ID: 1062623175

View in Genome Browser
Species Human (GRCh38)
Location 9:137431645-137431667
Sequence CCACTGGGGTGCGAGTGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623162_1062623175 5 Left 1062623162 9:137431617-137431639 CCTCAGTTTGGCCATTGCCCCTC 0: 1
1: 0
2: 0
3: 17
4: 255
Right 1062623175 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG No data
1062623158_1062623175 16 Left 1062623158 9:137431606-137431628 CCCCAGGACCACCTCAGTTTGGC 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1062623175 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG No data
1062623161_1062623175 8 Left 1062623161 9:137431614-137431636 CCACCTCAGTTTGGCCATTGCCC 0: 1
1: 0
2: 1
3: 10
4: 122
Right 1062623175 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG No data
1062623163_1062623175 -6 Left 1062623163 9:137431628-137431650 CCATTGCCCCTCCCCTCCCACTG 0: 1
1: 2
2: 8
3: 139
4: 1271
Right 1062623175 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG No data
1062623156_1062623175 17 Left 1062623156 9:137431605-137431627 CCCCCAGGACCACCTCAGTTTGG 0: 1
1: 1
2: 1
3: 23
4: 308
Right 1062623175 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG No data
1062623159_1062623175 15 Left 1062623159 9:137431607-137431629 CCCAGGACCACCTCAGTTTGGCC 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1062623175 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG No data
1062623160_1062623175 14 Left 1062623160 9:137431608-137431630 CCAGGACCACCTCAGTTTGGCCA 0: 2
1: 0
2: 0
3: 13
4: 128
Right 1062623175 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG No data
1062623154_1062623175 24 Left 1062623154 9:137431598-137431620 CCCTCAGCCCCCAGGACCACCTC 0: 1
1: 0
2: 6
3: 60
4: 620
Right 1062623175 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG No data
1062623155_1062623175 23 Left 1062623155 9:137431599-137431621 CCTCAGCCCCCAGGACCACCTCA 0: 1
1: 1
2: 4
3: 89
4: 716
Right 1062623175 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623175 Original CRISPR CCACTGGGGTGCGAGTGACC AGG Intronic
No off target data available for this crispr