ID: 1062623180

View in Genome Browser
Species Human (GRCh38)
Location 9:137431666-137431688
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623173_1062623180 -1 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG No data
Right 1062623180 9:137431666-137431688 GGAGTGACCCAGCTGGGGACAGG No data
1062623162_1062623180 26 Left 1062623162 9:137431617-137431639 CCTCAGTTTGGCCATTGCCCCTC No data
Right 1062623180 9:137431666-137431688 GGAGTGACCCAGCTGGGGACAGG No data
1062623167_1062623180 9 Left 1062623167 9:137431634-137431656 CCCCTCCCCTCCCACTGGGGTGC No data
Right 1062623180 9:137431666-137431688 GGAGTGACCCAGCTGGGGACAGG No data
1062623169_1062623180 7 Left 1062623169 9:137431636-137431658 CCTCCCCTCCCACTGGGGTGCGA No data
Right 1062623180 9:137431666-137431688 GGAGTGACCCAGCTGGGGACAGG No data
1062623168_1062623180 8 Left 1062623168 9:137431635-137431657 CCCTCCCCTCCCACTGGGGTGCG No data
Right 1062623180 9:137431666-137431688 GGAGTGACCCAGCTGGGGACAGG No data
1062623171_1062623180 3 Left 1062623171 9:137431640-137431662 CCCTCCCACTGGGGTGCGAGTGA No data
Right 1062623180 9:137431666-137431688 GGAGTGACCCAGCTGGGGACAGG No data
1062623172_1062623180 2 Left 1062623172 9:137431641-137431663 CCTCCCACTGGGGTGCGAGTGAC No data
Right 1062623180 9:137431666-137431688 GGAGTGACCCAGCTGGGGACAGG No data
1062623163_1062623180 15 Left 1062623163 9:137431628-137431650 CCATTGCCCCTCCCCTCCCACTG No data
Right 1062623180 9:137431666-137431688 GGAGTGACCCAGCTGGGGACAGG No data
1062623174_1062623180 -2 Left 1062623174 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG No data
Right 1062623180 9:137431666-137431688 GGAGTGACCCAGCTGGGGACAGG No data
1062623170_1062623180 4 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG No data
Right 1062623180 9:137431666-137431688 GGAGTGACCCAGCTGGGGACAGG No data
1062623161_1062623180 29 Left 1062623161 9:137431614-137431636 CCACCTCAGTTTGGCCATTGCCC No data
Right 1062623180 9:137431666-137431688 GGAGTGACCCAGCTGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type