ID: 1062623173

View in Genome Browser
Species Human (GRCh38)
Location 9:137431644-137431666
Sequence CTGGTCACTCGCACCCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 63}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623173_1062623184 6 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1062623184 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG No data
1062623173_1062623189 24 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1062623189 9:137431691-137431713 GGAGGCAGGACAGCTCTGGAGGG No data
1062623173_1062623178 -6 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1062623178 9:137431661-137431683 GACCAGGAGTGACCCAGCTGGGG No data
1062623173_1062623190 25 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1062623190 9:137431692-137431714 GAGGCAGGACAGCTCTGGAGGGG No data
1062623173_1062623186 10 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1062623186 9:137431677-137431699 GCTGGGGACAGGCGGGAGGCAGG No data
1062623173_1062623187 20 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1062623187 9:137431687-137431709 GGCGGGAGGCAGGACAGCTCTGG No data
1062623173_1062623177 -7 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623173_1062623180 -1 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1062623180 9:137431666-137431688 GGAGTGACCCAGCTGGGGACAGG No data
1062623173_1062623176 -8 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1062623176 9:137431659-137431681 GTGACCAGGAGTGACCCAGCTGG No data
1062623173_1062623181 2 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1062623181 9:137431669-137431691 GTGACCCAGCTGGGGACAGGCGG No data
1062623173_1062623188 23 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1062623188 9:137431690-137431712 GGGAGGCAGGACAGCTCTGGAGG No data
1062623173_1062623182 3 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1062623182 9:137431670-137431692 TGACCCAGCTGGGGACAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623173 Original CRISPR CTGGTCACTCGCACCCCAGT GGG (reversed) Intronic
908326560 1:63029110-63029132 CTGCTCACCTGCACCCCAGCTGG - Intergenic
912383941 1:109262045-109262067 CTGGGCATTCCCACCCCACTGGG + Intronic
916785982 1:168087437-168087459 CTGGTTACTCCCAGCCCTGTTGG - Intronic
921724579 1:218509230-218509252 CTGGTGACTGGCACCAGAGTGGG + Intergenic
1067749348 10:48959888-48959910 CTGGTCACTGGCCCTCCACTTGG - Intronic
1069686591 10:70322895-70322917 ATGGGCACTCGCACCACAGGAGG + Intronic
1072122611 10:92417648-92417670 CCCGTCACTGGCACCTCAGTGGG - Intergenic
1076712588 10:132346801-132346823 CTAGTCACTTGTACCCCAGGGGG + Intronic
1077108726 11:852951-852973 CTGGTCACTGGCTGCCCACTGGG - Intronic
1077497304 11:2892455-2892477 GGTGTCACTCGCACCTCAGTGGG + Intronic
1078656744 11:13247572-13247594 CTGATCACTCGCCACCAAGTAGG + Intergenic
1080337974 11:31221478-31221500 AAGGTCACTACCACCCCAGTGGG - Intronic
1088326799 11:108609129-108609151 CTCTTCACACCCACCCCAGTGGG + Intergenic
1091126503 11:133104075-133104097 CTGCTCAGTCACAGCCCAGTGGG + Intronic
1092745873 12:11672078-11672100 CTTGTCACCTGCACTCCAGTGGG + Intronic
1096000135 12:48122508-48122530 CTGATCCCTCCCACCCCAATTGG - Intronic
1096537179 12:52282598-52282620 ATGGTCACTCTCACTCCAGGTGG - Intronic
1104646099 12:130498504-130498526 CTGGTCACTTGCACATCACTGGG - Intronic
1105441218 13:20416491-20416513 GTGGCCCCTCGCACCCCCGTGGG + Intronic
1106112782 13:26791751-26791773 CTGGTCCCTCCCACAACAGTTGG - Intergenic
1109228114 13:59721832-59721854 CTGGACACAAGCAACCCAGTGGG - Intronic
1119621320 14:76134123-76134145 CTGGGCAGGGGCACCCCAGTGGG - Intergenic
1132724349 16:1332431-1332453 CTGGACACTCGCAGCCCTTTGGG - Intergenic
1133206146 16:4234994-4235016 CTGGTGACTCGCAGCACAGATGG - Intronic
1133312984 16:4862931-4862953 CTGGTCACCAGCTCCCCACTGGG - Intronic
1134511437 16:14851258-14851280 CCGGTCACTAACACCCCAGGAGG - Intronic
1134972754 16:18544919-18544941 CCGGTCACTAACACCCCAGGAGG + Intronic
1140770024 16:78195047-78195069 CTGCTAACTGGGACCCCAGTGGG + Intronic
1148760700 17:49998309-49998331 CTGGGCACTGGCACAGCAGTGGG + Intergenic
1151687953 17:75660672-75660694 CTGTTCACTCACATCTCAGTAGG - Intronic
1152650507 17:81490382-81490404 CTGGTCAGGGGCCCCCCAGTTGG + Intergenic
1160789877 19:918438-918460 CTGGTCACTCGGACCAAGGTGGG + Intronic
1163762341 19:19144605-19144627 CTGGCCTCACGCACCCCAGGTGG - Intergenic
1164531025 19:29048340-29048362 CTGCTCACTCGTACCCCAAGCGG - Intergenic
1166361860 19:42255779-42255801 CTGGTCACTTCCTCCCCAGCTGG - Intergenic
930708361 2:54526290-54526312 CTGCTCACTCTTATCCCAGTTGG + Intronic
932526577 2:72475921-72475943 CTGGTCACTGGCACCTAAGCTGG + Intronic
932598997 2:73111586-73111608 CCGGTCACTTCCACCTCAGTGGG - Intronic
944640059 2:201715748-201715770 CTGGGCCCTCACAGCCCAGTTGG + Exonic
945113646 2:206389467-206389489 CTGGTAACCCTCACCCCAGCCGG - Intergenic
1172056600 20:32158556-32158578 CGGGTCACTCCCACTCCACTCGG + Intronic
1175806025 20:61829878-61829900 CTCGTCCCTCCCACCCCAGCAGG - Intronic
1178922988 21:36751549-36751571 CTGTGCACCCGCACCCCAGTCGG + Exonic
1184213629 22:43051884-43051906 CTGGTCACTCTCTCTCCAGCCGG - Exonic
953631044 3:44617933-44617955 CTTGTCACTTGCCCTCCAGTTGG - Intronic
956675173 3:71725687-71725709 CCGGTCCCTCTCACCCCCGTGGG - Intronic
959033181 3:101327286-101327308 CAGGTCCCTCCCACCACAGTGGG - Intronic
967811640 3:193765819-193765841 CAGCTCACTCCCACCCCAGGGGG - Intergenic
968503970 4:963555-963577 CTGTTCACACGCAGCTCAGTGGG - Intronic
983934500 4:173491801-173491823 CTGGACATTCACTCCCCAGTAGG - Intergenic
984140872 4:176002340-176002362 CTGGTCACTCGCTCTCCTCTGGG - Intronic
997513275 5:134467144-134467166 CGGGACACTGGCACCCCAGCAGG + Intergenic
1000047932 5:157536738-157536760 CTGGACACTTGCACTCCAGCAGG + Intronic
1007323895 6:41045880-41045902 CAGGTCACAGGCACCCCAGGAGG + Intronic
1017294364 6:152776872-152776894 CTGCCCACCAGCACCCCAGTGGG - Intergenic
1018099933 6:160428369-160428391 CTGGTCACCTGCAGCCCAGGTGG - Intronic
1022525455 7:31034263-31034285 CTGGTCACTCACACCCATGGGGG + Intergenic
1032001919 7:128271257-128271279 CTGGTGGCTGGCATCCCAGTGGG - Intergenic
1038288007 8:26223288-26223310 CTGGTCCCTCTCACTCCCGTGGG - Intergenic
1048731562 8:137447457-137447479 CTTGTCTCTCCCATCCCAGTTGG + Intergenic
1049759144 8:144324051-144324073 CTGCTCACAGGCACCCCAGTCGG - Intronic
1061853182 9:133428072-133428094 CTGGCCTCTCCCACCCCATTAGG + Intronic
1062125410 9:134858090-134858112 CTGCTCACTGCCACCCCACTTGG + Intergenic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1192592205 X:72369673-72369695 CTGGTCTCCTGCTCCCCAGTAGG + Intronic
1201367754 Y:13227384-13227406 CTGGTCACACACACCCCTTTGGG + Intergenic