ID: 1062623173

View in Genome Browser
Species Human (GRCh38)
Location 9:137431644-137431666
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623173_1062623178 -6 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG No data
Right 1062623178 9:137431661-137431683 GACCAGGAGTGACCCAGCTGGGG No data
1062623173_1062623189 24 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG No data
Right 1062623189 9:137431691-137431713 GGAGGCAGGACAGCTCTGGAGGG No data
1062623173_1062623187 20 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG No data
Right 1062623187 9:137431687-137431709 GGCGGGAGGCAGGACAGCTCTGG No data
1062623173_1062623176 -8 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG No data
Right 1062623176 9:137431659-137431681 GTGACCAGGAGTGACCCAGCTGG No data
1062623173_1062623181 2 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG No data
Right 1062623181 9:137431669-137431691 GTGACCCAGCTGGGGACAGGCGG No data
1062623173_1062623182 3 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG No data
Right 1062623182 9:137431670-137431692 TGACCCAGCTGGGGACAGGCGGG No data
1062623173_1062623188 23 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG No data
Right 1062623188 9:137431690-137431712 GGGAGGCAGGACAGCTCTGGAGG No data
1062623173_1062623190 25 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG No data
Right 1062623190 9:137431692-137431714 GAGGCAGGACAGCTCTGGAGGGG No data
1062623173_1062623184 6 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG No data
Right 1062623184 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG No data
1062623173_1062623180 -1 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG No data
Right 1062623180 9:137431666-137431688 GGAGTGACCCAGCTGGGGACAGG No data
1062623173_1062623177 -7 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG No data
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623173_1062623186 10 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG No data
Right 1062623186 9:137431677-137431699 GCTGGGGACAGGCGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623173 Original CRISPR CTGGTCACTCGCACCCCAGT GGG (reversed) Intronic