ID: 1062623179

View in Genome Browser
Species Human (GRCh38)
Location 9:137431663-137431685
Sequence GTCCCCAGCTGGGTCACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 236}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623179_1062623191 14 Left 1062623179 9:137431663-137431685 CCAGGAGTGACCCAGCTGGGGAC 0: 1
1: 0
2: 4
3: 26
4: 236
Right 1062623191 9:137431700-137431722 ACAGCTCTGGAGGGGCCCCAAGG No data
1062623179_1062623186 -9 Left 1062623179 9:137431663-137431685 CCAGGAGTGACCCAGCTGGGGAC 0: 1
1: 0
2: 4
3: 26
4: 236
Right 1062623186 9:137431677-137431699 GCTGGGGACAGGCGGGAGGCAGG No data
1062623179_1062623190 6 Left 1062623179 9:137431663-137431685 CCAGGAGTGACCCAGCTGGGGAC 0: 1
1: 0
2: 4
3: 26
4: 236
Right 1062623190 9:137431692-137431714 GAGGCAGGACAGCTCTGGAGGGG No data
1062623179_1062623188 4 Left 1062623179 9:137431663-137431685 CCAGGAGTGACCCAGCTGGGGAC 0: 1
1: 0
2: 4
3: 26
4: 236
Right 1062623188 9:137431690-137431712 GGGAGGCAGGACAGCTCTGGAGG No data
1062623179_1062623194 30 Left 1062623179 9:137431663-137431685 CCAGGAGTGACCCAGCTGGGGAC 0: 1
1: 0
2: 4
3: 26
4: 236
Right 1062623194 9:137431716-137431738 CCCAAGGCTCCCGCCCCCCATGG No data
1062623179_1062623189 5 Left 1062623179 9:137431663-137431685 CCAGGAGTGACCCAGCTGGGGAC 0: 1
1: 0
2: 4
3: 26
4: 236
Right 1062623189 9:137431691-137431713 GGAGGCAGGACAGCTCTGGAGGG No data
1062623179_1062623187 1 Left 1062623179 9:137431663-137431685 CCAGGAGTGACCCAGCTGGGGAC 0: 1
1: 0
2: 4
3: 26
4: 236
Right 1062623187 9:137431687-137431709 GGCGGGAGGCAGGACAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623179 Original CRISPR GTCCCCAGCTGGGTCACTCC TGG (reversed) Intronic
900033107 1:385503-385525 GTCCCCTGCTTTGTCACCCCTGG + Intergenic
900053948 1:615393-615415 GTCCCCTGCTTTGTCACCCCTGG + Intergenic
900505248 1:3027133-3027155 GTCCCCACCAGTGTCACTGCAGG - Intergenic
901645274 1:10713694-10713716 GTCCCCTGCTGGGCTTCTCCAGG + Intronic
901877529 1:12175413-12175435 GTCCACAGCTGGACCACACCTGG - Intronic
903034362 1:20485005-20485027 ATCCCCGGCTGGGTCACCCTGGG - Intronic
904559831 1:31388877-31388899 ATCCCCAGCTGGGTCCCTGCAGG - Intergenic
905177843 1:36149193-36149215 GCCTCTTGCTGGGTCACTCCGGG - Intronic
905356202 1:37386615-37386637 CTCCCAAGCTGGGTGACTACAGG - Intergenic
907440322 1:54474811-54474833 CACCCCAGCTGGGCCACCCCCGG - Intergenic
908582065 1:65526084-65526106 GTCCCGAGCAGGTTCGCTCCAGG - Intronic
911217271 1:95208737-95208759 ATCCCCTGCTGGGTCCTTCCTGG + Intronic
911548480 1:99250911-99250933 GTCCCAAGGTGGGGCACTACTGG - Intergenic
912354181 1:109041847-109041869 GCCCTCAGGTGGGTGACTCCGGG - Exonic
915041053 1:152968613-152968635 GTCTCTATCTGGGTCACCCCTGG + Intergenic
915355715 1:155254442-155254464 GTCCCCAGCTGGCGTTCTCCGGG - Exonic
915512245 1:156392697-156392719 GCCCCCAGCTGGGGCACTCCTGG - Intergenic
920367184 1:205454379-205454401 GTCCCCAGCTCTGAGACTCCTGG + Intronic
922255467 1:223889654-223889676 GTCCCCTGCTTGGTCACCCCTGG + Intergenic
922938552 1:229440044-229440066 GTCCCAAGCTGGGACTCTCAGGG + Intergenic
924336670 1:242992523-242992545 GTCCCCTGCTTTGTCACCCCTGG + Intergenic
1064981778 10:21173459-21173481 GTGCCCAGCCTGGTCCCTCCGGG + Intronic
1067479164 10:46584252-46584274 GGCCCCAGCTGGCTCAGACCTGG + Intronic
1067615575 10:47757549-47757571 GGCCCCAGCTGGCTCAGACCTGG - Intergenic
1068915261 10:62424754-62424776 GTCCCCAACTGGGGCACTGTAGG - Intronic
1069860068 10:71465303-71465325 GCCCCCAGCTGAGTCACTCTGGG - Intronic
1070191945 10:74119013-74119035 CTTCCCAGCAGGGCCACTCCCGG + Exonic
1070546773 10:77458644-77458666 CTCCCCAGCTGGTTCTCCCCTGG - Intronic
1070886486 10:79904635-79904657 GTCCGGAGCACGGTCACTCCGGG + Intergenic
1073559124 10:104481894-104481916 GACCCCAGGTGGGACACTCAGGG - Intergenic
1075297507 10:121291355-121291377 GTCCCCAGCCGGGTGATTCCAGG + Intergenic
1076072601 10:127502938-127502960 GTGCCCAGCTGGCTGACACCTGG + Intergenic
1076197962 10:128533734-128533756 GTCCCCACCTGGGACTCTCTGGG + Intergenic
1076852996 10:133102282-133102304 GTCCTCAGTGGGGTCACGCCAGG - Intronic
1076872604 10:133201104-133201126 GTCCCCAGCTCTGTCCCTGCGGG - Intronic
1077444140 11:2582467-2582489 GTTCCCAGCTGGGGCATTCCTGG + Intronic
1077595170 11:3525738-3525760 GAACCCAGCTGAGTCACGCCTGG + Intergenic
1077662363 11:4081076-4081098 GTCCCTAGCTGAGGCCCTCCTGG + Intronic
1078105454 11:8355475-8355497 GTGCCCAGCTGGGTGAGACCTGG + Intergenic
1081625525 11:44653103-44653125 CTCCCCAGCTGTGTAACTCATGG + Intergenic
1081711675 11:45220651-45220673 GTCCCCTCCTGGGTTCCTCCTGG + Intronic
1083099899 11:60292286-60292308 TTTCCCAGCTGGGGCACACCAGG - Exonic
1083486306 11:62984798-62984820 CTCCGCAGCTGGGTTGCTCCGGG + Exonic
1084251072 11:67899717-67899739 GAACCCAGCTGAGTCACGCCTGG + Intergenic
1084704114 11:70806087-70806109 TTCCCCAGCTGGCTGCCTCCTGG - Intronic
1084821766 11:71696330-71696352 GAACCCAGCTGAGTCACGCCTGG - Intergenic
1084959719 11:72710086-72710108 GTCCCCTGCTGTCTCCCTCCTGG - Intronic
1085063791 11:73473460-73473482 GGCACCTGCTGGGTCACTGCTGG + Intronic
1085793139 11:79513406-79513428 TTCCCCAGCTGGATCTCTCAGGG - Intergenic
1088537018 11:110872519-110872541 GTCCCCAGGTTGGTCTCTGCTGG + Intergenic
1089288072 11:117420312-117420334 GTCCCCAGCTGAGCCCCGCCAGG - Intergenic
1089571860 11:119416443-119416465 GTCCTCAGCATGGTCATTCCGGG + Intergenic
1090055403 11:123419271-123419293 GTCCCCAACAGGTTCACTCTGGG + Intergenic
1091284130 11:134398713-134398735 GTCCACTGCTGGCTCCCTCCCGG + Intronic
1092421336 12:8334511-8334533 GAACCCAGCTGAGTCACGCCTGG + Intergenic
1092978385 12:13768577-13768599 CTCCCCAGCTGGCTCCCTACTGG - Intronic
1093098971 12:15004446-15004468 GTCCCCTGTTTGTTCACTCCAGG + Intergenic
1093882078 12:24416239-24416261 ATCCACAGCTCGGTCAGTCCTGG + Intergenic
1097236158 12:57541232-57541254 GTCCCTGGCTGGGTCACTGAGGG - Intronic
1099576041 12:84383040-84383062 GTTCCCAGCTTGGTCACTGTTGG + Intergenic
1100015744 12:90008843-90008865 GTCCCCACCTGGGTCCAGCCTGG - Intergenic
1102516580 12:113452762-113452784 GTCCCCAGCTAGACCACTCCAGG - Intergenic
1103416522 12:120745320-120745342 GTCCCCAGCTGGGTGACACTGGG - Intergenic
1103763957 12:123269141-123269163 AGCCCCAGCTGTGCCACTCCTGG + Intronic
1104033666 12:125083303-125083325 GTTCCCATCTGGCTCACTCTAGG - Intronic
1104601356 12:130156059-130156081 GTCCTCAGCTGTGTGACCCCAGG - Intergenic
1104616825 12:130277472-130277494 GTCACCAGCTGGGTCAACACAGG + Intergenic
1104757048 12:131275952-131275974 GTCCCCAGCTGGGGTCCTCAAGG - Intergenic
1106208516 13:27620856-27620878 TTCCCCAGCTGTGCCACTCTTGG - Exonic
1108530883 13:51325909-51325931 GTCTCCAGCTGGCTGACTGCAGG + Intergenic
1113555484 13:111230577-111230599 GACCCCAGCAAGGCCACTCCTGG - Intronic
1113880008 13:113619756-113619778 GTCACCAGCTGAGTCTCTACGGG - Intronic
1113950169 13:114067098-114067120 CCCCCCAGCTGGGGCACTCTGGG + Intronic
1114266775 14:21076926-21076948 GTCTTCAGCTGGGTTATTCCTGG - Intronic
1114277876 14:21164015-21164037 GTCCACAGCAGGGTCAATCTAGG - Intergenic
1114655315 14:24312103-24312125 GTTCCCTGCTGGGTCAAGCCAGG + Intronic
1118641146 14:67793649-67793671 CTCCCCACCTGAGTCACTGCTGG - Exonic
1119127552 14:72141725-72141747 GTCCCCAGCTGAGTTCCTCCAGG + Intronic
1119807284 14:77490525-77490547 GCCCCTAGCTGTGTGACTCCAGG - Intronic
1120946691 14:90004541-90004563 CTTCCCAGCTGGGTCACTTGGGG - Intronic
1121503120 14:94454820-94454842 ATCCCCAGCTTGGTCACTGTTGG + Intergenic
1121839347 14:97119731-97119753 CTCACCAGCTTGGGCACTCCAGG + Intergenic
1122651552 14:103229583-103229605 GTCCCCAGCTCTGTCCCTTCAGG + Intergenic
1122791177 14:104184825-104184847 GCCCCCATCTTGGGCACTCCAGG - Intergenic
1124662058 15:31557910-31557932 GTCCCCAGATGTGTCATCCCAGG - Intronic
1126076592 15:44917149-44917171 GTACCCAGCTAGGATACTCCTGG + Intergenic
1126108372 15:45161734-45161756 AACCGCAGGTGGGTCACTCCTGG - Exonic
1127664019 15:61127093-61127115 GTCCCCTGCTGGATCTTTCCTGG - Intronic
1128635503 15:69299636-69299658 GCCCCCAGCTGGGCATCTCCTGG + Intronic
1129192721 15:73946877-73946899 CCACCTAGCTGGGTCACTCCAGG - Intronic
1131310266 15:91284226-91284248 GTTGCCAGCAGGGTCATTCCTGG + Intronic
1132236624 15:100227035-100227057 GTTCCCACCTGGGCCTCTCCTGG + Intronic
1132463695 16:68005-68027 GTCCCCGGCTGAGACAGTCCTGG - Intronic
1132463710 16:68051-68073 GTCCCCGGCTGAGACAGTCCTGG - Intronic
1132872428 16:2121850-2121872 GGCACCTGCTGGGTCACTCGTGG - Intronic
1133020343 16:2964283-2964305 GTCCCTACCCGGGTCTCTCCGGG - Exonic
1133342194 16:5044149-5044171 GTTCACACCTGGGTCCCTCCCGG + Exonic
1133478429 16:6146206-6146228 GTGCCAAGCTGAGTCTCTCCTGG - Intronic
1134551484 16:15140932-15140954 GGCACCTGCTGGGTCACTCGTGG - Intergenic
1136139163 16:28277705-28277727 CTCCCCAGCTGGTCCACTCGAGG - Intergenic
1138340877 16:56288430-56288452 GTCCCCATATGGGGCACGCCAGG + Intronic
1140299831 16:73746215-73746237 GTGCTCAGCTGAGTGACTCCAGG - Intergenic
1141531642 16:84650094-84650116 GTTCCCAGCTGTGTGACGCCGGG + Intronic
1141564654 16:84893167-84893189 GTCCCCAGCAGGGTCACCTTGGG + Intronic
1142016426 16:87750658-87750680 GTCCTCAGCAGGCTCCCTCCCGG + Intronic
1142048937 16:87945625-87945647 GTCCCCAGCGGGGTCCCTCAGGG - Intergenic
1143211452 17:5191371-5191393 CTCCCCAGCGGGGTCACTCGTGG + Intronic
1144620290 17:16814581-16814603 GCTCCCAGCTGGGGCACCCCTGG + Intergenic
1146616136 17:34358792-34358814 GTCCCCAGCATGGGCGCTCCTGG + Intergenic
1146691138 17:34876948-34876970 GTCCCTGGCTGGGTCCCTGCAGG + Intergenic
1150449697 17:65256591-65256613 GTCCCCAAGTGGGTTCCTCCAGG + Intergenic
1152239846 17:79155570-79155592 GCCCCCAGCTGTGGCCCTCCGGG - Intronic
1152613871 17:81329117-81329139 GTCCCCAGCTGGGGTAACCCAGG - Intronic
1152942510 17:83180367-83180389 GCCTCCAGCAGGGTCACACCAGG - Intergenic
1153193838 18:2571443-2571465 GCGCCCAGCTGCGTCACCCCAGG - Exonic
1155341322 18:24817390-24817412 GCCTCCAGCTGGGTCACCTCAGG - Intergenic
1157393979 18:47326621-47326643 GTCCCCAGCTGGAGCACTGGAGG + Intergenic
1157522888 18:48357352-48357374 GTTCCCAGCTGTGTTTCTCCCGG - Intronic
1160412625 18:78685467-78685489 GTCAGCAGCTGGGTCCCTGCTGG - Intergenic
1160500816 18:79400472-79400494 CGCCCCAGGTGGGTCAGTCCCGG + Intronic
1160704583 19:524101-524123 GTCCTCTGATTGGTCACTCCTGG - Intergenic
1160763151 19:795893-795915 GTCACCAGGAGGGTCCCTCCCGG - Intergenic
1161118368 19:2511928-2511950 GTGCCCAGGTGGGTCACAACAGG + Exonic
1161475025 19:4479938-4479960 GACACCAGCTGGGTCCCTCTGGG - Intronic
1161708598 19:5834400-5834422 GTCCGCTGCTGGGTATCTCCAGG - Intronic
1162561534 19:11420639-11420661 CTCCCCAGCTGGGTCCGCCCCGG - Exonic
1163770325 19:19187114-19187136 CTCCGCAGCTAGGTCACTCCTGG + Intronic
1164089983 19:21941009-21941031 GTGCTCAGCTGGGTCACGACTGG + Intronic
1166372958 19:42312662-42312684 ATCCCCAGCTGTGTCCATCCTGG - Intergenic
925031330 2:652115-652137 GTACCCAGCTGGGCCACACCTGG + Intergenic
926319546 2:11739341-11739363 GCCACCAGCTGGGCCACTCCTGG + Intronic
926696252 2:15771722-15771744 GTGCCCTGCTGGGTGACTCTGGG - Intergenic
928461039 2:31472840-31472862 GTCTCCAGCAGAGTCACTCGTGG - Intergenic
929454503 2:42056236-42056258 GTCCAGAGCTGGGGCTCTCCAGG + Intronic
929534266 2:42770613-42770635 GTCCCCATCTGGGTGGCTTCAGG + Intronic
936239200 2:110772510-110772532 GATCCCAGCTGGCTCCCTCCTGG - Intronic
936633659 2:114231959-114231981 GTTCTCAGCTTGGTCACTGCTGG + Intergenic
937251578 2:120527391-120527413 GTCCCAAGCTCAGTCACACCTGG - Intergenic
939148042 2:138440165-138440187 GTCCAAAGCTGGTTCCCTCCTGG - Intergenic
946230214 2:218286675-218286697 GGCCCCGGCTGGGGCTCTCCTGG + Exonic
947591272 2:231387480-231387502 GACCCGAGCTGGGTCAATCAAGG - Intergenic
947729956 2:232422252-232422274 GTATCCAGCTGCGTCACTCAGGG - Intergenic
948316200 2:237030345-237030367 GTCCCCATCTGGGCCAGTCCAGG + Intergenic
948444286 2:238020047-238020069 GTCCCCAGCAGGGCGTCTCCAGG + Intronic
948630547 2:239299856-239299878 GTCCCCAGCTGCGTCCCTGCAGG - Intronic
1168772102 20:421883-421905 TCCCCCACCTGGGTGACTCCAGG - Intronic
1169251797 20:4066833-4066855 GACCCTAGCTGGGTCTATCCAGG - Intergenic
1170937487 20:20822857-20822879 CTCCCCACCTGGGTCACTGGAGG + Intergenic
1171149197 20:22811867-22811889 GTCACCAGCTGGGTGACTCCAGG - Intergenic
1172162028 20:32875422-32875444 GTCCTCAGCTGGTCCACTGCAGG - Intronic
1172902674 20:38346472-38346494 ATCCACAGCTGGGACAGTCCTGG + Exonic
1173617570 20:44413059-44413081 GCTCCCATCTGGGTCAGTCCTGG - Intronic
1173847149 20:46195438-46195460 TTCCCCATCTGGGTCACCCCAGG - Intronic
1174452472 20:50628793-50628815 GCTTCCAGCTGGGACACTCCAGG + Intronic
1174467666 20:50730495-50730517 GGACACAGCTTGGTCACTCCGGG + Intergenic
1175364709 20:58444664-58444686 GTCCCCACGTGGCCCACTCCCGG + Exonic
1175443470 20:59006132-59006154 GACCCAAGCTGGGTCATTCTGGG - Intronic
1175904016 20:62371065-62371087 GACCCCAGCTGGGCCACTGCTGG + Intergenic
1176130983 20:63496758-63496780 GGCCCCAGCTGGGTCCCATCTGG - Intronic
1177282411 21:18998868-18998890 TGCCCCAGCTGGTTTACTCCTGG - Intergenic
1178958294 21:37042590-37042612 GTCCCCAGCCAGGTCTTTCCAGG - Intergenic
1179567081 21:42255979-42256001 GGCTCCAGCTGGTTCACTCTGGG - Intronic
1180174049 21:46078950-46078972 GTGCCCAGCTTGGGGACTCCGGG - Intergenic
1180975150 22:19844089-19844111 GGCCCCACCTGGCTCACTGCAGG - Intronic
1181770391 22:25120888-25120910 CGCCCCTGCAGGGTCACTCCTGG - Intronic
1182457646 22:30462104-30462126 GTTCCCATCTGGGTCAGTCAGGG + Exonic
1183725851 22:39589320-39589342 GGACCCAGCGGGGCCACTCCTGG - Intronic
1183740574 22:39666558-39666580 CTGCCCAGATGGGTCACACCTGG - Intronic
1184865168 22:47198172-47198194 GTCCCCAGGTAGCTCACACCTGG + Intergenic
1185162971 22:49240546-49240568 GTCCCCAGTTGGGTCCCTCCTGG - Intergenic
950019709 3:9778709-9778731 AACCCAAGCTGGGTCACTCGAGG - Intronic
950584573 3:13883124-13883146 GTCCTCAGATGGGTTGCTCCAGG - Intergenic
950590832 3:13934915-13934937 GTGCCCCGCTGGGTCTGTCCTGG - Intergenic
950644901 3:14371332-14371354 TTCCTCAGCTGGGACCCTCCCGG + Intergenic
951613972 3:24521884-24521906 CTCCGCCGCCGGGTCACTCCGGG - Intergenic
954803625 3:53202140-53202162 GTCCCCAGCAGAGACACTGCTGG - Intergenic
957302747 3:78413936-78413958 GTTCCCAGCTGGGTCAATAATGG + Intergenic
959163966 3:102753665-102753687 TTCCACAGCTAGGTCAATCCAGG - Intergenic
960872896 3:122267801-122267823 GTCCCCAGGTGGGGAAGTCCTGG + Intronic
961288035 3:125822325-125822347 GAACCCAGCTGAGTCACGCCTGG - Intergenic
961899018 3:130193721-130193743 GAACCCAGCTGAGTCACGCCTGG + Intergenic
962312884 3:134338402-134338424 TTCCTCTGCTGGGACACTCCTGG + Intergenic
962751451 3:138437101-138437123 CTACCCAGCTGGGTCAAGCCTGG - Intronic
965757453 3:172040401-172040423 GTCCCCGGCTGGGCCTCTCCGGG + Intronic
965803944 3:172523345-172523367 GTCCCAGGCTGGGTCCCCCCTGG + Exonic
967556268 3:190862812-190862834 GTCTTCTGCTGGGTGACTCCTGG - Intronic
968619282 4:1596569-1596591 TTCCACAGCTGTGTCACTGCAGG + Intergenic
969009873 4:4053169-4053191 GAACCCAGCTGAGTCACGCCTGG + Intergenic
969744358 4:9058089-9058111 GAACCCAGCTGAGTCACGCCTGG - Intergenic
969803763 4:9590200-9590222 GAACCCAGCTGAGTCACTCCTGG - Intergenic
971301925 4:25449003-25449025 CTCCCCAGCTGTTTCCCTCCAGG - Intergenic
979240458 4:118442786-118442808 GTCCCCTGCTTTGTCACCCCTGG - Intergenic
980956114 4:139430850-139430872 GTCCCAAACTGGCCCACTCCTGG + Intergenic
985647517 5:1091950-1091972 TTCCCCTGCTGGGTCCTTCCCGG - Intronic
986286876 5:6365629-6365651 GTCCCCAGCTGTGTCCACCCAGG + Intergenic
987114445 5:14714856-14714878 GCTCCCAGCTGGGGCACTCCAGG + Intronic
987532919 5:19144095-19144117 CTCCCCTGCTGGTTCACTCCAGG + Intergenic
992672510 5:79074440-79074462 GTCCTTAGCTGGGTCAATCCTGG - Intronic
996982225 5:129512681-129512703 GTCACCAGCTGGGACACTGAGGG + Intronic
998172982 5:139883247-139883269 CTCCCCAGCTGGTTCTCTGCTGG + Intronic
998208376 5:140175466-140175488 GCCGCCAGCTGGATCCCTCCCGG + Intronic
998446711 5:142204477-142204499 GACTCCAGCTGGGGCACTACTGG + Intergenic
999269522 5:150288716-150288738 GTCCCCAGCTGGGTTTCTGGAGG - Intronic
1002323593 5:178390371-178390393 GTCACCTGCTGGTGCACTCCAGG + Intronic
1002579156 5:180197145-180197167 GTCCCCAGATGGGACTCTCCAGG - Intronic
1002740713 5:181433365-181433387 GTCCCCTGCTTTGTCACCCCTGG - Intergenic
1004515674 6:16320612-16320634 CTCCCCAGCTGGGGCCATCCTGG + Intronic
1005280812 6:24271506-24271528 GTCCCCACCCGAGTAACTCCAGG + Intronic
1006287960 6:33112594-33112616 GTCCAGAGCAGGGCCACTCCAGG + Intergenic
1006746899 6:36349103-36349125 GTCCCCAGCAAAGTCACTCATGG + Intergenic
1013162658 6:107560733-107560755 ATTCCCAGCCCGGTCACTCCTGG - Intronic
1013442255 6:110182105-110182127 GTCCCCAGGTGGGTAAGTGCTGG - Intronic
1013591810 6:111625155-111625177 GTCCCCCTCTAGGTCTCTCCAGG - Intergenic
1015466127 6:133550723-133550745 GACCTCTGTTGGGTCACTCCAGG + Intergenic
1017555252 6:155558180-155558202 ATGCCCAGCTGGGTGTCTCCTGG + Intergenic
1018222770 6:161597510-161597532 GTCCCCAGTTTTGTCACCCCTGG - Intronic
1019245822 6:170708961-170708983 GTCCCCTGCTTTGTCACCCCTGG - Intergenic
1019413305 7:916031-916053 TTCCCCAGAAGGGCCACTCCAGG + Intronic
1019938386 7:4270971-4270993 GCCTCCAGCTTGATCACTCCTGG + Intergenic
1022049426 7:26651281-26651303 GTGCCCAGCTGGGTGACCTCAGG - Intergenic
1023927285 7:44678704-44678726 GTCCCCAGCAGGGTCAGTGTGGG + Intronic
1023995693 7:45157798-45157820 GGCCGCAGCTGGGTCACGCTCGG - Exonic
1026037505 7:66840177-66840199 ATCCCCAGATGGTTCACCCCAGG - Intergenic
1026068224 7:67094789-67094811 ATCCCCAGGTTGGCCACTCCTGG - Intronic
1026983055 7:74537871-74537893 ATCCCCAGATGGTTCACCCCAGG + Intronic
1027056592 7:75053693-75053715 TGCACCAGCTGGGGCACTCCTGG + Intronic
1027214163 7:76173475-76173497 ATCCCCAGATGGTTCACCCCAGG + Intergenic
1027583809 7:80032022-80032044 TTCCCCAGCTGGGGCTCTCCAGG - Intergenic
1028985724 7:97006758-97006780 GTCCCCAGCCGGGTCAAACGTGG - Intronic
1033579274 7:142716777-142716799 GTCCACTGCTGACTCACTCCTGG + Intergenic
1035268141 7:157703579-157703601 GTTCCCATCTGGTTCTCTCCTGG - Intronic
1035300018 7:157891059-157891081 GTCCTCTCCTGGGTCACACCTGG + Intronic
1035373687 7:158394462-158394484 CTGCCAACCTGGGTCACTCCTGG - Intronic
1035502301 8:99237-99259 GTCCCCTGCTTTGTCACCCCTGG + Intergenic
1036237810 8:7056628-7056650 GGCCCAGGCTGAGTCACTCCAGG - Exonic
1036251276 8:7164906-7164928 GAACCCAGCTGAGTCACACCTGG + Intergenic
1036366211 8:8122554-8122576 GAACCCAGCTGAGTCACACCTGG - Intergenic
1036482652 8:9151731-9151753 GCCCGCAGCCGGATCACTCCGGG - Exonic
1036884686 8:12543105-12543127 GAACCCAGCTGAGTCACGCCTGG + Intergenic
1037699532 8:21262201-21262223 GGGCCCAGCTGGCCCACTCCCGG - Intergenic
1038459672 8:27705250-27705272 GACCCCACCTGGCTCCCTCCAGG + Intergenic
1039166473 8:34686958-34686980 GTCCCCAGCCGGTTCCCACCTGG - Intergenic
1048297948 8:133228646-133228668 GTCTGCAGCTGGGTCTCTCAAGG - Exonic
1049339936 8:142106650-142106672 GTCACCAGCTGCCTCTCTCCAGG - Intergenic
1055554506 9:77461124-77461146 GTCCCCAGCAGGCTCTCACCAGG + Intronic
1059335847 9:113567923-113567945 ATCCCCAGCTGGGTCCCTGGGGG + Intronic
1059469255 9:114491913-114491935 CTCTCCTCCTGGGTCACTCCCGG + Intronic
1060935107 9:127510062-127510084 GGCCCCGGCTGCGTGACTCCGGG - Intronic
1061218700 9:129236625-129236647 GTCCCCAGCTCTGCCACTGCTGG - Intergenic
1061444862 9:130632031-130632053 GTCCCCAACTGAGTCACAGCAGG - Intronic
1062386696 9:136314935-136314957 CTCCCCAGCAGGGTCATTCTGGG + Intergenic
1062578773 9:137220771-137220793 GCCCACAGGTGGGGCACTCCAGG + Exonic
1062623179 9:137431663-137431685 GTCCCCAGCTGGGTCACTCCTGG - Intronic
1203606021 Un_KI270748v1:58172-58194 GTCCCCTGCTTTGTCACCCCTGG - Intergenic
1185608289 X:1379735-1379757 GTCACCAGCTGGGTCACCCCAGG + Intronic
1187088085 X:16062951-16062973 GTCTCCAGCTTGGTGACTGCAGG + Intergenic
1189390249 X:40570465-40570487 ATCCCCAGCAGGGCCATTCCAGG - Intergenic
1190110704 X:47587333-47587355 GTCCCCAGCTGGGTTACTGTGGG - Intronic
1192178920 X:68903219-68903241 CTCCTCAGCTGGCCCACTCCTGG - Intergenic
1192539046 X:71952814-71952836 GTCCCCAGGTGGGTTAACCCAGG - Intergenic
1195510079 X:105705558-105705580 TTCCCCAACTATGTCACTCCTGG + Intronic
1196218789 X:113087733-113087755 TTCCTCAGCTGGGGCACTCACGG - Intergenic
1198822742 X:140666245-140666267 TTCTCCAGCTGGGTACCTCCTGG - Intergenic
1199431877 X:147770959-147770981 ATCTCCAGCTTGGCCACTCCTGG + Intergenic
1201594654 Y:15654316-15654338 GCCCCCAGCTGGGATACTCCAGG - Intergenic
1202388187 Y:24344609-24344631 GTCCCCTGCTTTGTCACCCCTGG - Intergenic
1202482600 Y:25325519-25325541 GTCCCCTGCTTTGTCACCCCTGG + Intergenic