ID: 1062623179

View in Genome Browser
Species Human (GRCh38)
Location 9:137431663-137431685
Sequence GTCCCCAGCTGGGTCACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623179_1062623190 6 Left 1062623179 9:137431663-137431685 CCAGGAGTGACCCAGCTGGGGAC No data
Right 1062623190 9:137431692-137431714 GAGGCAGGACAGCTCTGGAGGGG No data
1062623179_1062623194 30 Left 1062623179 9:137431663-137431685 CCAGGAGTGACCCAGCTGGGGAC No data
Right 1062623194 9:137431716-137431738 CCCAAGGCTCCCGCCCCCCATGG No data
1062623179_1062623189 5 Left 1062623179 9:137431663-137431685 CCAGGAGTGACCCAGCTGGGGAC No data
Right 1062623189 9:137431691-137431713 GGAGGCAGGACAGCTCTGGAGGG No data
1062623179_1062623187 1 Left 1062623179 9:137431663-137431685 CCAGGAGTGACCCAGCTGGGGAC No data
Right 1062623187 9:137431687-137431709 GGCGGGAGGCAGGACAGCTCTGG No data
1062623179_1062623186 -9 Left 1062623179 9:137431663-137431685 CCAGGAGTGACCCAGCTGGGGAC No data
Right 1062623186 9:137431677-137431699 GCTGGGGACAGGCGGGAGGCAGG No data
1062623179_1062623188 4 Left 1062623179 9:137431663-137431685 CCAGGAGTGACCCAGCTGGGGAC No data
Right 1062623188 9:137431690-137431712 GGGAGGCAGGACAGCTCTGGAGG No data
1062623179_1062623191 14 Left 1062623179 9:137431663-137431685 CCAGGAGTGACCCAGCTGGGGAC No data
Right 1062623191 9:137431700-137431722 ACAGCTCTGGAGGGGCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623179 Original CRISPR GTCCCCAGCTGGGTCACTCC TGG (reversed) Intronic