ID: 1062623183

View in Genome Browser
Species Human (GRCh38)
Location 9:137431673-137431695
Sequence CCTCCCGCCTGTCCCCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623183_1062623188 -6 Left 1062623183 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG No data
Right 1062623188 9:137431690-137431712 GGGAGGCAGGACAGCTCTGGAGG No data
1062623183_1062623197 22 Left 1062623183 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG No data
Right 1062623197 9:137431718-137431740 CAAGGCTCCCGCCCCCCATGGGG No data
1062623183_1062623191 4 Left 1062623183 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG No data
Right 1062623191 9:137431700-137431722 ACAGCTCTGGAGGGGCCCCAAGG No data
1062623183_1062623198 23 Left 1062623183 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG No data
Right 1062623198 9:137431719-137431741 AAGGCTCCCGCCCCCCATGGGGG No data
1062623183_1062623194 20 Left 1062623183 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG No data
Right 1062623194 9:137431716-137431738 CCCAAGGCTCCCGCCCCCCATGG No data
1062623183_1062623187 -9 Left 1062623183 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG No data
Right 1062623187 9:137431687-137431709 GGCGGGAGGCAGGACAGCTCTGG No data
1062623183_1062623196 21 Left 1062623183 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG No data
Right 1062623196 9:137431717-137431739 CCAAGGCTCCCGCCCCCCATGGG No data
1062623183_1062623189 -5 Left 1062623183 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG No data
Right 1062623189 9:137431691-137431713 GGAGGCAGGACAGCTCTGGAGGG No data
1062623183_1062623190 -4 Left 1062623183 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG No data
Right 1062623190 9:137431692-137431714 GAGGCAGGACAGCTCTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623183 Original CRISPR CCTCCCGCCTGTCCCCAGCT GGG (reversed) Intronic