ID: 1062623172

View in Genome Browser
Species Human (GRCh38)
Location 9:137431641-137431663
Sequence GTCACTCGCACCCCAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 87}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623172_1062623186 13 Left 1062623172 9:137431641-137431663 CCTCCCACTGGGGTGCGAGTGAC 0: 1
1: 0
2: 1
3: 5
4: 87
Right 1062623186 9:137431677-137431699 GCTGGGGACAGGCGGGAGGCAGG No data
1062623172_1062623178 -3 Left 1062623172 9:137431641-137431663 CCTCCCACTGGGGTGCGAGTGAC 0: 1
1: 0
2: 1
3: 5
4: 87
Right 1062623178 9:137431661-137431683 GACCAGGAGTGACCCAGCTGGGG No data
1062623172_1062623188 26 Left 1062623172 9:137431641-137431663 CCTCCCACTGGGGTGCGAGTGAC 0: 1
1: 0
2: 1
3: 5
4: 87
Right 1062623188 9:137431690-137431712 GGGAGGCAGGACAGCTCTGGAGG No data
1062623172_1062623176 -5 Left 1062623172 9:137431641-137431663 CCTCCCACTGGGGTGCGAGTGAC 0: 1
1: 0
2: 1
3: 5
4: 87
Right 1062623176 9:137431659-137431681 GTGACCAGGAGTGACCCAGCTGG No data
1062623172_1062623184 9 Left 1062623172 9:137431641-137431663 CCTCCCACTGGGGTGCGAGTGAC 0: 1
1: 0
2: 1
3: 5
4: 87
Right 1062623184 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG No data
1062623172_1062623177 -4 Left 1062623172 9:137431641-137431663 CCTCCCACTGGGGTGCGAGTGAC 0: 1
1: 0
2: 1
3: 5
4: 87
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623172_1062623180 2 Left 1062623172 9:137431641-137431663 CCTCCCACTGGGGTGCGAGTGAC 0: 1
1: 0
2: 1
3: 5
4: 87
Right 1062623180 9:137431666-137431688 GGAGTGACCCAGCTGGGGACAGG No data
1062623172_1062623181 5 Left 1062623172 9:137431641-137431663 CCTCCCACTGGGGTGCGAGTGAC 0: 1
1: 0
2: 1
3: 5
4: 87
Right 1062623181 9:137431669-137431691 GTGACCCAGCTGGGGACAGGCGG No data
1062623172_1062623189 27 Left 1062623172 9:137431641-137431663 CCTCCCACTGGGGTGCGAGTGAC 0: 1
1: 0
2: 1
3: 5
4: 87
Right 1062623189 9:137431691-137431713 GGAGGCAGGACAGCTCTGGAGGG No data
1062623172_1062623190 28 Left 1062623172 9:137431641-137431663 CCTCCCACTGGGGTGCGAGTGAC 0: 1
1: 0
2: 1
3: 5
4: 87
Right 1062623190 9:137431692-137431714 GAGGCAGGACAGCTCTGGAGGGG No data
1062623172_1062623187 23 Left 1062623172 9:137431641-137431663 CCTCCCACTGGGGTGCGAGTGAC 0: 1
1: 0
2: 1
3: 5
4: 87
Right 1062623187 9:137431687-137431709 GGCGGGAGGCAGGACAGCTCTGG No data
1062623172_1062623182 6 Left 1062623172 9:137431641-137431663 CCTCCCACTGGGGTGCGAGTGAC 0: 1
1: 0
2: 1
3: 5
4: 87
Right 1062623182 9:137431670-137431692 TGACCCAGCTGGGGACAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623172 Original CRISPR GTCACTCGCACCCCAGTGGG AGG (reversed) Intronic
904682902 1:32241233-32241255 GTCACTCGCAACCCTGGGGAGGG + Intergenic
912320139 1:108705402-108705424 CTCAGTGGCACCCCAGTGGGTGG + Intergenic
917410534 1:174756233-174756255 ATCACTTGCACCCCAGGAGGCGG - Intronic
921004177 1:211076322-211076344 GTCAGTCGGACCCTACTGGGAGG - Intronic
921364118 1:214357822-214357844 GCCACCTGCACCCCTGTGGGGGG + Exonic
1073021738 10:100450708-100450730 ATCACTTGAACCCCAGAGGGTGG - Intergenic
1074912176 10:117921440-117921462 GGCACTCGCATTCTAGTGGGAGG - Intergenic
1075212359 10:120502066-120502088 GTGACTTGCACCCCAGTGAGGGG + Intronic
1077453687 11:2665447-2665469 GTCACTGGCACGACAGTGGGTGG + Intronic
1089217099 11:116841062-116841084 GGCACTGGCACCCTAGAGGGAGG + Intergenic
1090201656 11:124861957-124861979 CACACTCACACACCAGTGGGGGG + Intergenic
1090361978 11:126179377-126179399 GTCATTCTCACCACACTGGGTGG - Intergenic
1090524005 11:127509775-127509797 GCCCCTCTCACCCCAGTCGGAGG + Intergenic
1091546614 12:1505237-1505259 GCCACTCGCACCCGTGTGGACGG + Intergenic
1102498304 12:113334491-113334513 GTAACTCGGACTCCAGTTGGAGG - Exonic
1112019388 13:95358555-95358577 CTCACTCCCACCCCACTGGTGGG - Intergenic
1113773871 13:112931122-112931144 GCCACTCCCTCCCCACTGGGAGG - Intronic
1121132892 14:91464830-91464852 CCCACTCCCACCCCAGTTGGTGG - Intronic
1121304054 14:92894417-92894439 GTCTCTCCCACCCCTGTGAGTGG - Intergenic
1124240178 15:28021818-28021840 GTAGCTCTTACCCCAGTGGGAGG + Intronic
1124719269 15:32097807-32097829 GTCACTCCCTCCCAAGTTGGAGG - Intronic
1126657400 15:50993905-50993927 GCCACTCTCACCCCTGTGGGTGG + Intronic
1127167501 15:56261967-56261989 TTCACTGGCACCCCAGAAGGTGG - Intronic
1127449744 15:59105088-59105110 GTCGCTTGCGCCCCATTGGGCGG - Exonic
1127609887 15:60626666-60626688 GTCACTGTCACCAGAGTGGGTGG + Intronic
1136995636 16:35186691-35186713 GACAGTCACAGCCCAGTGGGAGG + Intergenic
1138436509 16:57003598-57003620 GTCACTGCACCCCCAGTGGGCGG - Intronic
1143697347 17:8630415-8630437 GGCACTGGGACCTCAGTGGGTGG - Intronic
1148018721 17:44539887-44539909 GTCCCTCTCAGCCCCGTGGGGGG + Intergenic
1148129497 17:45254535-45254557 GTCACTTGGGCCCCAGAGGGTGG + Intronic
1149238994 17:54626382-54626404 CTCACCACCACCCCAGTGGGTGG - Intergenic
1151928992 17:77219055-77219077 GCCCCACGAACCCCAGTGGGAGG + Intergenic
1155835543 18:30578998-30579020 AACACACTCACCCCAGTGGGAGG + Intergenic
1163636456 19:18439079-18439101 GACACCCCCGCCCCAGTGGGTGG + Intergenic
1164204710 19:23048507-23048529 GTCACAATCACCCCAGTGGGGGG + Intergenic
1165489092 19:36113093-36113115 GTCTCTCGGACCCCAGTGGGTGG + Intronic
1166714225 19:44956194-44956216 GTCAGTGACATCCCAGTGGGTGG - Intronic
1168035885 19:53718922-53718944 ATCACTTGAACCCCAGGGGGCGG + Intergenic
926707390 2:15846356-15846378 GACACTCGCAGTCCAGTCGGAGG + Intergenic
930057531 2:47263541-47263563 GACACTGGCACCCTAGAGGGAGG + Intergenic
940491531 2:154368364-154368386 GTCAGTCACACCCCAGAGAGGGG - Intronic
943299953 2:186186276-186186298 GTCAGTCGGCCCCCACTGGGAGG + Intergenic
946000037 2:216474667-216474689 ATCACTTGAACCCCAGGGGGCGG + Intronic
948281334 2:236749980-236750002 GTCTCTCTCTGCCCAGTGGGGGG - Intergenic
948703899 2:239777707-239777729 GTCTGTGCCACCCCAGTGGGTGG + Intronic
1171816118 20:29787492-29787514 CTCACCTGCACTCCAGTGGGTGG - Intergenic
1172009479 20:31838026-31838048 GCCTCTGGAACCCCAGTGGGAGG + Intergenic
1172083302 20:32358894-32358916 GCCCCTCCCCCCCCAGTGGGGGG - Intronic
1180319575 22:11308056-11308078 CTCACCTGCACTCCAGTGGGTGG - Intergenic
1180939149 22:19645475-19645497 TTTACTCCCACCCCAGTGAGCGG + Intergenic
1180994615 22:19959446-19959468 GTCCCTCCCGGCCCAGTGGGCGG + Intronic
1181947115 22:26526990-26527012 GTCACTTGAACCCCAGAAGGTGG + Intronic
954537099 3:51368799-51368821 GTCAGTCGCCCCCTACTGGGAGG - Intronic
956716144 3:72081645-72081667 GTCACTTGAACCCCAGAGGCAGG + Intergenic
956993349 3:74794808-74794830 GTCACTCGGCCCCTACTGGGAGG - Intergenic
963581297 3:147129567-147129589 GTCAGTCGCCCCCTACTGGGAGG + Intergenic
969331385 4:6475093-6475115 GTCCATCTCACCCCACTGGGAGG - Intronic
985624840 5:979955-979977 CTCACTCCCACCCCAGTGCCTGG + Intronic
990554479 5:56917565-56917587 GTCAATCTCCCTCCAGTGGGTGG - Intergenic
991247208 5:64520843-64520865 GTCCCTGTCACCCCAGGGGGAGG - Intronic
997123896 5:131206064-131206086 GTCACTCTCACCAATGTGGGTGG + Intergenic
997513276 5:134467147-134467169 GACACTGGCACCCCAGCAGGTGG + Intergenic
997581714 5:135021519-135021541 ATGACTGGCACCTCAGTGGGAGG + Intergenic
998700340 5:144691553-144691575 ATCACTTGAACCCCAGTAGGCGG - Intergenic
999586908 5:153099519-153099541 AACACACGCACCTCAGTGGGAGG - Intergenic
1002544425 5:179929802-179929824 TTCGGTCACACCCCAGTGGGTGG - Intronic
1002586672 5:180253027-180253049 GTCACTCTCACTCCTGTGGCGGG - Intronic
1004101162 6:12613241-12613263 GTCACCAACAGCCCAGTGGGAGG - Intergenic
1007697788 6:43744631-43744653 CTCCCTCACACCCCAGCGGGAGG - Intergenic
1013902186 6:115170538-115170560 GTCTCTCACAGACCAGTGGGTGG + Intergenic
1019354023 7:569711-569733 GGCACTCGCAGCCCAGGGGAGGG + Intronic
1026207196 7:68268228-68268250 GTCACTCGCAATGCAGTGGTTGG - Intergenic
1028251932 7:88547232-88547254 GTTGCTGGCACCCCATTGGGTGG + Intergenic
1028960160 7:96739789-96739811 TTCACTTGCACCCCACTGTGTGG + Intergenic
1032001916 7:128271254-128271276 GTGGCTGGCATCCCAGTGGGGGG - Intergenic
1036571534 8:9983892-9983914 GTGACTTCCACCCCAGTGAGAGG - Intergenic
1037458983 8:19090182-19090204 GTCACTCTCACCCAGGTTGGAGG - Intergenic
1039440404 8:37591326-37591348 GTGACTCCTACCCCACTGGGGGG - Intergenic
1039855254 8:41406602-41406624 GACACTCCCACAGCAGTGGGTGG + Intergenic
1046524879 8:115371079-115371101 GTCAGTCGCCCCCTACTGGGAGG - Intergenic
1049332135 8:142060181-142060203 GTGAGTCGCAAACCAGTGGGAGG - Intergenic
1056235281 9:84588102-84588124 GTCACAAGCTCCTCAGTGGGAGG - Intergenic
1060722800 9:125989758-125989780 GTCACTTCCAACTCAGTGGGTGG - Intergenic
1061549560 9:131325502-131325524 GTCACACAGACGCCAGTGGGAGG - Intergenic
1062397686 9:136359012-136359034 GTGACCCTCACCCAAGTGGGGGG + Exonic
1062623172 9:137431641-137431663 GTCACTCGCACCCCAGTGGGAGG - Intronic
1203367806 Un_KI270442v1:273806-273828 CTCACCTGCACTCCAGTGGGTGG - Intergenic
1185872498 X:3675586-3675608 TTTACATGCACCCCAGTGGGAGG - Intronic
1187234913 X:17458312-17458334 ATCACTTGAACCCCAGGGGGCGG - Intronic
1193990271 X:88298738-88298760 GTCACTTGCATTCCAGAGGGTGG - Intergenic
1194071344 X:89329373-89329395 GTCACTCTCAGCCCAGAAGGGGG + Intergenic
1200725576 Y:6665104-6665126 GTCACTCTCAGCCCAGAAGGGGG + Intergenic
1201070890 Y:10146469-10146491 CTCACCTGCACTCCAGTGGGTGG + Intergenic
1201367755 Y:13227387-13227409 GTCACACACACCCCTTTGGGAGG + Intergenic