ID: 1062623174

View in Genome Browser
Species Human (GRCh38)
Location 9:137431645-137431667
Sequence CCTGGTCACTCGCACCCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 112}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623174_1062623182 2 Left 1062623174 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1062623182 9:137431670-137431692 TGACCCAGCTGGGGACAGGCGGG No data
1062623174_1062623180 -2 Left 1062623174 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1062623180 9:137431666-137431688 GGAGTGACCCAGCTGGGGACAGG No data
1062623174_1062623188 22 Left 1062623174 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1062623188 9:137431690-137431712 GGGAGGCAGGACAGCTCTGGAGG No data
1062623174_1062623177 -8 Left 1062623174 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623174_1062623190 24 Left 1062623174 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1062623190 9:137431692-137431714 GAGGCAGGACAGCTCTGGAGGGG No data
1062623174_1062623181 1 Left 1062623174 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1062623181 9:137431669-137431691 GTGACCCAGCTGGGGACAGGCGG No data
1062623174_1062623184 5 Left 1062623174 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1062623184 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG No data
1062623174_1062623186 9 Left 1062623174 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1062623186 9:137431677-137431699 GCTGGGGACAGGCGGGAGGCAGG No data
1062623174_1062623178 -7 Left 1062623174 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1062623178 9:137431661-137431683 GACCAGGAGTGACCCAGCTGGGG No data
1062623174_1062623187 19 Left 1062623174 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1062623187 9:137431687-137431709 GGCGGGAGGCAGGACAGCTCTGG No data
1062623174_1062623176 -9 Left 1062623174 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1062623176 9:137431659-137431681 GTGACCAGGAGTGACCCAGCTGG No data
1062623174_1062623189 23 Left 1062623174 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1062623189 9:137431691-137431713 GGAGGCAGGACAGCTCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623174 Original CRISPR CCTGGTCACTCGCACCCCAG TGG (reversed) Intronic
900114823 1:1023992-1024014 CCTGGCCAGCCCCACCCCAGGGG - Intronic
900131779 1:1090287-1090309 CCTGGGCACACACACACCAGTGG + Intronic
900317832 1:2068280-2068302 CCTTGCCACCCCCACCCCAGAGG + Intronic
901204851 1:7488342-7488364 CCTGGTGTCTGGCACCCCACTGG + Intronic
904343607 1:29853864-29853886 CCTGGTCTGTTGGACCCCAGGGG + Intergenic
904682900 1:32241229-32241251 CCGAGTCACTCGCAACCCTGGGG + Intergenic
905878952 1:41451106-41451128 GGTGGCCACTCGGACCCCAGTGG + Intergenic
920380995 1:205534498-205534520 CCTGGTCCCTGGGAGCCCAGTGG - Intergenic
921360760 1:214329335-214329357 CGTGGTCACTGGCACGCTAGCGG + Intronic
1063096306 10:2912190-2912212 CCTGATCACTCGGACAGCAGAGG + Intergenic
1074377744 10:112952607-112952629 CCTGGTCTCTGGCCCCCCTGGGG - Intronic
1076712587 10:132346800-132346822 TCTAGTCACTTGTACCCCAGGGG + Intronic
1077041945 11:528666-528688 CCTTGTCACTGTCACCCCCGTGG - Intergenic
1077183439 11:1226412-1226434 CCTGGTCACTGGCCACCCTGGGG + Intronic
1077497303 11:2892454-2892476 CGGTGTCACTCGCACCTCAGTGG + Intronic
1078558603 11:12351649-12351671 CTTCCTCACTCTCACCCCAGGGG - Intronic
1080972544 11:37295658-37295680 CCTGGTCCCTCGCACACATGAGG - Intergenic
1081775317 11:45672069-45672091 CCTGGTCAATGCCACACCAGTGG + Intergenic
1084087980 11:66863455-66863477 CCAGGTGATTCTCACCCCAGAGG + Intronic
1084182453 11:67453823-67453845 CCTAAACACTCGAACCCCAGAGG - Intronic
1084654131 11:70505477-70505499 CCTGGCCACTAGATCCCCAGGGG + Intronic
1091126502 11:133104074-133104096 CCTGCTCAGTCACAGCCCAGTGG + Intronic
1092745872 12:11672077-11672099 CCTTGTCACCTGCACTCCAGTGG + Intronic
1095951773 12:47785520-47785542 CCAGCTCACTCCCACCCCAGGGG + Intronic
1104850233 12:131869344-131869366 CCTGGTCACTGTCACCCCGCAGG + Intergenic
1120730157 14:87992829-87992851 CCTGCTGACTGGCACCCTAGGGG + Intronic
1122780296 14:104140612-104140634 CCTGGTCACGGGCAGGCCAGGGG + Intronic
1124244196 15:28056045-28056067 CCTGGTCCCCTGCACTCCAGGGG + Intronic
1124719626 15:32100010-32100032 CCTGGCCCATCTCACCCCAGAGG + Intronic
1125728014 15:41877994-41878016 CCTGGTAACACGGACCCCAGCGG - Intronic
1128145716 15:65331476-65331498 CCAGGACACACGCACCTCAGTGG + Exonic
1129009799 15:72405228-72405250 CCAGCTCACCCCCACCCCAGTGG - Intronic
1129382845 15:75178681-75178703 CCTGGAGACTCCCGCCCCAGCGG + Intergenic
1129470296 15:75750030-75750052 CCTGGGCACCCCCAGCCCAGAGG + Intergenic
1131082702 15:89550141-89550163 CTTGGTCACTATCACCACAGTGG - Intergenic
1132147616 15:99437807-99437829 CCTGGGCACTCTCGCCCCTGTGG + Intergenic
1133312985 16:4862932-4862954 CCTGGTCACCAGCTCCCCACTGG - Intronic
1135281964 16:21159677-21159699 CCTGGTCACTCACTCCTCGGAGG - Intronic
1136272363 16:29155955-29155977 CCAGGTCACTCGCACACGACCGG - Intergenic
1137481681 16:48856992-48857014 CAATGTCACTCCCACCCCAGAGG - Intergenic
1139952277 16:70678221-70678243 CCTGGGGACTCAGACCCCAGAGG - Intronic
1142302493 16:89266692-89266714 CCTGGTCACTGGGTCCCCTGCGG - Intergenic
1142329889 16:89445070-89445092 CCTGGGCACCCTCACCCAAGGGG - Intronic
1142441410 16:90100736-90100758 CCTGCACACTCACATCCCAGAGG + Intergenic
1147792305 17:43021432-43021454 CCTGGTCACATGCAGCCCCGTGG - Intronic
1148118221 17:45190553-45190575 CTTGGTCATTGTCACCCCAGTGG + Intergenic
1148760699 17:49998308-49998330 CCTGGGCACTGGCACAGCAGTGG + Intergenic
1152525807 17:80887652-80887674 CCTCCTCTCTCCCACCCCAGAGG - Intronic
1152626354 17:81389521-81389543 CCTGGTCACTGTCACCTCTGCGG - Intergenic
1157544897 18:48540267-48540289 TCGGGTCACTCGCCACCCAGAGG - Intronic
1158049458 18:53199163-53199185 CCTGATCCCTTGAACCCCAGAGG - Intronic
1159957441 18:74529922-74529944 GCTGGTCTCCCGGACCCCAGGGG - Intergenic
1160005950 18:75069197-75069219 CCGGGCCACTCTCATCCCAGAGG - Intergenic
1163262539 19:16199799-16199821 CCTGGCCACTGCCTCCCCAGAGG + Intronic
1163783635 19:19263166-19263188 CCTGGTCTCCAGCACCCCAAAGG + Intergenic
1165312999 19:35039918-35039940 CCTGCCCCCTCCCACCCCAGTGG - Intronic
1167300240 19:48673653-48673675 CTTGGTCCCCCGCACCCCGGGGG - Intergenic
1167767260 19:51491751-51491773 CCTGGCCACCCCCTCCCCAGAGG - Exonic
927249030 2:20981673-20981695 CCTGGTAACTCCCATCCCAGGGG + Intergenic
929579045 2:43070220-43070242 CCTGGTCACCCAGATCCCAGTGG - Intergenic
929856261 2:45640785-45640807 CCAGGTCACTCGCATCCCATTGG - Intergenic
931100794 2:58998762-58998784 CCTGGTCCCTCCCACACCTGGGG - Intergenic
932598999 2:73111587-73111609 CCCGGTCACTTCCACCTCAGTGG - Intronic
933648465 2:84830786-84830808 CCTGTTCCCCCTCACCCCAGAGG - Intronic
933770858 2:85743088-85743110 CCTGGACACACTCAGCCCAGAGG - Intergenic
934652460 2:96100336-96100358 CCTGGCCACGCACACCACAGAGG + Intergenic
946321633 2:218958148-218958170 CCTGGTCACTCACACCCTCCTGG - Intergenic
947605739 2:231484040-231484062 CCTGGGAAACCGCACCCCAGAGG - Intergenic
948858615 2:240742279-240742301 CCCGGGCACCAGCACCCCAGAGG - Intronic
1172346103 20:34201199-34201221 CCTTGTCACCCGCACTCCGGTGG - Intronic
1173744960 20:45429189-45429211 CCCGGTCACTTTCACCTCAGCGG - Intergenic
1176080315 20:63269254-63269276 CCAGGCCACCCCCACCCCAGAGG - Intronic
1179565130 21:42242880-42242902 CCTGCTCACTCAGACCCCCGGGG - Intronic
1183545549 22:38453356-38453378 CCTGGTCACAGCCACTCCAGAGG + Intronic
950032823 3:9863341-9863363 CCAGGTCACTCGCCCCCCTACGG + Intergenic
950417530 3:12876730-12876752 CCAGGTCACTCGCCTCCCATGGG + Intergenic
954619407 3:51986982-51987004 GCTGGTAACCCGCACCCCTGGGG - Exonic
954909157 3:54088305-54088327 CCTCTTCACTCTGACCCCAGGGG - Intergenic
955659394 3:61280484-61280506 TCTGGTCTCCCACACCCCAGAGG - Intergenic
956675175 3:71725688-71725710 CCCGGTCCCTCTCACCCCCGTGG - Intronic
959033182 3:101327287-101327309 CCAGGTCCCTCCCACCACAGTGG - Intronic
963150353 3:142039645-142039667 CCTGTTCATTTGAACCCCAGGGG - Intronic
964773551 3:160251134-160251156 CCTGGCCATTTGCAACCCAGGGG - Intronic
967811641 3:193765820-193765842 CCAGCTCACTCCCACCCCAGGGG - Intergenic
968361671 3:198151712-198151734 CCTGCACACTCACATCCCAGAGG + Intergenic
968627006 4:1630264-1630286 CCTGGTCACGGGCAGCTCAGAGG - Intronic
969600671 4:8174152-8174174 CCAGGTCTCTTGCACTCCAGAGG - Intergenic
972135693 4:35890574-35890596 CCTGGTGACTTGCAACTCAGTGG + Intergenic
974444237 4:61958742-61958764 CCTGGTCACTCCCGCCACACAGG + Intronic
976270891 4:83229483-83229505 CCTGGTCCCTCGGATCCCAGAGG - Intergenic
983494540 4:168428181-168428203 CCTGGCCACCCTCAGCCCAGAGG + Intronic
985677108 5:1237819-1237841 CCTGGTCAATCCCATACCAGAGG + Intronic
1003522797 6:6873013-6873035 CCTGGTCACTCAGACCCTACTGG - Intergenic
1005949029 6:30617456-30617478 CCTGGTCACGCGCACGCGACAGG - Intronic
1019254013 7:37010-37032 CCTGCACACTCACATCCCAGAGG - Intergenic
1019354021 7:569707-569729 CAGGGGCACTCGCAGCCCAGGGG + Intronic
1020725454 7:11808009-11808031 CCTGGTCCCAAGTACCCCAGAGG + Intronic
1022301460 7:29106244-29106266 CTTGGCCATTTGCACCCCAGAGG - Intronic
1022525454 7:31034262-31034284 TCTGGTCACTCACACCCATGGGG + Intergenic
1022559739 7:31336185-31336207 CCTGTTCATTCAAACCCCAGAGG - Intergenic
1032001920 7:128271258-128271280 CCTGGTGGCTGGCATCCCAGTGG - Intergenic
1032864594 7:135913316-135913338 CTTGATCAATGGCACCCCAGTGG - Intergenic
1037999704 8:23381043-23381065 CATGGTTACCCGCCCCCCAGTGG - Intronic
1038492645 8:27981749-27981771 CCTGGCCACTGGCTCCCCCGGGG + Intronic
1039468394 8:37798961-37798983 CCTGGACCCTCAAACCCCAGCGG - Intronic
1039829203 8:41199672-41199694 CCTGGACACTGACACCCCAAGGG + Intergenic
1047544196 8:125799156-125799178 CCAGCTCAGTCCCACCCCAGGGG + Intergenic
1048540977 8:135341951-135341973 CCTGGTGCCTCCCACCCAAGGGG + Intergenic
1056688144 9:88783725-88783747 CCTGGTCACTGGCAGCTCACTGG - Intergenic
1056843801 9:90019797-90019819 CCTGGGCACCCGCTTCCCAGAGG + Intergenic
1059473592 9:114525872-114525894 CATGGCCCCTCTCACCCCAGAGG + Intergenic
1060197858 9:121634886-121634908 CCTGCTGACTTGCACCTCAGAGG + Intronic
1061420539 9:130470981-130471003 CCTGGTGACCCCCACACCAGTGG + Intronic
1062039419 9:134397191-134397213 CAGGGACACTCACACCCCAGAGG - Intronic
1062623174 9:137431645-137431667 CCTGGTCACTCGCACCCCAGTGG - Intronic
1062746385 9:138215533-138215555 CCTGCACACTCACATCCCAGAGG + Intergenic
1186840851 X:13483618-13483640 CCTGGACACACATACCCCAGAGG + Intergenic
1189262482 X:39688684-39688706 CCTGGTCGCCCCCACCCCTGGGG - Intergenic
1201367753 Y:13227383-13227405 CCTGGTCACACACACCCCTTTGG + Intergenic