ID: 1062623171

View in Genome Browser
Species Human (GRCh38)
Location 9:137431640-137431662
Sequence TCACTCGCACCCCAGTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623171_1062623178 -2 Left 1062623171 9:137431640-137431662 CCCTCCCACTGGGGTGCGAGTGA 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1062623178 9:137431661-137431683 GACCAGGAGTGACCCAGCTGGGG No data
1062623171_1062623190 29 Left 1062623171 9:137431640-137431662 CCCTCCCACTGGGGTGCGAGTGA 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1062623190 9:137431692-137431714 GAGGCAGGACAGCTCTGGAGGGG No data
1062623171_1062623181 6 Left 1062623171 9:137431640-137431662 CCCTCCCACTGGGGTGCGAGTGA 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1062623181 9:137431669-137431691 GTGACCCAGCTGGGGACAGGCGG No data
1062623171_1062623189 28 Left 1062623171 9:137431640-137431662 CCCTCCCACTGGGGTGCGAGTGA 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1062623189 9:137431691-137431713 GGAGGCAGGACAGCTCTGGAGGG No data
1062623171_1062623182 7 Left 1062623171 9:137431640-137431662 CCCTCCCACTGGGGTGCGAGTGA 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1062623182 9:137431670-137431692 TGACCCAGCTGGGGACAGGCGGG No data
1062623171_1062623177 -3 Left 1062623171 9:137431640-137431662 CCCTCCCACTGGGGTGCGAGTGA 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623171_1062623187 24 Left 1062623171 9:137431640-137431662 CCCTCCCACTGGGGTGCGAGTGA 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1062623187 9:137431687-137431709 GGCGGGAGGCAGGACAGCTCTGG No data
1062623171_1062623180 3 Left 1062623171 9:137431640-137431662 CCCTCCCACTGGGGTGCGAGTGA 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1062623180 9:137431666-137431688 GGAGTGACCCAGCTGGGGACAGG No data
1062623171_1062623188 27 Left 1062623171 9:137431640-137431662 CCCTCCCACTGGGGTGCGAGTGA 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1062623188 9:137431690-137431712 GGGAGGCAGGACAGCTCTGGAGG No data
1062623171_1062623176 -4 Left 1062623171 9:137431640-137431662 CCCTCCCACTGGGGTGCGAGTGA 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1062623176 9:137431659-137431681 GTGACCAGGAGTGACCCAGCTGG No data
1062623171_1062623184 10 Left 1062623171 9:137431640-137431662 CCCTCCCACTGGGGTGCGAGTGA 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1062623184 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG No data
1062623171_1062623186 14 Left 1062623171 9:137431640-137431662 CCCTCCCACTGGGGTGCGAGTGA 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1062623186 9:137431677-137431699 GCTGGGGACAGGCGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623171 Original CRISPR TCACTCGCACCCCAGTGGGA GGG (reversed) Intronic
902656213 1:17870113-17870135 TCACTTGCAACCCTGTGGAAAGG - Intergenic
905049215 1:35034665-35034687 TCACTTGAACCCCAGAGGCAGGG + Intergenic
907086444 1:51679637-51679659 TGATTCACACCCAAGTGGGATGG - Intronic
911062966 1:93763726-93763748 TTACTGGCACACCAGTGGGGTGG - Intronic
911924878 1:103817361-103817383 CCACCCTCACCCCAGTGGCAAGG + Intergenic
921707838 1:218344959-218344981 GCACACGCACCCCTATGGGAGGG - Intergenic
923331054 1:232925091-232925113 TCGCTGACACCCCAGTGAGATGG - Intergenic
1064653542 10:17534273-17534295 TCAGTAGCACCCCAGGGGCAGGG - Intergenic
1070549388 10:77479359-77479381 CCACTCAAACCACAGTGGGAGGG + Intronic
1072676984 10:97474461-97474483 TCACTCGAACCCCGGAGGCAGGG + Intronic
1074724591 10:116295493-116295515 TCACTTGAACCCCAGAGGCAGGG - Intergenic
1077453688 11:2665448-2665470 TCACTGGCACGACAGTGGGTGGG + Intronic
1078770864 11:14350326-14350348 TCACTCACACCCCAGTCCCAGGG - Intronic
1089217100 11:116841063-116841085 GCACTGGCACCCTAGAGGGAGGG + Intergenic
1091631707 12:2166303-2166325 TCACTCACACCCCTTTGGAAGGG + Intronic
1093218292 12:16388410-16388432 TGACTTGCAACCCAGTGGGTTGG + Intronic
1094474711 12:30832398-30832420 TCACTACCCCCCCAGTTGGAAGG + Intergenic
1102498303 12:113334490-113334512 TAACTCGGACTCCAGTTGGAGGG - Exonic
1105535163 13:21259291-21259313 TCACTCCCTGCCCAGTGAGAAGG + Intergenic
1105591892 13:21800008-21800030 TTACTAGGACCCCAGTAGGAGGG - Intergenic
1112786076 13:102953140-102953162 GCACTCACACCCAAGAGGGATGG + Intergenic
1119410408 14:74426463-74426485 TCCCGCGCACCCCAGAGCGATGG + Intergenic
1122836428 14:104433069-104433091 TCCCTGCCACCCCCGTGGGAAGG - Intergenic
1124240179 15:28021819-28021841 TAGCTCTTACCCCAGTGGGAGGG + Intronic
1129456239 15:75677413-75677435 TCACTCTCCCCTCAGTGGGCTGG - Intronic
1133610849 16:7432033-7432055 TTACACCCAGCCCAGTGGGAAGG + Intronic
1136995637 16:35186692-35186714 ACAGTCACAGCCCAGTGGGAGGG + Intergenic
1141878972 16:86845554-86845576 TCACACTCACCCCTGTGGTAAGG + Intergenic
1149238993 17:54626381-54626403 TCACCACCACCCCAGTGGGTGGG - Intergenic
1154354860 18:13616899-13616921 TCACGGGCACCCTAGTGGCATGG - Intronic
1155835544 18:30578999-30579021 ACACACTCACCCCAGTGGGAGGG + Intergenic
1158463732 18:57670789-57670811 TCGCTTGAACCCCAGAGGGAGGG - Intronic
1163675128 19:18651919-18651941 GCAGTCTCACCTCAGTGGGAGGG + Intronic
1164052415 19:21594621-21594643 TCACAATCACCCCAGTGGGCAGG - Intergenic
1164127777 19:22334180-22334202 TCACAATCACCCCAGTGGGCAGG + Intergenic
1165489093 19:36113094-36113116 TCTCTCGGACCCCAGTGGGTGGG + Intronic
1168008334 19:53509169-53509191 TCACTAGAATCCCAGAGGGAGGG - Intergenic
1168355591 19:55697889-55697911 TCTCTCTCCCCACAGTGGGATGG + Intronic
925074844 2:1007217-1007239 TCACACACACCCTAGTGAGAAGG + Intronic
925181356 2:1819022-1819044 GGACATGCACCCCAGTGGGAGGG - Intronic
926410967 2:12602262-12602284 TCACTTGCTCCCCAGTGTTATGG - Intergenic
927708549 2:25311550-25311572 ACACTCACACCCCAGCAGGAGGG - Intronic
929856260 2:45640780-45640802 TCACTCGCATCCCATTGGCTAGG - Intergenic
930057532 2:47263542-47263564 ACACTGGCACCCTAGAGGGAGGG + Intergenic
932773822 2:74515461-74515483 TCCCTCGCATCCCAGGGGAAGGG + Intronic
937304511 2:120862917-120862939 TCCCTGGCTCCCCAGTCGGAGGG + Intronic
945508882 2:210675774-210675796 TCCCTGCCACCCCAGTGGCATGG + Exonic
947392095 2:229650280-229650302 TTACTCACACCACAGTGTGAAGG + Intronic
947508820 2:230732113-230732135 TCACTCTCACCCAAGCTGGAGGG + Intronic
948243001 2:236454083-236454105 TCACTTGCATTCCAGTGGGATGG + Intronic
1172176640 20:32976457-32976479 TCACTCACCCCTCAGTGGGGAGG - Intergenic
1175180810 20:57145785-57145807 TCACTCCTACCCCAGTGTTAAGG + Intergenic
1180590533 22:16933504-16933526 TCACTTGCAACACAGTAGGAGGG + Intergenic
1181589733 22:23876728-23876750 TCACTGGGACCCGAGTGTGAAGG - Intronic
1183496989 22:38152141-38152163 TCACCCCCACCCCACAGGGAGGG - Intronic
1185215968 22:49600151-49600173 TCCCTTGCACCCCATGGGGAAGG - Intronic
951968935 3:28421276-28421298 TCACTGACACCATAGTGGGAGGG + Intronic
954304317 3:49717468-49717490 TCCCTCCCACCCCCTTGGGAAGG + Exonic
956487599 3:69739414-69739436 ACACTCGCACCCGGGCGGGAGGG - Exonic
956716145 3:72081646-72081668 TCACTTGAACCCCAGAGGCAGGG + Intergenic
960592562 3:119379902-119379924 GCACTCACACTGCAGTGGGAGGG + Intronic
961903006 3:130232776-130232798 ACACTCACATCCCAGCGGGAAGG - Intergenic
962471888 3:135716366-135716388 TCACTCACACAACAGTGGGCTGG - Intergenic
964291733 3:155188611-155188633 TCACTTGCACCTCTCTGGGAAGG + Intergenic
967154095 3:186677089-186677111 TCATGCCCACCCCAGTGGAAGGG - Exonic
968503969 4:963551-963573 TCACACGCAGCTCAGTGGGCAGG - Intronic
968561579 4:1285985-1286007 GCACTCAGCCCCCAGTGGGAGGG + Intergenic
968817246 4:2828446-2828468 GCACTGGGACCCCAGAGGGAAGG - Intronic
971422078 4:26482459-26482481 TCATTAGCTCCCCAGAGGGAAGG + Intronic
982721856 4:158868138-158868160 TGACTCGCACCGTAGTGGTAGGG + Exonic
983984019 4:174036313-174036335 TCACTAACAGCTCAGTGGGAGGG + Intergenic
985472587 5:54720-54742 CCACTCCCACCCCAGTTGCAAGG - Intergenic
996093599 5:119375186-119375208 TCACTTGCTCCCCTGTGGAAAGG - Intronic
998229303 5:140349549-140349571 GCACTTGCTCCCCAGTGGGGAGG + Intergenic
999586907 5:153099518-153099540 ACACACGCACCTCAGTGGGAGGG - Intergenic
999722363 5:154408267-154408289 TCATTTGCACCTCAGTGTGAAGG - Intronic
1002544424 5:179929801-179929823 TCGGTCACACCCCAGTGGGTGGG - Intronic
1003420908 6:5957840-5957862 TCACTCGCTCTCCACAGGGATGG + Intergenic
1004284770 6:14311125-14311147 TCACTCTCACGCTAGTGGGCTGG + Intergenic
1019573649 7:1725565-1725587 GCACTCACACCCCAGTTGGGTGG + Intronic
1023869322 7:44254405-44254427 TCACCCACACCCCAGAGCGATGG - Intronic
1027002742 7:74665334-74665356 TCACTCGAACCCGAGAGGCAGGG - Intronic
1028599795 7:92589824-92589846 TCCTGCGCACCCAAGTGGGAGGG - Intronic
1033290737 7:140080601-140080623 GCACTGACAGCCCAGTGGGATGG - Intergenic
1033763562 7:144463203-144463225 TAATTCTCACCCCTGTGGGATGG - Intronic
1035081989 7:156224080-156224102 CCACTAACAGCCCAGTGGGAGGG - Intergenic
1035171701 7:157020978-157021000 TCGCTCGCACCGCAGAGGGATGG + Intergenic
1037458982 8:19090181-19090203 TCACTCTCACCCAGGTTGGAGGG - Intergenic
1037471411 8:19215149-19215171 TCACCCCCACCACCGTGGGAAGG + Intergenic
1039579210 8:38650520-38650542 CCACGGGCACCCCAGAGGGACGG + Intergenic
1047879761 8:129180277-129180299 TAACTGGCAGCCCAGTGGCAAGG - Intergenic
1049332134 8:142060180-142060202 TGAGTCGCAAACCAGTGGGAGGG - Intergenic
1051017233 9:12493510-12493532 TTACTCTCACCCTAGTGGTAGGG + Intergenic
1052533304 9:29716376-29716398 TCTCTTGAACCCCAGTGGGGTGG - Intergenic
1062623171 9:137431640-137431662 TCACTCGCACCCCAGTGGGAGGG - Intronic
1189164228 X:38844131-38844153 TCACTAAAACCCCATTGGGAAGG - Intergenic
1189259971 X:39671387-39671409 TCACTCTGATCACAGTGGGAGGG - Intergenic
1195571724 X:106404319-106404341 TCTCTCGCACCCATTTGGGAGGG - Intergenic
1199903458 X:152200577-152200599 TCACTCTCTCCCCACTGAGAAGG + Intronic
1201756604 Y:17493641-17493663 TCACTCGCAGCCAAGTGAGGCGG + Intergenic
1201844949 Y:18412343-18412365 TCACTCGCAGCCAAGTGAGGCGG - Intergenic