ID: 1062623177

View in Genome Browser
Species Human (GRCh38)
Location 9:137431660-137431682
Sequence TGACCAGGAGTGACCCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623161_1062623177 23 Left 1062623161 9:137431614-137431636 CCACCTCAGTTTGGCCATTGCCC 0: 1
1: 0
2: 1
3: 10
4: 122
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623163_1062623177 9 Left 1062623163 9:137431628-137431650 CCATTGCCCCTCCCCTCCCACTG 0: 1
1: 2
2: 8
3: 139
4: 1271
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623170_1062623177 -2 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG 0: 1
1: 0
2: 0
3: 29
4: 312
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623168_1062623177 2 Left 1062623168 9:137431635-137431657 CCCTCCCCTCCCACTGGGGTGCG 0: 1
1: 0
2: 5
3: 25
4: 277
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623174_1062623177 -8 Left 1062623174 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623167_1062623177 3 Left 1062623167 9:137431634-137431656 CCCCTCCCCTCCCACTGGGGTGC 0: 1
1: 1
2: 7
3: 52
4: 516
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623160_1062623177 29 Left 1062623160 9:137431608-137431630 CCAGGACCACCTCAGTTTGGCCA 0: 2
1: 0
2: 0
3: 13
4: 128
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623159_1062623177 30 Left 1062623159 9:137431607-137431629 CCCAGGACCACCTCAGTTTGGCC 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623172_1062623177 -4 Left 1062623172 9:137431641-137431663 CCTCCCACTGGGGTGCGAGTGAC 0: 1
1: 0
2: 1
3: 5
4: 87
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623169_1062623177 1 Left 1062623169 9:137431636-137431658 CCTCCCCTCCCACTGGGGTGCGA 0: 1
1: 0
2: 2
3: 11
4: 182
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623171_1062623177 -3 Left 1062623171 9:137431640-137431662 CCCTCCCACTGGGGTGCGAGTGA 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623173_1062623177 -7 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data
1062623162_1062623177 20 Left 1062623162 9:137431617-137431639 CCTCAGTTTGGCCATTGCCCCTC 0: 1
1: 0
2: 0
3: 17
4: 255
Right 1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623177 Original CRISPR TGACCAGGAGTGACCCAGCT GGG Intronic
No off target data available for this crispr