ID: 1062623170

View in Genome Browser
Species Human (GRCh38)
Location 9:137431639-137431661
Sequence CACTCGCACCCCAGTGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 312}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623170_1062623177 -2 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG 0: 1
1: 0
2: 0
3: 29
4: 312
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623170_1062623186 15 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG 0: 1
1: 0
2: 0
3: 29
4: 312
Right 1062623186 9:137431677-137431699 GCTGGGGACAGGCGGGAGGCAGG No data
1062623170_1062623188 28 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG 0: 1
1: 0
2: 0
3: 29
4: 312
Right 1062623188 9:137431690-137431712 GGGAGGCAGGACAGCTCTGGAGG No data
1062623170_1062623182 8 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG 0: 1
1: 0
2: 0
3: 29
4: 312
Right 1062623182 9:137431670-137431692 TGACCCAGCTGGGGACAGGCGGG No data
1062623170_1062623180 4 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG 0: 1
1: 0
2: 0
3: 29
4: 312
Right 1062623180 9:137431666-137431688 GGAGTGACCCAGCTGGGGACAGG No data
1062623170_1062623181 7 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG 0: 1
1: 0
2: 0
3: 29
4: 312
Right 1062623181 9:137431669-137431691 GTGACCCAGCTGGGGACAGGCGG No data
1062623170_1062623187 25 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG 0: 1
1: 0
2: 0
3: 29
4: 312
Right 1062623187 9:137431687-137431709 GGCGGGAGGCAGGACAGCTCTGG No data
1062623170_1062623176 -3 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG 0: 1
1: 0
2: 0
3: 29
4: 312
Right 1062623176 9:137431659-137431681 GTGACCAGGAGTGACCCAGCTGG No data
1062623170_1062623190 30 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG 0: 1
1: 0
2: 0
3: 29
4: 312
Right 1062623190 9:137431692-137431714 GAGGCAGGACAGCTCTGGAGGGG No data
1062623170_1062623178 -1 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG 0: 1
1: 0
2: 0
3: 29
4: 312
Right 1062623178 9:137431661-137431683 GACCAGGAGTGACCCAGCTGGGG No data
1062623170_1062623184 11 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG 0: 1
1: 0
2: 0
3: 29
4: 312
Right 1062623184 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG No data
1062623170_1062623189 29 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG 0: 1
1: 0
2: 0
3: 29
4: 312
Right 1062623189 9:137431691-137431713 GGAGGCAGGACAGCTCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623170 Original CRISPR CACTCGCACCCCAGTGGGAG GGG (reversed) Intronic
901301870 1:8205549-8205571 CACTTGAACCCCAGAGGCAGAGG - Intergenic
903039385 1:20517031-20517053 CACTTGAACCCCGGTGGCAGAGG + Intergenic
905049216 1:35034666-35034688 CACTTGAACCCCAGAGGCAGGGG + Intergenic
906293962 1:44637685-44637707 CACTTGCACAGCAGTGTGAGGGG + Intronic
908408563 1:63840361-63840383 CACTCGAACCCCGGAGGCAGAGG - Intronic
908518162 1:64914645-64914667 CACTTGAACCCCAGAGGCAGAGG - Intronic
909524298 1:76605779-76605801 CACTTGAACCCAAGTGGCAGAGG + Intronic
910391257 1:86746782-86746804 CACTTGAACCCCAGAGGCAGAGG + Intronic
910514071 1:88037938-88037960 AGCTAGCACTCCAGTGGGAGAGG + Intergenic
910580168 1:88816054-88816076 CACTTGAACCCCAGAGGCAGAGG + Intronic
911024206 1:93419853-93419875 CACTTGAACCCCAGAGGCAGAGG + Intergenic
911187510 1:94918408-94918430 CACTCGAACCCGAGAGGCAGAGG + Intronic
911453668 1:98096598-98096620 CACTTGAACCCCAGAGGCAGAGG - Intergenic
914835613 1:151204258-151204280 CACTCAAACCCCAGAGGCAGAGG - Intronic
915109929 1:153557168-153557190 CACTTGAACCCCAGAGGCAGCGG + Intergenic
916403847 1:164477300-164477322 CACTTGAACCCCAGAGGCAGAGG + Intergenic
919453509 1:197798694-197798716 CAGCCGCACTCAAGTGGGAGAGG - Intergenic
919646114 1:200096169-200096191 CACTTGAACCCCAGAGGCAGAGG - Intronic
924559608 1:245146823-245146845 CACTTGAACCCCAGAGGCAGAGG - Intergenic
924579880 1:245314366-245314388 CGCTTGAACCCCAGAGGGAGAGG + Intronic
1062827263 10:581816-581838 GACTCGGACCTCAGTTGGAGAGG - Intronic
1064201709 10:13290209-13290231 CACTCAAACCCCAGAGGCAGAGG + Intronic
1064466162 10:15584211-15584233 CACTCGAACCCTGGAGGGAGAGG + Intronic
1064594394 10:16928611-16928633 CACTTGAACCCCAGAGGCAGAGG - Intronic
1064703613 10:18047763-18047785 GACTCTCTCCCCAGTGGAAGGGG + Intergenic
1065217963 10:23468832-23468854 CGCTCGAACCCAAGTGGCAGAGG - Intergenic
1067007269 10:42676404-42676426 CACTTGAACCCCAGAGGCAGAGG + Intergenic
1067773813 10:49146859-49146881 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1069026272 10:63545769-63545791 CACTCGAACCCCGGAGGCAGAGG - Intronic
1069256890 10:66344141-66344163 CACTTGAACCCCAGAGGCAGAGG + Intronic
1070478648 10:76856707-76856729 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1070549389 10:77479360-77479382 CACTCAAACCACAGTGGGAGGGG + Intronic
1071503889 10:86221673-86221695 ACCTCTCACCCCAGTGTGAGCGG - Intronic
1072676985 10:97474462-97474484 CACTCGAACCCCGGAGGCAGGGG + Intronic
1072891842 10:99330770-99330792 CACTCGCATCCCAGTGTACGAGG + Exonic
1073166855 10:101462593-101462615 CACTTGAACCCCAGAGGCAGAGG + Intronic
1073459440 10:103658243-103658265 CACTCCCAGCCAAGTGAGAGGGG + Intronic
1074724590 10:116295492-116295514 CACTTGAACCCCAGAGGCAGGGG - Intergenic
1074793910 10:116921469-116921491 CGATCCCACCCCAGTGGCAGTGG - Exonic
1074993697 10:118736467-118736489 CACTTGAGCCCCAGAGGGAGAGG - Intronic
1075450723 10:122550298-122550320 CACTCGTCCCCCAGGTGGAGTGG - Intergenic
1076449493 10:130546958-130546980 CACCATCACCACAGTGGGAGTGG + Intergenic
1077453689 11:2665449-2665471 CACTGGCACGACAGTGGGTGGGG + Intronic
1077740659 11:4841847-4841869 CACTTGAACCTCAGTGGCAGAGG + Intronic
1078517274 11:12033578-12033600 CACACTCACACCAGTGGGAGTGG - Intergenic
1079258208 11:18851736-18851758 CACACACCCCACAGTGGGAGGGG - Intergenic
1080337973 11:31221473-31221495 CACTACCACCCCAGTGGGCCTGG - Intronic
1080594636 11:33760065-33760087 CACTAGAATCCCAGAGGGAGAGG + Intronic
1080615201 11:33939681-33939703 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1081384403 11:42454301-42454323 CACTTGCACCCCAGAGGCGGAGG - Intergenic
1081728755 11:45353553-45353575 CATTTGAACCCCAGTGGCAGAGG + Intergenic
1081798457 11:45839577-45839599 CACTTGCACCCAAGAGGCAGAGG - Intergenic
1084066064 11:66705083-66705105 AACTCCAAGCCCAGTGGGAGCGG - Exonic
1084159209 11:67335790-67335812 CACTTGAACCCCAGAGGCAGAGG + Intronic
1085738761 11:79062043-79062065 CACTGGAACCCCAGAGGCAGAGG - Intronic
1089677936 11:120102708-120102730 CACTCTTGCCTCAGTGGGAGTGG - Intergenic
1090096509 11:123746983-123747005 CACTTGAACCCCAGAGGTAGAGG + Intergenic
1091250448 11:134139885-134139907 CAATCGAACCCCAGTGGTACAGG + Exonic
1093179887 12:15954718-15954740 CACTGGCACCACTGTTGGAGAGG - Intronic
1095736057 12:45557343-45557365 CACTCTGCACCCAGTGGGAGAGG + Intergenic
1096620150 12:52859338-52859360 CACTCGAACCCCAGAGGTGGAGG + Intergenic
1097058179 12:56263147-56263169 CACTTGAACCCCAGAGGTAGAGG - Intergenic
1097203037 12:57295951-57295973 CACTTGAACCCCAGTGGCAGAGG - Intronic
1097707654 12:62884415-62884437 CACTTGAACCCCAGAGGCAGAGG + Intronic
1097905090 12:64911277-64911299 CACTCTTATCCCAGTGAGAGTGG + Intergenic
1099508794 12:83508764-83508786 CATTCAAACCCCTGTGGGAGGGG + Intergenic
1100750972 12:97697930-97697952 CACTGGCACCACAATGGCAGAGG - Intergenic
1102130598 12:110525772-110525794 CACTTGAACCCGAGTGGCAGAGG - Intronic
1102378017 12:112439375-112439397 CACTTGAACCCCAGAGGCAGAGG - Intronic
1102498302 12:113334489-113334511 AACTCGGACTCCAGTTGGAGGGG - Exonic
1102888105 12:116536839-116536861 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1103039590 12:117684276-117684298 CACTCCCAAACCAGTGGGAGAGG - Intronic
1103298197 12:119906254-119906276 CACTTGAACCCCGGTGGCAGAGG + Intergenic
1105203960 13:18203659-18203681 CACTTGAACCCCAGAGGCAGAGG + Intergenic
1105282865 13:18979231-18979253 CAGTCCCTGCCCAGTGGGAGAGG + Intergenic
1105532730 13:21234802-21234824 CAGTGGCAGCCCAGAGGGAGAGG + Intergenic
1105591891 13:21800007-21800029 TACTAGGACCCCAGTAGGAGGGG - Intergenic
1106441832 13:29781089-29781111 CACTTGAACCCCAGAGGCAGAGG + Intronic
1106861640 13:33915880-33915902 CACTTGAACCCCAGAGGCAGAGG - Intronic
1107485768 13:40825918-40825940 CACTTGCACCCGAGAGGCAGAGG - Intergenic
1108754751 13:53486407-53486429 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1109228113 13:59721827-59721849 CACAAGCAACCCAGTGGGACTGG - Intronic
1109873342 13:68365743-68365765 GACTGTCACCCCAGTGGGAGTGG - Intergenic
1110346566 13:74454608-74454630 CACTCGAACCCCAGAGGCAGAGG + Intergenic
1110402141 13:75104574-75104596 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1112403789 13:99099818-99099840 CACTTGAACCCCAGAGGCAGAGG + Intergenic
1112512958 13:100026188-100026210 CACTTGAACCCCAGAGGCAGAGG + Intergenic
1113237691 13:108298885-108298907 CACTCGAACCCCAGAGGCAGAGG + Intronic
1113316968 13:109191133-109191155 CACTTGAACCCCAGAGGCAGAGG + Intronic
1113335093 13:109369877-109369899 CACCTGCACCCAAGAGGGAGAGG + Intergenic
1114525634 14:23365696-23365718 CACTCGCACCCCCGGCGGTGCGG + Intronic
1115887812 14:37993421-37993443 TAGTGGCACCCCAGTGGGAGTGG + Intronic
1117536694 14:56709423-56709445 CACTCCCACCTGAGAGGGAGGGG + Intronic
1118388936 14:65280399-65280421 CACTTGAACCCCGGAGGGAGAGG - Intergenic
1118816026 14:69314564-69314586 CACTGGCAGCCCAGTGGGGTTGG + Intronic
1119237175 14:73029432-73029454 CACTTGAACCCCAGAGGCAGAGG + Intergenic
1119456330 14:74758983-74759005 CACTTGAACCCAAGTGGCAGAGG - Intergenic
1119468614 14:74879360-74879382 CACTTGAACCCGAGTGGCAGAGG + Intergenic
1119542232 14:75447739-75447761 CACTTGAACCCCAGAGGCAGAGG - Intronic
1119713098 14:76837056-76837078 CACTTGAACCCCAGAGGCAGAGG + Intronic
1120795616 14:88630112-88630134 CACTTGAACCCCAGAGGCAGAGG - Intronic
1121138845 14:91523289-91523311 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1122530592 14:102423346-102423368 CACTTGAACCCAAGAGGGAGAGG + Intronic
1124240180 15:28021820-28021842 AGCTCTTACCCCAGTGGGAGGGG + Intronic
1124573423 15:30886136-30886158 GACTCCCACCCCAGTGGGCCTGG + Intergenic
1128981145 15:72187075-72187097 CACTTGAACCCCAGAGGTAGAGG + Intronic
1129851918 15:78798375-78798397 CACACCCACCCCATTAGGAGAGG + Intronic
1130536002 15:84785393-84785415 CACTTGAACCCCAGAGGCAGAGG - Intronic
1130669208 15:85895667-85895689 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1131482541 15:92794340-92794362 CACTCGAACCCGAGAGGCAGAGG + Intronic
1132908943 16:2298674-2298696 AAAGCCCACCCCAGTGGGAGTGG - Intronic
1133896643 16:9935783-9935805 CACTTGAACCCAAGAGGGAGAGG - Intronic
1133978074 16:10614334-10614356 CACTTGAACCCCAGAGGCAGAGG + Intergenic
1134890173 16:17834540-17834562 GGCTCGCACCCCACTGGGAGAGG + Intergenic
1136995638 16:35186693-35186715 CAGTCACAGCCCAGTGGGAGGGG + Intergenic
1137633627 16:49966472-49966494 CACTTGAACCCCAGAGGCAGAGG + Intergenic
1137830671 16:51540052-51540074 CACTAACAGCTCAGTGGGAGAGG + Intergenic
1138827570 16:60338838-60338860 CACTCTCACCCAGGTTGGAGTGG - Intergenic
1139090718 16:63643467-63643489 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1139675049 16:68517751-68517773 CACTCTGTCCCCAGGGGGAGGGG + Intergenic
1140025744 16:71289142-71289164 CACTGGGGCCCCAGTGGGCGTGG - Intronic
1140408451 16:74726470-74726492 CACTTGAACCCCAGAGGCAGAGG - Intronic
1141094089 16:81150401-81150423 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1141726116 16:85789706-85789728 CACTTGAACCCCAGAGGGGGAGG + Intronic
1142705610 17:1691891-1691913 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1143020591 17:3915468-3915490 CACTCCCAGCCCGGTGGGACAGG + Intronic
1144239299 17:13294571-13294593 CACTTGAACCCCAGGGGCAGAGG - Intergenic
1145088452 17:19964807-19964829 CACTCGAACCCGAGAGGCAGAGG + Intronic
1146307968 17:31745274-31745296 CACTTGAACCCCAGAGGCAGAGG + Intergenic
1146724331 17:35145565-35145587 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1146890941 17:36506191-36506213 CATGAGCACCCCAGTGGCAGGGG + Intronic
1147153685 17:38532667-38532689 CACTCACACCCAAGTGGGCCTGG - Exonic
1148118364 17:45191891-45191913 CACTTGCACCCAAGAGGCAGAGG - Intergenic
1148587324 17:48790368-48790390 CACATGCACCCCAGATGGAGTGG - Intronic
1149553607 17:57557689-57557711 CATTCGCTCCCCAGTGGGAATGG + Intronic
1149832271 17:59882866-59882888 CACTTGAACCCAAGTGGCAGAGG - Intronic
1149873135 17:60201740-60201762 CACTTGAACCCCAGAGGCAGAGG - Intronic
1149997819 17:61414037-61414059 CAATCGCACCCCACAGGGAATGG - Intergenic
1150423046 17:65056115-65056137 CCCTCGCGCCCCAGGGCGAGAGG - Intronic
1150468197 17:65413257-65413279 CACTTGAACCCCAGAGGCAGAGG + Intergenic
1150499863 17:65640235-65640257 CACTTGAACCCCAGAGGCAGAGG - Intronic
1153037346 18:776275-776297 CACTTGAACCCCAGAGGCAGAGG - Intronic
1155244701 18:23896250-23896272 CACTTGAACCCCAGAGGCAGAGG + Intronic
1155309085 18:24506801-24506823 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1156826136 18:41431996-41432018 CACTTGAACCCCAGAGGCAGAGG + Intergenic
1157092630 18:44654009-44654031 CACTTGAACCCCAGAGGCAGAGG + Intergenic
1158463731 18:57670788-57670810 CGCTTGAACCCCAGAGGGAGGGG - Intronic
1158970531 18:62662396-62662418 CTTTCGCCCTCCAGTGGGAGGGG - Intergenic
1160440379 18:78884839-78884861 CACTCACACCCCCTAGGGAGTGG + Intergenic
1160998303 19:1895458-1895480 CACTCTCTCCCCTCTGGGAGGGG - Intergenic
1161317153 19:3622638-3622660 CCCTCGGCCCCCAGAGGGAGTGG + Intronic
1161794824 19:6380680-6380702 CACCCGCTTCCCTGTGGGAGTGG + Exonic
1161920418 19:7261612-7261634 CACTCGAACCCGAGAGGCAGAGG - Intronic
1162631080 19:11927268-11927290 CACTTGAACCCCAGAGGCAGAGG + Intronic
1163630247 19:18414778-18414800 CCCTCGCAGCCCTGTGGGATTGG + Intergenic
1164074721 19:21803669-21803691 CACTTGAACCCCAGAGGGAGAGG - Intergenic
1164881961 19:31740381-31740403 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1165159939 19:33810131-33810153 CACACCCACCCCACTGGGAATGG - Intronic
1165943867 19:39429701-39429723 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1166180956 19:41108388-41108410 CACTAGAACCCAAGAGGGAGAGG + Intergenic
1166568359 19:43778809-43778831 CACCTGCTCCCCAGGGGGAGGGG - Intronic
925412519 2:3648103-3648125 CACTAGCACAGGAGTGGGAGAGG - Intergenic
925463968 2:4089630-4089652 CACTAGCACCCTAGAGGGTGAGG - Intergenic
926862952 2:17328018-17328040 CACTTGCACCCCAGAGGCAGAGG + Intergenic
927576372 2:24205061-24205083 CACTTGTACCCCAGAGGCAGAGG + Intronic
927708548 2:25311549-25311571 CACTCACACCCCAGCAGGAGGGG - Intronic
928665470 2:33546963-33546985 CACTTGAACCCAAGAGGGAGAGG + Intronic
929692455 2:44086194-44086216 CACTTGAACCCCAGTGGCAGAGG + Intergenic
930069942 2:47358213-47358235 CACTTGAACCCCAGAGGCAGAGG - Intronic
930564206 2:52999217-52999239 CACTCGAACCCCAGAGGCAGAGG - Intergenic
931054415 2:58452948-58452970 GACTTGTACCCCAGTGGGAGAGG - Intergenic
931072573 2:58669719-58669741 CACTTGAACCCCAGAGGCAGAGG - Intergenic
931393943 2:61869250-61869272 CACTTGAACCCCAGAGGCAGAGG + Intronic
932140112 2:69268639-69268661 CACTTGAACCCCAGAGGCAGAGG + Intergenic
933991082 2:87634415-87634437 CACTCACACCCCCGTGGGCTTGG + Intergenic
937653450 2:124347002-124347024 CCCTTGAACCCCAGAGGGAGAGG + Intronic
937964302 2:127490004-127490026 TAATTGCACCCCAGTGTGAGGGG + Intronic
938589413 2:132722308-132722330 CACTGGAACCCCACTGGCAGAGG + Intronic
940867399 2:158830948-158830970 CACTTGAACCCCAGTGGTTGAGG + Intronic
942572911 2:177331421-177331443 CACTTGAACCCCAGAGGCAGAGG - Intronic
944115804 2:196184876-196184898 CACTTGAACCCCAGTGGCAGAGG + Intergenic
944636236 2:201678514-201678536 CACCAGCACCCCACTGGGCGTGG - Intronic
945935914 2:215902505-215902527 CAATCCAACCCCAGTGGAAGTGG + Intergenic
1169325048 20:4668817-4668839 CGCTTGAACCCCAGAGGGAGAGG - Intergenic
1172232187 20:33344200-33344222 CACTTGAACCCCAGAGGCAGAGG + Intergenic
1173694340 20:44995520-44995542 CACTTGAACCCCAGAGGCAGAGG + Intronic
1173907782 20:46641374-46641396 CACTCACAGCCAAGGGGGAGAGG + Intronic
1176361729 21:6002362-6002384 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1176714011 21:10334426-10334448 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1177429918 21:20978987-20979009 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1178789047 21:35681616-35681638 CCCTCGAACCCCAGAGGCAGAGG + Intronic
1179761789 21:43536188-43536210 CACTTGAACCCCAGAGGCAGAGG + Intronic
1180026340 21:45164457-45164479 GCCTCGCAGCCCACTGGGAGAGG + Intronic
1180038540 21:45263789-45263811 CACTCGCAGGCCAGCAGGAGCGG + Intergenic
1180930403 22:19586647-19586669 CACTTGAACCCCAGAGGCAGAGG + Intergenic
1182477316 22:30583212-30583234 CACACGTGCCCCAGGGGGAGAGG + Intronic
1182795281 22:32987181-32987203 CACTCCACCCCCAGTGGGGGTGG - Intronic
1183223523 22:36532967-36532989 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1183527094 22:38329659-38329681 CACTTGAACCCCAGAGGCAGAGG + Intronic
1184022535 22:41830471-41830493 CAGTCACACACCAGTGTGAGGGG + Intergenic
1184698437 22:46152220-46152242 CGCTTGAACCCCAGTGGCAGAGG - Intronic
1185197698 22:49482742-49482764 CACAGTCACCCCAGTGTGAGAGG + Intronic
950848910 3:16043611-16043633 CACGTGCACACCAGTGGCAGCGG + Intergenic
953742700 3:45551295-45551317 CACTTGAACCCCAGAGGCAGAGG - Intergenic
955557115 3:60150077-60150099 CACTTGAACCCCAGAGGCAGAGG - Intronic
956487598 3:69739413-69739435 CACTCGCACCCGGGCGGGAGGGG - Exonic
956716146 3:72081647-72081669 CACTTGAACCCCAGAGGCAGGGG + Intergenic
960395990 3:117138202-117138224 CACTTGAACCCCAGAGGTAGAGG - Intronic
960592563 3:119379903-119379925 CACTCACACTGCAGTGGGAGGGG + Intronic
960816600 3:121679802-121679824 CACTGATACCACAGTGGGAGTGG - Intronic
961306254 3:125960335-125960357 CACTGTGACACCAGTGGGAGAGG - Intergenic
961607985 3:128111617-128111639 CACTCCCAACCCAGCCGGAGGGG + Intronic
961621753 3:128229846-128229868 CTCCCGCACCCCATTTGGAGGGG - Intronic
962404712 3:135091139-135091161 CCCTTGCATCCCAGTTGGAGAGG + Intronic
963199034 3:142568471-142568493 CAGTGGCAGCCCAGTTGGAGCGG + Intronic
964121263 3:153185999-153186021 AACTCGAACCCCAGAGGCAGAGG - Intergenic
964227934 3:154428872-154428894 CACTCTCCCCGCAGTAGGAGGGG + Exonic
965881879 3:173396845-173396867 CACCCCCACCCCAATGGGATTGG - Intronic
967931502 3:194693704-194693726 CACTTGAACCCCAGAGGCAGAGG - Intergenic
968222695 3:196950067-196950089 CACTTGAACCCCAGAGGCAGAGG - Intronic
968561580 4:1285986-1286008 CACTCAGCCCCCAGTGGGAGGGG + Intergenic
968680290 4:1914104-1914126 CACTTGAACCCAAGTGGCAGAGG - Intronic
969249930 4:5960594-5960616 CACTTCCAATCCAGTGGGAGAGG + Intronic
969939641 4:10717620-10717642 CACTCCCACCCCACTGGTAAAGG + Intergenic
970776562 4:19681360-19681382 AACTCACAACTCAGTGGGAGAGG + Intergenic
970780125 4:19727471-19727493 CACTTGAACCCGAGTGGCAGAGG + Intergenic
971370148 4:26012596-26012618 CACACACACCCCAGAGGGGGAGG - Intergenic
971928159 4:33041570-33041592 CACTCGAACCCCAGAGGAAGAGG + Intergenic
974948729 4:68561571-68561593 CACTTGAACCACAGTGGGAGAGG + Intronic
974957759 4:68664051-68664073 CACTTGAACCACAGTGGGAGAGG + Intronic
974986466 4:69033453-69033475 CACTTGCACCATAATGGGAGAGG - Intronic
978030576 4:103936853-103936875 CACAGGCCCCCCACTGGGAGCGG + Intergenic
979025838 4:115573840-115573862 CACTTGAACCCCAGAGGCAGAGG - Intergenic
980850792 4:138379101-138379123 CACTTGGACCCCAGAGGCAGAGG - Intergenic
981032405 4:140138655-140138677 CACACTCTCCCCAGTGAGAGAGG + Intronic
982038625 4:151372685-151372707 CACTTGAACCCAAGTGGCAGAGG - Intergenic
983384768 4:167046537-167046559 CACTTGAACCCCGGTGGCAGAGG - Intronic
983881705 4:172940444-172940466 CACTTGAACCCCAGAGGCAGAGG - Intronic
984793027 4:183631427-183631449 CACTTGAACCCCAGAGGCAGAGG + Intergenic
984950646 4:185005132-185005154 CACTCACACGCCAGTGGAGGGGG + Intergenic
985940781 5:3134020-3134042 CACCCCCACCCCAGGGGAAGGGG - Intergenic
987193289 5:15500507-15500529 TCCCCGCACTCCAGTGGGAGGGG - Exonic
989172335 5:38484827-38484849 CATTCTCATCCCAGTGGCAGTGG - Exonic
989815330 5:45729648-45729670 CCCTCCCACCCCACTGGGAGAGG - Intergenic
991914976 5:71596854-71596876 CGCTCGAACCCCAGAGGCAGAGG + Intronic
994191973 5:96878842-96878864 CACTTGAACCCCAGAGGCAGAGG + Intronic
995245709 5:109932906-109932928 CACCCGCACCTCAGGGGAAGAGG - Intergenic
996017976 5:118562107-118562129 CACACCCACCCGATTGGGAGGGG - Intergenic
996458054 5:123707865-123707887 CACTTGAACCCCAGAGGCAGAGG - Intergenic
996556658 5:124785636-124785658 CACTTGAACCCCAGAGGCAGAGG - Intergenic
997490320 5:134270325-134270347 CACTTGAACCCCAGAGGCAGAGG - Intergenic
997588960 5:135061403-135061425 CACTTGAACCCCAGAGGCAGTGG - Intronic
999276141 5:150331321-150331343 CACTTGCAGCCCTGTGGGACAGG + Intronic
999705795 5:154271380-154271402 CGCTTGAACCCCAGAGGGAGAGG + Intronic
1000081197 5:157848743-157848765 CACTTGAACCCCAGAGGCAGAGG - Intronic
1002458202 5:179358040-179358062 CACGCCCAGCCCAGTGGGAGTGG + Intergenic
1002480038 5:179494517-179494539 CACTTGAACCCCAGAGGCAGAGG + Intergenic
1003285647 6:4731713-4731735 CACTTGAACCCCAGAGGCAGAGG + Intronic
1003389532 6:5701332-5701354 CAGTGGCAGCCCAGAGGGAGAGG - Intronic
1004930571 6:20459186-20459208 CACTTGAACCCCAGAGGCAGAGG + Intronic
1005759613 6:28955913-28955935 CACTTGAACCCCAGAGGCAGAGG + Intergenic
1006017489 6:31093950-31093972 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1007857937 6:44877383-44877405 CACTTGAACCCCAGAGGCAGAGG + Intronic
1007934852 6:45723702-45723724 CACTTGAACCCAAGTGGCAGAGG + Intergenic
1011899643 6:92276203-92276225 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1012420311 6:99057473-99057495 CACTTGAACCCCAGAGGCAGAGG + Intergenic
1014657918 6:124131226-124131248 CACTTGAACCCCAGAGGCAGAGG - Intronic
1014770365 6:125452915-125452937 CACTCCCTCCCAAGTTGGAGTGG + Intergenic
1014801755 6:125786658-125786680 CACTTGAACCCGAGAGGGAGAGG - Intronic
1015406645 6:132845165-132845187 GACTGCCACCCCAGTGTGAGTGG + Intergenic
1015542587 6:134330596-134330618 CACTTGAACCCCAGAGGCAGAGG + Intergenic
1017184460 6:151587163-151587185 CACTGATAACCCAGTGGGAGAGG + Intronic
1017788265 6:157774122-157774144 CAGACGCAGCCCAGAGGGAGAGG + Intronic
1018746175 6:166764140-166764162 CACGCCCTCCCCAGTGGGAGTGG - Intronic
1019354575 7:571931-571953 GGCTCGCTCCCCAGTGAGAGTGG - Intronic
1019706376 7:2499025-2499047 CACCCCCACCCCAGTGTGGGAGG - Intergenic
1023609565 7:41959133-41959155 AGCTCCCAGCCCAGTGGGAGAGG - Intergenic
1023819790 7:43974263-43974285 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1027002741 7:74665333-74665355 CACTCGAACCCGAGAGGCAGGGG - Intronic
1029099520 7:98117112-98117134 CACTCGTACACCATGGGGAGGGG - Intronic
1029727026 7:102413225-102413247 CAGATGCACCCCAGTGGGGGAGG + Intronic
1029748062 7:102527712-102527734 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1029766010 7:102626811-102626833 CACTTGAACCCCAGAGGCAGAGG - Intronic
1030059482 7:105611453-105611475 CACTTGAACCCCAGAGGCAGAGG - Intronic
1030385540 7:108863666-108863688 CGCTCAGCCCCCAGTGGGAGTGG - Intergenic
1031665499 7:124478227-124478249 CACTTGAACCCCAGTGGCAGAGG - Intergenic
1031968206 7:128043488-128043510 CACTTGAACCCCAGAGGCAGAGG + Intronic
1031983760 7:128148792-128148814 CACCCCTACCCCAGTGGGATAGG - Intergenic
1032404486 7:131645859-131645881 CACTTGAACCCGAGTGGCAGAGG + Intergenic
1032849491 7:135782127-135782149 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1032876205 7:136041033-136041055 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1033171606 7:139089400-139089422 CCCTTGCAGCCCAGTGGAAGAGG + Intronic
1033290736 7:140080600-140080622 CACTGACAGCCCAGTGGGATGGG - Intergenic
1035081988 7:156224079-156224101 CACTAACAGCCCAGTGGGAGGGG - Intergenic
1035713796 8:1738703-1738725 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1036429589 8:8677616-8677638 CACTCGAACCCGGGAGGGAGAGG + Intergenic
1037547741 8:19940090-19940112 CCCTCGCTCCGCTGTGGGAGTGG + Intronic
1038115559 8:24551020-24551042 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1040054320 8:43044248-43044270 CACTTGAACCCAAGAGGGAGAGG + Intronic
1040107667 8:43549620-43549642 CGCTCCCACCCCAGTGTGGGTGG - Intergenic
1040834978 8:51722278-51722300 CACTCCAACCCCTATGGGAGGGG + Intronic
1041067747 8:54098595-54098617 CACTTGAACCCGAGTGGCAGAGG + Intronic
1041583041 8:59484531-59484553 CACTTGAACCCCAGAGGCAGAGG + Intergenic
1045039967 8:98214245-98214267 CACTTGAACCCAAGAGGGAGAGG - Intronic
1045095273 8:98790898-98790920 CACTTGAACCCCAGAGGCAGAGG + Intronic
1045338038 8:101226053-101226075 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1045771489 8:105745841-105745863 CACTTGAACCCCAGAGGCAGAGG - Intronic
1045842409 8:106595464-106595486 CACTCGAACCCGAGAGGCAGAGG + Intronic
1048068075 8:130992161-130992183 CACTTGAACCCCAGAGGCAGAGG - Intronic
1049423932 8:142528945-142528967 CACTCGGGCCCCAGAGGGACAGG - Intronic
1049790816 8:144472056-144472078 AGCTCACGCCCCAGTGGGAGAGG + Intronic
1050507550 9:6363484-6363506 CACTTGAACCCAAGAGGGAGAGG + Intergenic
1050600905 9:7249543-7249565 CACTTGAACCCCAGAGGGGGAGG - Intergenic
1052950049 9:34201458-34201480 CACTTGAACCCCAGAGGCAGAGG + Intronic
1056632261 9:88303659-88303681 CACTGGCACCACAGTGTGTGGGG + Intergenic
1056655879 9:88508722-88508744 AGCTGGCAGCCCAGTGGGAGAGG - Intergenic
1057527193 9:95813372-95813394 CACTCGAACCCGAGAGGCAGAGG - Intergenic
1057555424 9:96083885-96083907 CACAAACACCCCAGTGGGCGGGG + Intergenic
1057718528 9:97514609-97514631 CACTGGCAGCCCAGCAGGAGTGG - Intronic
1057797726 9:98170523-98170545 CACTTGAACCCCAGAGGCAGAGG - Intronic
1058196707 9:101985584-101985606 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1058590348 9:106558430-106558452 CACTTTTACCCCAGTGAGAGAGG - Intergenic
1061281244 9:129598588-129598610 CCCTCTCACCCCAGAGGCAGTGG - Intergenic
1061781407 9:132998391-132998413 CACTTGAACCCCAGAGGTAGAGG + Intergenic
1061798751 9:133103077-133103099 CCCTCACCCTCCAGTGGGAGGGG + Intronic
1062623170 9:137431639-137431661 CACTCGCACCCCAGTGGGAGGGG - Intronic
1062675094 9:137738108-137738130 CACTTGAACCCGAGTGGTAGAGG + Intronic
1186075191 X:5870858-5870880 CACTCGAACCCCAGAGGTGGAGG - Intronic
1187347385 X:18478792-18478814 CACTTGAACCCGAGAGGGAGAGG - Intronic
1187646624 X:21354534-21354556 CACTTGAACCCCAGAGGCAGAGG + Intergenic
1189395467 X:40618840-40618862 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1189489456 X:41458541-41458563 CACTTGAACCCGAGTGGCAGAGG - Intronic
1189531802 X:41892414-41892436 CACTTGAACCCCAGAGGCAGAGG - Intronic
1193875099 X:86852742-86852764 CACTTGAACCCCAGAGGCAGAGG + Intergenic
1194048860 X:89042169-89042191 CACTTGAACCCCAGAGGCAGAGG + Intergenic
1196437153 X:115684922-115684944 CACTCACAACCCATTTGGAGAGG - Intergenic
1198045217 X:132894618-132894640 CACTTGAACCCCAGAGGCAGAGG - Intronic
1198056542 X:133001313-133001335 CACTTGAACCCCAGAGGCAGAGG + Intergenic
1199802541 X:151265877-151265899 CACTTGAACCCCAGAGGCAGAGG - Intergenic
1200156347 X:153978125-153978147 CACTCAAACCCCGGAGGGAGAGG + Intronic
1200216969 X:154372174-154372196 CACGGGCACGCCAGTGGGCGCGG + Intronic
1200309045 X:155058136-155058158 GACTGTCACCCCAGTGGTAGGGG - Exonic