ID: 1062623183

View in Genome Browser
Species Human (GRCh38)
Location 9:137431673-137431695
Sequence CCTCCCGCCTGTCCCCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 325}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623183_1062623191 4 Left 1062623183 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG 0: 1
1: 0
2: 3
3: 31
4: 325
Right 1062623191 9:137431700-137431722 ACAGCTCTGGAGGGGCCCCAAGG No data
1062623183_1062623190 -4 Left 1062623183 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG 0: 1
1: 0
2: 3
3: 31
4: 325
Right 1062623190 9:137431692-137431714 GAGGCAGGACAGCTCTGGAGGGG No data
1062623183_1062623187 -9 Left 1062623183 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG 0: 1
1: 0
2: 3
3: 31
4: 325
Right 1062623187 9:137431687-137431709 GGCGGGAGGCAGGACAGCTCTGG No data
1062623183_1062623189 -5 Left 1062623183 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG 0: 1
1: 0
2: 3
3: 31
4: 325
Right 1062623189 9:137431691-137431713 GGAGGCAGGACAGCTCTGGAGGG No data
1062623183_1062623198 23 Left 1062623183 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG 0: 1
1: 0
2: 3
3: 31
4: 325
Right 1062623198 9:137431719-137431741 AAGGCTCCCGCCCCCCATGGGGG No data
1062623183_1062623197 22 Left 1062623183 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG 0: 1
1: 0
2: 3
3: 31
4: 325
Right 1062623197 9:137431718-137431740 CAAGGCTCCCGCCCCCCATGGGG No data
1062623183_1062623196 21 Left 1062623183 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG 0: 1
1: 0
2: 3
3: 31
4: 325
Right 1062623196 9:137431717-137431739 CCAAGGCTCCCGCCCCCCATGGG No data
1062623183_1062623194 20 Left 1062623183 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG 0: 1
1: 0
2: 3
3: 31
4: 325
Right 1062623194 9:137431716-137431738 CCCAAGGCTCCCGCCCCCCATGG No data
1062623183_1062623188 -6 Left 1062623183 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG 0: 1
1: 0
2: 3
3: 31
4: 325
Right 1062623188 9:137431690-137431712 GGGAGGCAGGACAGCTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623183 Original CRISPR CCTCCCGCCTGTCCCCAGCT GGG (reversed) Intronic
900118335 1:1038082-1038104 CCTCCCTCCTATCCCCATCCAGG - Intronic
900142713 1:1145284-1145306 GCTCCCGCCTGTCCCCTGGCAGG - Intergenic
900389571 1:2428105-2428127 TCTCCACCCTGTCCCCAGCATGG + Intronic
900539152 1:3194116-3194138 CCTCCCACCTGTCCCTTGCCCGG - Intronic
901025608 1:6277286-6277308 TCTCCCGGCTGCCCCCAGCTGGG - Intronic
901223050 1:7594817-7594839 CATCCCGCCTGTTCCCCGCTGGG - Intronic
901632553 1:10655024-10655046 CCTCCCACCCCACCCCAGCTGGG + Intronic
902526401 1:17060743-17060765 CCTCTTTCCTTTCCCCAGCTGGG - Intergenic
902785746 1:18731600-18731622 CCTCCCGCCGCTCTCCAGTTGGG + Intronic
902985207 1:20150496-20150518 TCTCCCTCCTGCCCCCAGCCTGG + Intergenic
903068332 1:20713725-20713747 GCTCTCTCCTGTCTCCAGCTTGG + Intronic
903600283 1:24533158-24533180 CCTCCAGCCTCTCCCCCGGTGGG + Exonic
903652667 1:24930895-24930917 CCTTCCGCCTGTCCCCGGTTTGG - Intronic
903875791 1:26472395-26472417 CCGCCCACGTGACCCCAGCTGGG + Intergenic
904750259 1:32737427-32737449 CTTCCAGCCTGTCCCCAGGGAGG - Intergenic
905441605 1:37999760-37999782 TGTCCCGACTGTCCCCAGCGTGG + Intronic
906163073 1:43665281-43665303 CCTCTTGCCTGCCCCCAGTTAGG + Intronic
906702109 1:47867024-47867046 CCACCCGCCTGTCTCCTGCAAGG + Intronic
906795286 1:48691951-48691973 CCTCCCGACTCTGCCCAACTTGG + Intronic
907118471 1:51989833-51989855 CCCCACGCCGGTCCCCAGCCGGG + Intronic
907795380 1:57710914-57710936 CCTCCTGCCTGCCCCAATCTTGG - Intronic
913190026 1:116405706-116405728 CCTCCCGCATTGGCCCAGCTTGG - Intronic
915978847 1:160407956-160407978 CTTCCCGCCGGCCCCCACCTGGG + Intronic
916071625 1:161173563-161173585 CCTCCCTCCTGACCCCAGTCTGG - Intronic
919788415 1:201274954-201274976 CCTCCCAGATGTCCCCAGCTGGG - Intergenic
919814880 1:201431082-201431104 CCTCCACCCTGTGCCCAGCCTGG + Intergenic
919919706 1:202160732-202160754 CCTCCCGCCTGTGCCCTTCTGGG + Exonic
920522112 1:206635540-206635562 GCTCCCGACTGGCCCCGGCTGGG - Exonic
921190156 1:212700747-212700769 CCTCAACCCGGTCCCCAGCTTGG - Intergenic
921833335 1:219752366-219752388 CCATCCTCCTGTCTCCAGCTAGG + Intronic
922077718 1:222264430-222264452 ACACCATCCTGTCCCCAGCTGGG + Intergenic
1062936625 10:1395335-1395357 CCTCCCTCCTGTCTCCAACCTGG + Intronic
1062965494 10:1604409-1604431 CTTCCTGCCTGTTCCCAGCCTGG - Intronic
1063173642 10:3532704-3532726 CCACCTGCCTGTCCCCACCCTGG + Intergenic
1066293374 10:34033969-34033991 CCTCCTACCTGTACTCAGCTGGG - Intergenic
1066656350 10:37702230-37702252 CCTCCTCCCTGTCCTCAGCCAGG + Intergenic
1067074164 10:43163944-43163966 CCTCTCCCTTGTCCCAAGCTCGG - Exonic
1067807920 10:49405931-49405953 CCTCCTGCCTGTCCCCACCCAGG + Intergenic
1069607711 10:69750145-69750167 CTTCCTGCCTGGCCCCATCTTGG + Intergenic
1069793822 10:71039998-71040020 TCTCCCTCCTCTCCCCCGCTAGG - Intergenic
1071560620 10:86644584-86644606 ACTCGCCCCTGTCCCCTGCTGGG + Intergenic
1071801186 10:89063050-89063072 CTTCCTGCCTGACTCCAGCTTGG + Intergenic
1071888298 10:89974540-89974562 CCTCCCAGCTGACCACAGCTTGG - Intergenic
1073115631 10:101089983-101090005 CCTCCAGCCTAGCCCCAGCTAGG - Exonic
1073569977 10:104572554-104572576 GCTCCACCCTCTCCCCAGCTTGG - Intergenic
1075664334 10:124219922-124219944 CCTCCTCCCTGTCCCCCTCTGGG + Intergenic
1075715356 10:124552143-124552165 CCTCCAGCCTTTCCCCACCCTGG + Intronic
1077141597 11:1027237-1027259 CCCCCCGCCTGGCCCCTGCCCGG + Intronic
1077179170 11:1204509-1204531 CCTCCCAGCTCTCCCCAGCATGG + Intergenic
1077215212 11:1392580-1392602 CCACCCGGCTGACCCAAGCTGGG + Intronic
1077286410 11:1767935-1767957 CCTGCCTCCTCTCCCCAGGTGGG - Intergenic
1077332893 11:1991064-1991086 CCTCCCGCCTGTGTCCAGCCAGG + Intergenic
1077441757 11:2572139-2572161 CCTCCGTCCTGTCCCCAACCTGG - Intronic
1077456818 11:2686322-2686344 CGTCCCACCTGTTCCAAGCTGGG + Intronic
1077470998 11:2760519-2760541 CCTTCCTCCTCTCCCAAGCTGGG + Intronic
1077504249 11:2922779-2922801 CCCCTGGCCTGCCCCCAGCTGGG - Intronic
1078513863 11:12007260-12007282 CATCCCTGCTGTCTCCAGCTTGG - Intronic
1080109365 11:28548068-28548090 CTTCCCGTGTGTCCCCAGATGGG - Intergenic
1080349586 11:31368358-31368380 ACTCCCTTCTGTCCACAGCTTGG - Intronic
1080641527 11:34161208-34161230 CCTCCCGCCTGCCCCCTTCCTGG + Intronic
1081751169 11:45512166-45512188 TATCCCTCCTGTCCCCAGCAAGG - Intergenic
1083282903 11:61638436-61638458 CCTCCCTCCTGTCCTCCCCTGGG - Intergenic
1083624945 11:64067582-64067604 TCTCCCTCCTGTCCCTAGGTGGG + Intronic
1083633857 11:64109644-64109666 CCTCCACCCTGCCCCCAGCCTGG + Intronic
1083784475 11:64935878-64935900 CCTCCTGCTGGTCTCCAGCTTGG + Exonic
1083934435 11:65862987-65863009 TTTCCTGCCTGCCCCCAGCTGGG - Intronic
1084726252 11:70944281-70944303 CCACCCTCCTGTGCCCACCTAGG + Intronic
1085232950 11:74988793-74988815 CCTCCCTCCAGCCCGCAGCTCGG - Exonic
1086424641 11:86671915-86671937 CCGCGTGCCTGTCCCCAGCGCGG + Exonic
1088828666 11:113516855-113516877 CCTCCACCCTGTACCCAGGTAGG - Intergenic
1089093284 11:115896688-115896710 CCTACCTCCTGTCACCAGCAGGG + Intergenic
1089159187 11:116424485-116424507 TCTCCCTGCTGTGCCCAGCTGGG - Intergenic
1089452556 11:118608151-118608173 CTCCCCGCCTGTCCCCAGGCCGG + Intronic
1089755289 11:120681745-120681767 CTTCCTGCCTGTTCCCAGCCTGG - Intronic
1091038305 11:132253819-132253841 CCTCAGGCCTGCCCTCAGCTCGG + Intronic
1091092223 11:132782256-132782278 CATCCCTCCTGTTGCCAGCTGGG + Intronic
1091268626 11:134290011-134290033 CCTCCCCACTTTGCCCAGCTGGG - Intronic
1091302253 11:134515112-134515134 CCTCCCGCCTCTGCCCCGCACGG + Intergenic
1202815876 11_KI270721v1_random:46240-46262 CCTCCCGCCTGTGTCCAGCCAGG + Intergenic
1092238065 12:6822019-6822041 CCTCCCTCCTGTCCCCCTCCAGG - Intronic
1092242392 12:6843295-6843317 CTACCCTCCTGTGCCCAGCTGGG + Intronic
1092344734 12:7705968-7705990 CCTCCCGCCCCACCCCAGCGGGG + Intergenic
1093093025 12:14942431-14942453 CCTCCTCCCTGTCCACAGCTGGG - Exonic
1096653109 12:53071844-53071866 CCTGCCACCTGGCCCAAGCTGGG + Intronic
1098301970 12:69063843-69063865 TCTCCCAGCTGTCCCCAACTTGG + Intergenic
1101714478 12:107298482-107298504 CCTCACGTCTGTCCTAAGCTGGG - Intergenic
1102780900 12:115563548-115563570 CCTCTGGCCAGTCTCCAGCTGGG - Intergenic
1103416526 12:120745330-120745352 GCTCCAGCCTGTCCCCAGCTGGG - Intergenic
1103553458 12:121751869-121751891 CCCCCTGCCTGTCCCCAGCATGG + Intronic
1107035153 13:35894464-35894486 CCTCCCACCTGTTCCCAGGCTGG - Intronic
1107793107 13:44022553-44022575 CCTCCAGCCTGTGCCCTGCTGGG - Intergenic
1108408725 13:50127511-50127533 GCTCCCTCCTCTCCGCAGCTGGG - Intronic
1112586298 13:100721664-100721686 CCCCCTGCATGGCCCCAGCTGGG - Intergenic
1112783533 13:102927565-102927587 ACTCCAGCTTGTCCCCAGATGGG + Intergenic
1113346171 13:109480590-109480612 ACTCCAGCCTGTACCCTGCTGGG - Intergenic
1113458257 13:110464237-110464259 CCGACCACCTGCCCCCAGCTGGG - Intronic
1113521466 13:110944853-110944875 CCTCCTGCCTGCCTGCAGCTGGG + Intergenic
1113768425 13:112894555-112894577 CCCAGCGCCTGTCCCCAGCCAGG - Intronic
1113959756 13:114119936-114119958 CCTCCCTCCTCTCTCCAGCCAGG + Intronic
1113959835 13:114120180-114120202 CCTCCCTCCTCTCTCCAGCCAGG + Intronic
1113959914 13:114120430-114120452 CCTCCCTCCTCTCTCCAGCCAGG + Intronic
1118385901 14:65255371-65255393 CCTCCCGCCTATCTCCCTCTGGG + Intergenic
1118602551 14:67480849-67480871 CCTCCCGTCTGTTACCAGCTGGG - Intronic
1119262472 14:73245812-73245834 CCTCCCGCCAATCCACAGCAGGG + Intronic
1119439586 14:74619378-74619400 CTTCCAGCCTGTGCCCACCTTGG + Intergenic
1121332095 14:93056040-93056062 CCTCCCTCCTTTCCCCAGACCGG - Intronic
1121459735 14:94065683-94065705 CCTCCCTCCTCTCCACAGTTGGG - Intronic
1121887958 14:97561922-97561944 CCTCCCTCCACTCCCCTGCTCGG + Intergenic
1122048831 14:99041595-99041617 CCTCCCACCTCTCCCCAGCCTGG + Intergenic
1122152118 14:99730976-99730998 CCTCCCACCTGGCCATAGCTGGG - Intergenic
1122295590 14:100703984-100704006 GCTCCCGGCCCTCCCCAGCTCGG + Intergenic
1122802365 14:104238078-104238100 CCTTCCTCCTGTGCCCACCTCGG - Intergenic
1122825953 14:104370548-104370570 GCTCCCTCCAGGCCCCAGCTGGG + Intergenic
1123039776 14:105485761-105485783 TCTGCCACCAGTCCCCAGCTTGG - Intergenic
1128323152 15:66706407-66706429 CCTCCCAGCTGTCCCCAGGGTGG - Intronic
1128782831 15:70374266-70374288 CCTCCTGGCTGTCCCCAGGCAGG - Intergenic
1129192248 15:73944335-73944357 GCTGCCTCCTCTCCCCAGCTGGG - Intronic
1129782106 15:78279448-78279470 CCTCCCGGCTGGCACCCGCTGGG - Intronic
1129994177 15:79990617-79990639 CCTCCTTAATGTCCCCAGCTTGG - Intergenic
1131049143 15:89334813-89334835 CTTCCCGTCTGCACCCAGCTAGG + Exonic
1131294280 15:91133594-91133616 CCTGCCGCCTGTCCCCACTCTGG - Intronic
1132577824 16:672066-672088 CCTCCCGCCCACCCCCAGCCTGG + Exonic
1132615690 16:840248-840270 CCTCTCCCGTGTCCCCAGGTGGG + Intergenic
1132626893 16:895467-895489 CGTCCTGCCTGGCCCCGGCTAGG - Intronic
1132701742 16:1225011-1225033 CCTCCTGCCTCTCCCCAGCACGG + Intronic
1132733446 16:1374429-1374451 CCTTCCTCCTGTCCTCACCTGGG + Intronic
1133021816 16:2970149-2970171 CCTCCCGCCAGCACCCAGCCGGG + Intronic
1134440985 16:14299572-14299594 CCTGCTGCGTGTCGCCAGCTCGG - Intergenic
1135641590 16:24124286-24124308 CACCCAGCCTGTCCCCACCTTGG - Intronic
1136346409 16:29679039-29679061 CCTCCCTCCTGTCCTCTGCCAGG - Exonic
1136611853 16:31371297-31371319 CCGACGGCCTGTCCTCAGCTCGG + Intronic
1136926564 16:34380670-34380692 CCTCCCTCCTGCCCCTAGCCAGG - Intergenic
1136978010 16:35031137-35031159 CCTCCCTCCTGCCCCTAGCCAGG + Intergenic
1136996095 16:35188886-35188908 CCTCCACCCTGCCCCCAGCCCGG - Intergenic
1137972536 16:53000491-53000513 CTTCCCTCCTGTCCCCAGTCTGG - Intergenic
1138501476 16:57447591-57447613 CTCCCCGCCTCTCCCCGGCTTGG - Intronic
1140477979 16:75248537-75248559 CCTCCCCCATGTCCCCATCCTGG + Intronic
1142363159 16:89636709-89636731 CCTCCCTCCTGACCACAGCCCGG - Intronic
1142441880 16:90103740-90103762 CCTCCTGCCTTTCCCCACATGGG - Intergenic
1142763678 17:2054888-2054910 CCTCCCACCTGTACCCACCTGGG - Intronic
1142848119 17:2691891-2691913 CTTCCCGCCTCCCCGCAGCTGGG - Exonic
1143125635 17:4639656-4639678 CCTCCCGCCAGGCCCCACCGGGG - Intronic
1143402842 17:6657167-6657189 CCTCCCGCCAGGCCCCACCGGGG + Intergenic
1143444644 17:7000318-7000340 CATCCCTCCTGTCCCCAGAATGG + Exonic
1143753610 17:9050379-9050401 CACCACGCCTGGCCCCAGCTAGG - Intronic
1145263968 17:21370653-21370675 CCTCCTCCCTGTCCCCACGTGGG - Intergenic
1145886368 17:28384943-28384965 CTGCCCGCCGGACCCCAGCTAGG + Intronic
1146297654 17:31662174-31662196 CCTCCTCACTGCCCCCAGCTTGG - Intergenic
1146929235 17:36766029-36766051 CCTCCAGCCAGTCCCCATCCTGG - Intergenic
1147218204 17:38913019-38913041 CTTCCCTCCCCTCCCCAGCTTGG + Intronic
1147265264 17:39231005-39231027 CCCCCTTCCTTTCCCCAGCTGGG - Intergenic
1147360735 17:39927999-39928021 CCTCCGCCCTGGCCCCAGATTGG + Intergenic
1147367488 17:39968691-39968713 CCTCTTGCCCTTCCCCAGCTCGG - Intronic
1147930481 17:43977477-43977499 CCTGCAGCGTGTTCCCAGCTGGG - Intronic
1148074386 17:44927142-44927164 CCTCCCTCCAGCCCCCAGCTCGG + Intronic
1148874997 17:50681858-50681880 CCACCTGCCTGACCCCAGCCTGG + Intronic
1150006236 17:61470650-61470672 GCTCCCGCCTGGCCCAACCTCGG - Intronic
1150631265 17:66882030-66882052 CCTCCCTCCATTCCCCAGCATGG - Intronic
1151323299 17:73364308-73364330 CCTTCCTCCGGGCCCCAGCTGGG - Intronic
1151328874 17:73395107-73395129 CCTGCTGCCTGTCCCCTCCTTGG - Intronic
1151662580 17:75526350-75526372 TCTCCGGCCTTTCTCCAGCTGGG + Intronic
1151725044 17:75878653-75878675 GCCCCCGCCCGCCCCCAGCTCGG + Intergenic
1151766234 17:76134881-76134903 ACTCTCGCCACTCCCCAGCTTGG + Intergenic
1151944779 17:77313565-77313587 CCTCCAGGCTGGCCCCAGCCTGG - Intronic
1152094081 17:78263165-78263187 CCTTCCAGGTGTCCCCAGCTTGG + Intergenic
1152461482 17:80444561-80444583 TCACCCTCCTGTGCCCAGCTGGG + Intergenic
1152587641 17:81196143-81196165 CCGCCGTCCTGTCCTCAGCTGGG + Intronic
1152798124 17:82317812-82317834 CCTGCCACCCGTCCCCAGCCAGG - Intergenic
1154236390 18:12610059-12610081 CCTCCCTCCTCTTCCCAGCCTGG + Intronic
1157426492 18:47588801-47588823 CCACCCTCATCTCCCCAGCTTGG - Intergenic
1157469750 18:47979944-47979966 TCTCCCTCCTCTCTCCAGCTCGG + Intergenic
1157478290 18:48037092-48037114 CACCCTGCCTTTCCCCAGCTCGG + Intronic
1157773836 18:50374940-50374962 CGCCCCGCCTTTCCCCGGCTCGG + Intergenic
1158077022 18:53542811-53542833 CCTCCACCTGGTCCCCAGCTAGG + Intergenic
1159359298 18:67380842-67380864 CCTCCTGCTTTTCACCAGCTTGG - Intergenic
1159925420 18:74264696-74264718 CTTCCCGCCTCTCCCCAGTGTGG - Intronic
1160414454 18:78698381-78698403 CCTCCCTCCCCTCCCCAGCGAGG + Intergenic
1160793886 19:935038-935060 CCTCCCGCCCGGCCCCTACTGGG + Intronic
1161060797 19:2213831-2213853 CCCGCCCCATGTCCCCAGCTGGG + Exonic
1161076166 19:2286847-2286869 GCCCCCACCTGTCCCCAGCTGGG + Intronic
1161155037 19:2728095-2728117 CCTCCCGCCTGTGACCTGCCTGG + Intronic
1161233384 19:3186514-3186536 CCTCTCTCCTGTCCCCAGCTGGG + Intronic
1161422497 19:4183562-4183584 CCTCCCGGATGCCCCCAGCCTGG - Intronic
1161985788 19:7653089-7653111 CCTCCTTCCCTTCCCCAGCTGGG + Intergenic
1162547460 19:11339308-11339330 CCCAACGCCTGTCCCCAGCTGGG + Intronic
1162797807 19:13095624-13095646 CCTCCGGCCCGGCCCCAGCAGGG - Exonic
1163118010 19:15200019-15200041 CCTCCCTCCCCTCCCCCGCTCGG - Intronic
1164527445 19:29022495-29022517 CATGCCGGCTGTCCCCAGCAGGG + Intergenic
1164876467 19:31694069-31694091 CCTCCTGCCTGTTCCCCCCTAGG - Intergenic
1165527598 19:36369160-36369182 AATCCCTTCTGTCCCCAGCTTGG - Intronic
1165803758 19:38568038-38568060 CCTCTGCCCTTTCCCCAGCTAGG - Intronic
1165937472 19:39398010-39398032 CTTCCTGACTGTCTCCAGCTGGG + Exonic
1165953185 19:39486182-39486204 CCTCCAGCCAGTGGCCAGCTGGG - Exonic
1166386868 19:42387310-42387332 GCTCCCGCGGGTCCCCAGCCCGG + Intronic
1167295384 19:48646366-48646388 CCGCCCGCGTGGCCCCAGCGCGG - Intergenic
1167376533 19:49115023-49115045 CCTCCTGCTTGTCCCGAGCCCGG + Intronic
1167459804 19:49618866-49618888 CCTCCAGTCTGTCCCCTGCTTGG + Intronic
1167630800 19:50625356-50625378 CCTCCTGCCTGACCCCCGCCCGG + Intronic
1167638022 19:50666637-50666659 CCTGCGGCCTGGCCCCAGCGGGG - Exonic
1168235909 19:55063034-55063056 CCTGACGCCTGTCCCCGGCCCGG - Exonic
925856573 2:8134866-8134888 CCTCCAGCCTCTCACCATCTCGG + Intergenic
926190023 2:10721523-10721545 CCTCCCGCCTCGCTCCAGCCAGG - Intergenic
927496113 2:23553097-23553119 CCTCCCCTCTTTCCCCAGCCTGG + Intronic
928203946 2:29270939-29270961 CTTCCTCCCTGTCCCCAGCATGG + Intronic
929992380 2:46801096-46801118 CTTCCTGCCTCTCCCCGGCTAGG + Intergenic
931200855 2:60096206-60096228 CTTCCCCCATGTCCCCAGGTAGG - Intergenic
932380539 2:71277670-71277692 GCTCCGGGCTGTCCCCAGCGTGG + Intronic
932455725 2:71848766-71848788 CCTCCCCCCAGGCCCCACCTAGG + Intergenic
932469719 2:71945862-71945884 CAGCCAGCCTGTCCCCTGCTGGG - Intergenic
935804850 2:106735213-106735235 CCACCCTCCTGCCCCCTGCTTGG + Intergenic
938297925 2:130190006-130190028 CTTCCTGCCTGTCACCATCTAGG + Intronic
938458839 2:131484662-131484684 CTTCCTGCCTGTCACCATCTGGG - Intronic
938841400 2:135168325-135168347 CCTCCTGTCTGTCTCCAGCCCGG + Intronic
939105092 2:137939734-137939756 CCACCAGCCTGTCCACAGCTGGG - Intergenic
942251588 2:174051870-174051892 CTTCCTGCCTGGCCCAAGCTGGG + Intergenic
942302066 2:174572030-174572052 CCTGCCGCCTACCCCCAGCAGGG - Exonic
943380338 2:187136927-187136949 AATCCCGCCTTTTCCCAGCTAGG - Intergenic
947722343 2:232377840-232377862 CCTCCTGCCTGCCCCCCGCCTGG - Intergenic
948141788 2:235678731-235678753 CCTCCCTCCCGCCCCCACCTTGG + Intronic
948855534 2:240728643-240728665 CCTTGCGTCTGTCCTCAGCTGGG + Intronic
948944990 2:241214972-241214994 CCTCCAGCCCGGCCCTAGCTGGG + Intronic
1169310977 20:4539679-4539701 CCTCCCGCCCTTCCTCAACTGGG + Intergenic
1169426030 20:5497953-5497975 CCACCCGCCTGCCCCCTTCTAGG - Intergenic
1170629987 20:18057667-18057689 CCTCCCGGCTGCTCCCCGCTAGG + Exonic
1170639454 20:18138487-18138509 CCTCCCTCCTGGCCCAAGGTTGG + Intronic
1171773974 20:29349011-29349033 CCTTCCCCTTGTCCCCATCTAGG + Intergenic
1171815983 20:29786565-29786587 CCTTCCCCTTGTCCCCATCTAGG + Intergenic
1171902385 20:30869474-30869496 CCTTCCCCTTGTCCCCATCTAGG - Intergenic
1172885740 20:38229715-38229737 CCTGCCACTTGTGCCCAGCTTGG + Intronic
1173579544 20:44137402-44137424 CCTCCCGCCCCTCCCCAGGTGGG + Intronic
1174264174 20:49319344-49319366 CCCCGCGCCCGTCCCCAGCTGGG - Intergenic
1175297502 20:57919202-57919224 CCTCCCACCTCTTCCCTGCTGGG - Intergenic
1175843796 20:62048458-62048480 CCTCCCTCCTGTCCCCAGGGTGG + Intronic
1175862920 20:62159717-62159739 CCACCTGCCTGTGTCCAGCTGGG + Intronic
1175927995 20:62480319-62480341 CATCCTGCCCGCCCCCAGCTTGG + Intergenic
1176097048 20:63349079-63349101 TCTCCCACCTGTCCCCAGCTTGG + Intronic
1176286769 21:5022742-5022764 CGGCCCGCGCGTCCCCAGCTCGG + Intronic
1179870412 21:44240733-44240755 CGGCCCGCGCGTCCCCAGCTCGG - Intronic
1180079341 21:45479802-45479824 GCTCCCGTCCGTCCCCTGCTTGG + Intronic
1180319436 22:11307129-11307151 CCTTCCCCTTGTCCCCATCTAGG + Intergenic
1180335769 22:11575444-11575466 CCTTCCCCTTGTCCCCATCTAGG - Intergenic
1180983486 22:19890685-19890707 GCTCCCACCCATCCCCAGCTTGG + Intronic
1181603545 22:23966609-23966631 CCTCCTGCCTGGCGCCAGGTGGG - Intergenic
1181604968 22:23974698-23974720 CCTCCTGCCTGGCGCCAGGTGGG + Intronic
1181644792 22:24225484-24225506 CCTCCCTCCTCTCCCCTGGTGGG + Intronic
1182096636 22:27630433-27630455 CCACACCCCTGTCCCCAGCCAGG + Intergenic
1182134033 22:27883849-27883871 CCCCCGTCCTGTCCCCAGTTTGG - Intronic
1182517001 22:30864677-30864699 CCACCGGCCTGTCCCCTGCCAGG + Intronic
1183167550 22:36159247-36159269 CCTCCCACCTCACCCCAGATGGG + Intronic
1183351591 22:37337624-37337646 CCTCCAGGCTCTTCCCAGCTGGG - Intergenic
1183670218 22:39268517-39268539 CGGCCCACCTGTCCCCAGGTGGG - Intergenic
1183716156 22:39534861-39534883 CGTCCCGCCCGTGCCCGGCTGGG - Intergenic
1184321595 22:43746109-43746131 CTTCCCGCTTGTCCCCGGATTGG - Intronic
1184853645 22:47135059-47135081 CCCCGCCCCAGTCCCCAGCTGGG + Intronic
1185038193 22:48490328-48490350 AGTCCCGCCGGTCACCAGCTCGG - Intronic
1185345483 22:50308748-50308770 GCTTCCTCCTGTCCCCAGCCAGG + Intergenic
950496587 3:13337694-13337716 CTTCCCACCTGTCCCCACCCAGG - Intronic
950510937 3:13426118-13426140 CCTCTGGCCTGGCCCCACCTGGG + Intergenic
952966439 3:38623796-38623818 CATCCCCACTGTCCCCAGCAGGG - Intronic
953753166 3:45624807-45624829 CCTCCTTCCTGTCCACAGCCAGG - Intronic
954779132 3:53046210-53046232 CCTCCCGCGCGGCCCCAGCCAGG - Intronic
961041544 3:123681997-123682019 TCTCCAGCCTGTCTCCAGCCTGG - Intronic
962265123 3:133939289-133939311 CCTCTCTCCACTCCCCAGCTGGG - Intronic
962736514 3:138329948-138329970 CCTCCTGCCTCTCCCTGGCTGGG - Intergenic
962753477 3:138451318-138451340 CCTCCCACCTCTGCCCACCTTGG - Intronic
964407546 3:156365060-156365082 CCTCTTTCCTTTCCCCAGCTTGG - Intronic
968232177 3:197010663-197010685 CCTGCCGCCTGGCCTCAGCCGGG - Intronic
968362147 3:198154707-198154729 CCTCCTGCCTTTCCCCACATGGG - Intergenic
968514960 4:1011983-1012005 CCTCCCCCGTGTGCCCACCTGGG - Intronic
968524416 4:1048697-1048719 CCTGCCGCCCTTCCCCATCTTGG + Intergenic
969349278 4:6588943-6588965 TCTCCCGCCTGCCCTCACCTTGG - Intronic
970823874 4:20251775-20251797 CCTCTCCCCTCTCCCCAGCGAGG + Intergenic
984932219 4:184857964-184857986 CCCCCAGCCTGTCCCCATTTTGG - Intergenic
985485577 5:146499-146521 CCTCCCTCCTGTCCCCACTGTGG + Intronic
985572319 5:654836-654858 CTTCCTCCCTGTCCCCATCTGGG + Intronic
985580390 5:692912-692934 CCTCCAGACCCTCCCCAGCTCGG - Intronic
989263520 5:39446261-39446283 CCTCCCTCCTTTCCTCACCTGGG + Intronic
991499834 5:67266116-67266138 CCTCCTGCTGGTCCCCAGTTAGG + Intergenic
996081708 5:119264949-119264971 CCTCCCTCCAGACCCCAGCCTGG + Intergenic
997208574 5:132064748-132064770 CCCCCCACCTCTCCCCAGCCTGG + Intergenic
997639504 5:135439493-135439515 CCTCCCACCTTCCCCCAGCTTGG - Intergenic
998077445 5:139247972-139247994 GCTCCTGCCTTTCCCCATCTTGG - Intronic
1002101648 5:176860870-176860892 ACTCCGGCCTCTCCCCAGCTTGG - Intronic
1002198629 5:177514465-177514487 CCTCCCAGATGTCCCCAGCAAGG + Intronic
1002307117 5:178290417-178290439 CCCCTCGCCTGTCCTCAGCACGG + Intronic
1002470530 5:179432714-179432736 CCTCCAGGCTGTGTCCAGCTGGG + Intergenic
1002637095 5:180613898-180613920 CCCCCCACCTCTCCCCAGCCTGG - Intronic
1004383079 6:15149086-15149108 CTTCCTGCCTCTCCCCAGCTAGG - Intergenic
1004637753 6:17485423-17485445 CCACCCGGCTTTCCCCAGCTTGG + Intronic
1005736409 6:28751737-28751759 CCTCGCATCTCTCCCCAGCTGGG + Intergenic
1005742975 6:28809958-28809980 CCTCACGTCTCTCCCCAGCTGGG + Intergenic
1006174473 6:32113676-32113698 CCTCCTTCCTGCCCCCAGTTCGG - Intronic
1006361647 6:33590330-33590352 CCTTCCACCCGGCCCCAGCTCGG - Intergenic
1006643055 6:35498165-35498187 CCTCCGTCCTCTCCCCAGCCTGG - Exonic
1007384436 6:41511140-41511162 CCTACAGCCTGTCCCTACCTGGG - Intergenic
1007465297 6:42047576-42047598 CCTCCCAGCTGTACCCAGCTGGG + Intronic
1007787738 6:44290870-44290892 CATCCCACCTGGCCCCAGGTGGG - Intronic
1010203021 6:73299481-73299503 CCCCCCACCCCTCCCCAGCTGGG + Intronic
1011470237 6:87701445-87701467 CCTCCCGCCTCACCACAGGTGGG - Exonic
1011474481 6:87737462-87737484 TCTCCCACCTGCCCCCAGCCTGG + Intergenic
1013610890 6:111794045-111794067 CCTCCAGCCTGCCCCTACCTGGG + Intronic
1017119923 6:151014634-151014656 CCTGCAGCCTGTCCTCAGCAGGG + Intronic
1019012181 6:168850723-168850745 CTTCCCCACTGTCCCCACCTTGG + Intergenic
1019253533 7:34000-34022 CCTCCTGCCTTTCCCCACATGGG + Intergenic
1019304873 7:328553-328575 CCGCCCACCTGTCCCCACCCAGG + Intergenic
1019342988 7:517312-517334 CGCCCCGCCCGGCCCCAGCTCGG + Intronic
1019469251 7:1209647-1209669 TCTTCTGCCTGTCCCCACCTGGG + Intergenic
1019519282 7:1453420-1453442 CCTCCCTCCTGCCCCCAGGAGGG + Intronic
1020098932 7:5383626-5383648 CAACCCGACTGTCCTCAGCTGGG + Intronic
1022612422 7:31890183-31890205 CCTCTCCCCAGTCCCCAGCATGG - Intronic
1023360948 7:39414597-39414619 CGTCCCGCGCGTCCGCAGCTGGG - Intronic
1027183174 7:75953623-75953645 CCTCCCGCCTGCCCCCCGTGCGG + Intronic
1029441092 7:100586903-100586925 CCCCCCGCCCGCCCCCAGCCCGG - Intronic
1032011586 7:128351240-128351262 CCTGCCCCCGGTCCCCAGCGAGG + Exonic
1032423575 7:131802447-131802469 CCTCCTGGGTCTCCCCAGCTAGG + Intergenic
1032543854 7:132726034-132726056 CCTCCCGCCAGACCCCACCCTGG + Intronic
1034182361 7:149148233-149148255 CCTCCCGCGTGTCCCGAGTCCGG - Intronic
1034392895 7:150800348-150800370 CCTCCCGTCGCTCCCCTGCTCGG - Intronic
1034911913 7:155003742-155003764 CCCCCAGCACGTCCCCAGCTCGG - Intergenic
1035642374 8:1193884-1193906 CCCGCCTCCTGTCCCCAGCCAGG + Intergenic
1036183031 8:6601151-6601173 CCTCCCAGCTGTGCCCACCTGGG + Intronic
1037731141 8:21524804-21524826 CCTCTCACCTCTCCCCACCTTGG + Intergenic
1038079940 8:24122899-24122921 CCTACCTCCTTTCCCCAGTTAGG + Intergenic
1040946834 8:52893377-52893399 CCTCTCTTCTGTCCTCAGCTAGG - Intergenic
1041709058 8:60876451-60876473 TCTCCCACCTGTGCCCAGCGCGG - Intergenic
1044115502 8:88328660-88328682 CCGCCAGCCTCTCCCCCGCTCGG - Intergenic
1048005989 8:130419692-130419714 CCTCCCTCCTGTCTTCTGCTGGG - Intronic
1048445500 8:134489877-134489899 CCTCCCTCCTGTCCTCTTCTCGG + Intronic
1048529848 8:135237475-135237497 CCTCACACCTGTCCCAAGGTAGG - Intergenic
1049586799 8:143436109-143436131 CCACCAGGCTGTCCTCAGCTGGG + Intergenic
1049671481 8:143872042-143872064 CAGCCCGCCTGTGGCCAGCTGGG + Exonic
1049776083 8:144405855-144405877 ACTCTCCCCTGTCCCCAGCATGG - Intronic
1051353106 9:16216830-16216852 CCTCTCCCCTGTCCACGGCTGGG - Intronic
1051386514 9:16515008-16515030 CCTCCCGTCTGTTCCCTTCTGGG - Intronic
1052970404 9:34373796-34373818 CCTCCCTCCTCTCCCCCTCTGGG - Intronic
1053168470 9:35861323-35861345 CCTCCCGCCCATCCCCAGTGGGG + Intergenic
1053469716 9:38337714-38337736 CCTCCTCCCCGTCCCCAGCACGG + Intergenic
1056135186 9:83623565-83623587 CCTCCCGCCTGGCCCCGACAAGG - Intronic
1057294934 9:93829430-93829452 GCTCCCTCCTGTCCCCACCCTGG + Intergenic
1057701500 9:97366219-97366241 CCTGCAGCCTATACCCAGCTTGG + Intronic
1059671650 9:116497713-116497735 CCTCCCCCTTCTCCCCAGCCTGG - Intronic
1061020157 9:128009147-128009169 CCTCCAGCATGCCCCCAGCCTGG - Intergenic
1061508580 9:131046812-131046834 CCTTCCGCCTGTCCCCAGGAAGG + Intronic
1061666237 9:132162230-132162252 CCGCCCGCCTTACCCCGGCTCGG - Exonic
1062026651 9:134343732-134343754 CCATCCGCCCGTCCCCAGCCGGG + Intronic
1062139796 9:134949685-134949707 ACTCATGCCTGTCCTCAGCTGGG + Intergenic
1062347678 9:136122914-136122936 CCCCCGGCCTGGCCACAGCTCGG + Intergenic
1062569530 9:137178761-137178783 CCTCCCTCCAGGCCTCAGCTTGG - Intronic
1062623183 9:137431673-137431695 CCTCCCGCCTGTCCCCAGCTGGG - Intronic
1062746834 9:138218369-138218391 CCTCCTGCCTTTCCCCACATGGG - Intergenic
1185499396 X:585384-585406 CCTCACGCCGGCCCCCACCTGGG + Intergenic
1187045800 X:15646800-15646822 CCACCAGCCTGTCCGCAGCCTGG + Intronic
1188038506 X:25344767-25344789 ACTGCCGCCTGTGCTCAGCTCGG + Intergenic
1189499461 X:41542312-41542334 CCTCCCGCCTGGCTCCTGCCTGG - Intronic
1189643848 X:43104835-43104857 CCTCCTGCATTTCCCCATCTGGG - Intergenic
1190113223 X:47608692-47608714 CCCCGGGCCCGTCCCCAGCTGGG + Intronic
1193070001 X:77297094-77297116 CCTCCTGCCTGTCCTAAGCCAGG + Intergenic
1195034250 X:100956969-100956991 CCTCTCCCTTGTCCCAAGCTCGG - Intergenic
1199296563 X:146165517-146165539 CCTCCCACCTTTCCTCAGGTAGG - Intergenic
1200065257 X:153501723-153501745 CCTCCAGCCTGCCCACTGCTTGG + Intronic