCGTGGGCGGCGTGG + Intronic
1061879723 9:133562633-133562655 TCGCACCGCCGTGGGCGGCGTGG + Intronic
1061879736 9:133562677-133562699 TCGCACCGCCGTGGGCGGCGTGG + Intronic
1061879749 9:133562722-133562744 TCGCACCGCCGTGGGCGGCGTGG + Intronic
1061879762 9:133562766-133562788 TCGCACCGCTGTGGGCGGCGTGG + Intronic
1061879774 9:133562810-133562832 TCGCACCGCTGTGGGCGGCGTGG + Intronic
1061879787 9:133562855-133562877 TCGCACCGCTGTGGGAGGCGTGG + Intronic
1061879812 9:133562944-133562966 TCGCACCGCTGTGGGCGGCGTGG + Intronic
1061879824 9:133562989-133563011 TCGCACCGCTGTGGGCGGCGTGG + Intronic
1062009925 9:134261430-134261452 GCAAACCCCAGTGGGAGGTGAGG + Intergenic
1062131867 9:134900140-134900162 TGGCACCACAAGGGGAGGGGTGG - Intergenic
1062212960 9:135374366-135374388 TTGCACCCCAGTAGGGGGTGGGG + Intergenic
1062440789 9:136568429-136568451 CCCCACCCCAGCTGGAGGGGAGG + Intergenic
1062573175 9:137194769-137194791 TGTCCCCACAGTGGGAGGGGAGG - Intronic
1062623169 9:137431636-137431658 TCGCACCCCAGTGGGAGGGGAGG - Intronic
1185815823 X:3154289-3154311 GGGCACCCCAGTGCAAGGGGTGG + Intergenic
1188262049 X:28033964-28033986 TGGAACCGCAGTGGGAGGGCTGG + Intergenic
1188756997 X:33974753-33974775 TGCCACCCCAGTGGGTGTGGTGG + Intergenic
1192908802 X:75581288-75581310 CCCCACCCCAGTGATAGGGGTGG + Intergenic
1199608880 X:149597210-149597232 TGGCACCCCACGGGGGGGGGGGG + Exonic
1199630242 X:149772150-149772172 TGGCACCCCACGGGGGGGGGGGG - Intergenic