ID: 1062623170

View in Genome Browser
Species Human (GRCh38)
Location 9:137431639-137431661
Sequence CACTCGCACCCCAGTGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623170_1062623181 7 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG No data
Right 1062623181 9:137431669-137431691 GTGACCCAGCTGGGGACAGGCGG No data
1062623170_1062623188 28 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG No data
Right 1062623188 9:137431690-137431712 GGGAGGCAGGACAGCTCTGGAGG No data
1062623170_1062623187 25 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG No data
Right 1062623187 9:137431687-137431709 GGCGGGAGGCAGGACAGCTCTGG No data
1062623170_1062623180 4 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG No data
Right 1062623180 9:137431666-137431688 GGAGTGACCCAGCTGGGGACAGG No data
1062623170_1062623189 29 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG No data
Right 1062623189 9:137431691-137431713 GGAGGCAGGACAGCTCTGGAGGG No data
1062623170_1062623184 11 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG No data
Right 1062623184 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG No data
1062623170_1062623190 30 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG No data
Right 1062623190 9:137431692-137431714 GAGGCAGGACAGCTCTGGAGGGG No data
1062623170_1062623176 -3 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG No data
Right 1062623176 9:137431659-137431681 GTGACCAGGAGTGACCCAGCTGG No data
1062623170_1062623186 15 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG No data
Right 1062623186 9:137431677-137431699 GCTGGGGACAGGCGGGAGGCAGG No data
1062623170_1062623178 -1 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG No data
Right 1062623178 9:137431661-137431683 GACCAGGAGTGACCCAGCTGGGG No data
1062623170_1062623182 8 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG No data
Right 1062623182 9:137431670-137431692 TGACCCAGCTGGGGACAGGCGGG No data
1062623170_1062623177 -2 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG No data
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623170 Original CRISPR CACTCGCACCCCAGTGGGAG GGG (reversed) Intronic