ID: 1062623185

View in Genome Browser
Species Human (GRCh38)
Location 9:137431674-137431696
Sequence GCCTCCCGCCTGTCCCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 351}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623185_1062623196 20 Left 1062623185 9:137431674-137431696 CCAGCTGGGGACAGGCGGGAGGC 0: 1
1: 0
2: 3
3: 33
4: 351
Right 1062623196 9:137431717-137431739 CCAAGGCTCCCGCCCCCCATGGG No data
1062623185_1062623188 -7 Left 1062623185 9:137431674-137431696 CCAGCTGGGGACAGGCGGGAGGC 0: 1
1: 0
2: 3
3: 33
4: 351
Right 1062623188 9:137431690-137431712 GGGAGGCAGGACAGCTCTGGAGG No data
1062623185_1062623190 -5 Left 1062623185 9:137431674-137431696 CCAGCTGGGGACAGGCGGGAGGC 0: 1
1: 0
2: 3
3: 33
4: 351
Right 1062623190 9:137431692-137431714 GAGGCAGGACAGCTCTGGAGGGG No data
1062623185_1062623198 22 Left 1062623185 9:137431674-137431696 CCAGCTGGGGACAGGCGGGAGGC 0: 1
1: 0
2: 3
3: 33
4: 351
Right 1062623198 9:137431719-137431741 AAGGCTCCCGCCCCCCATGGGGG No data
1062623185_1062623189 -6 Left 1062623185 9:137431674-137431696 CCAGCTGGGGACAGGCGGGAGGC 0: 1
1: 0
2: 3
3: 33
4: 351
Right 1062623189 9:137431691-137431713 GGAGGCAGGACAGCTCTGGAGGG No data
1062623185_1062623187 -10 Left 1062623185 9:137431674-137431696 CCAGCTGGGGACAGGCGGGAGGC 0: 1
1: 0
2: 3
3: 33
4: 351
Right 1062623187 9:137431687-137431709 GGCGGGAGGCAGGACAGCTCTGG No data
1062623185_1062623194 19 Left 1062623185 9:137431674-137431696 CCAGCTGGGGACAGGCGGGAGGC 0: 1
1: 0
2: 3
3: 33
4: 351
Right 1062623194 9:137431716-137431738 CCCAAGGCTCCCGCCCCCCATGG No data
1062623185_1062623197 21 Left 1062623185 9:137431674-137431696 CCAGCTGGGGACAGGCGGGAGGC 0: 1
1: 0
2: 3
3: 33
4: 351
Right 1062623197 9:137431718-137431740 CAAGGCTCCCGCCCCCCATGGGG No data
1062623185_1062623191 3 Left 1062623185 9:137431674-137431696 CCAGCTGGGGACAGGCGGGAGGC 0: 1
1: 0
2: 3
3: 33
4: 351
Right 1062623191 9:137431700-137431722 ACAGCTCTGGAGGGGCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623185 Original CRISPR GCCTCCCGCCTGTCCCCAGC TGG (reversed) Intronic
900349349 1:2227537-2227559 GCCCCCCGGCCGCCCCCAGCTGG + Intergenic
900367154 1:2315966-2315988 TCCTCTCTCCTGTCCCCAGATGG + Intergenic
900373585 1:2343410-2343432 GGCACCCGCCTGGCCCCGGCAGG - Intronic
900513315 1:3070254-3070276 GCGCCCCGCCTGCCGCCAGCCGG + Intronic
900541877 1:3206980-3207002 GCCGCCCGCATGTCCCCACATGG + Intronic
900548552 1:3242052-3242074 GGCTCCCTCCTGTTCCCAGTGGG - Intronic
900950894 1:5857881-5857903 GCATCCCGGCTCTGCCCAGCTGG + Intergenic
900984806 1:6066985-6067007 GCCTCCCTCCTCTTCCCTGCCGG + Intronic
901025609 1:6277287-6277309 CTCTCCCGGCTGCCCCCAGCTGG - Intronic
901223051 1:7594818-7594840 TCATCCCGCCTGTTCCCCGCTGG - Intronic
901536548 1:9886146-9886168 GCTGCCCGTCAGTCCCCAGCTGG + Intronic
902271768 1:15309969-15309991 GCCTCCCCCCTGACCCCACCAGG - Intronic
902784250 1:18722720-18722742 GCCTCCCTCCTGCTCCCTGCTGG - Intronic
902973360 1:20071102-20071124 GACTCACACCTGTGCCCAGCTGG - Intronic
903212931 1:21828802-21828824 CCCTCCCGCTTGTCCCGAGGAGG + Intronic
904836335 1:33339648-33339670 GCCTGACGTCTGTCCTCAGCAGG - Intronic
904839781 1:33364883-33364905 GCCTCAAGCCTGTCACCTGCTGG + Intronic
905166226 1:36084676-36084698 CCCTCCCTCCCGTCCCCAGGCGG - Intronic
906195847 1:43930442-43930464 GGCTCCTGGCTGTGCCCAGCAGG + Exonic
906211205 1:44013231-44013253 GCCTGTCTCCTGTTCCCAGCAGG + Intronic
907118469 1:51989832-51989854 CCCCCACGCCGGTCCCCAGCCGG + Intronic
914171821 1:145232854-145232876 GGCTCCCGCCCGCTCCCAGCCGG + Intergenic
914677007 1:149913425-149913447 GCCTCCCCCCGGCCCCCAGGGGG + Exonic
914824832 1:151132996-151133018 GCCGCCCGGCTGTCCCGGGCAGG - Exonic
915440424 1:155942281-155942303 GCCTGCTGCGTTTCCCCAGCAGG + Exonic
915837394 1:159188500-159188522 CCCACCTGCCTCTCCCCAGCTGG + Intronic
916405387 1:164492904-164492926 GCCTTTCCCCTGTCCCCAACAGG - Intergenic
917498929 1:175568153-175568175 GGCACCTGCCTGTCCACAGCTGG - Intronic
917720732 1:177784288-177784310 GCCTCCTCCCTATCCCCAGCTGG - Intergenic
917965471 1:180176001-180176023 GCCCCCAGCCTGTCCCCCACTGG + Exonic
919788417 1:201274955-201274977 CCCTCCCAGATGTCCCCAGCTGG - Intergenic
919919704 1:202160731-202160753 GCCTCCCGCCTGTGCCCTTCTGG + Exonic
919980210 1:202638213-202638235 GCCCACAGCCTTTCCCCAGCTGG - Intronic
922077717 1:222264429-222264451 GACACCATCCTGTCCCCAGCTGG + Intergenic
922784208 1:228275070-228275092 GCCTCCCCCCATTCCCCACCAGG - Intronic
923085546 1:230700891-230700913 GCCTGACGTCTGTCCCCATCAGG + Intergenic
923765466 1:236889059-236889081 GCCTCCCTCCTGTCACCCGTAGG - Intronic
924144501 1:241060066-241060088 TCCTCTCTCCTGTCCCCAGCTGG + Intronic
924259239 1:242212547-242212569 GCCTCCTGCCCATCCCCAGCAGG - Intronic
924613023 1:245589399-245589421 GCCTGCCATCTGTCCCCAGGCGG + Intronic
1062857549 10:786819-786841 ACCCCACGCCTGCCCCCAGCCGG + Intergenic
1065047170 10:21754799-21754821 GCCTGTCCCCTGTCCCCACCTGG + Intergenic
1069625908 10:69867544-69867566 GCCACCGGCAGGTCCCCAGCAGG + Intronic
1069643225 10:69970146-69970168 GCCCCCAGCCTGTCCACACCAGG + Intergenic
1070145235 10:73769146-73769168 GCCTCCCGCCTGCCACCTGCAGG - Exonic
1070314192 10:75295108-75295130 GCCTCCCGCGCGTCCCCTCCCGG - Intergenic
1070645711 10:78200839-78200861 GCCACCTGCCTGGCCCCAGCAGG + Intergenic
1070779078 10:79127105-79127127 GTCCCCTCCCTGTCCCCAGCAGG - Intronic
1070949546 10:80419883-80419905 GCCCCCAGCCAGTGCCCAGCAGG - Intronic
1071491518 10:86139629-86139651 TCCTCCTGCCTGTTTCCAGCTGG + Intronic
1071560619 10:86644583-86644605 GACTCGCCCCTGTCCCCTGCTGG + Intergenic
1071966347 10:90857081-90857103 GCTGCCAGCCGGTCCCCAGCCGG + Intronic
1072498607 10:95989144-95989166 GCCTCTCACCTGTCCCCATGAGG - Intronic
1072720776 10:97779786-97779808 GGCTCCCGCCTGAGCCCATCTGG - Intergenic
1072782428 10:98259736-98259758 ACCTCCCACCTGTCCCCAGAGGG - Intronic
1073179207 10:101573908-101573930 CCCTCCCACCTGGCCCTAGCTGG + Intronic
1075412727 10:122240840-122240862 GCCTCCCAGCTGTCCCCAAATGG - Intronic
1076251049 10:128984130-128984152 TCCTCCCTCCAGTCCCCATCTGG + Intergenic
1076252603 10:128995977-128995999 GCCTCCAGCCTGTTTCCTGCAGG - Intergenic
1077249710 11:1555592-1555614 GCCTCCTGCCTGACCCCCGGAGG + Exonic
1077504251 11:2922780-2922802 GCCCCTGGCCTGCCCCCAGCTGG - Intronic
1077556032 11:3226492-3226514 GGCTCCCGCACGTGCCCAGCAGG - Intergenic
1079613126 11:22457560-22457582 GCCTGCTGCCTGTCCCCAAGAGG - Intergenic
1080637894 11:34139501-34139523 CCCTCCTCCCTGTCCCCACCCGG - Intronic
1081602760 11:44506656-44506678 GGCCCCAGCCGGTCCCCAGCAGG + Intergenic
1082962021 11:58927548-58927570 GCCTCTCGCCCCTCCCCTGCAGG + Intronic
1083623951 11:64062427-64062449 GCCTTCCGCCTATGCCCAGTTGG - Intronic
1083624944 11:64067581-64067603 GTCTCCCTCCTGTCCCTAGGTGG + Intronic
1084592616 11:70099232-70099254 GACCACAGCCTGTCCCCAGCAGG - Intronic
1085012088 11:73148244-73148266 GCATCCCGCCTGTCCTCCGTGGG + Intergenic
1085263803 11:75224510-75224532 GCCCCCTGCCTGCCCCCAGATGG - Intergenic
1089093282 11:115896687-115896709 CCCTACCTCCTGTCACCAGCAGG + Intergenic
1089159188 11:116424486-116424508 GTCTCCCTGCTGTGCCCAGCTGG - Intergenic
1090830679 11:130418937-130418959 GTCTCCCTGCTGGCCCCAGCTGG - Intronic
1091324650 11:134677142-134677164 GCCTCCAGCCTGTGGCCAGAGGG - Intergenic
1091459145 12:630816-630838 GCCTCGTGCCCCTCCCCAGCAGG + Intronic
1091696386 12:2630835-2630857 GCCTCACACTTGTCCTCAGCAGG - Intronic
1092344732 12:7705967-7705989 CCCTCCCGCCCCACCCCAGCGGG + Intergenic
1093093027 12:14942432-14942454 CCCTCCTCCCTGTCCACAGCTGG - Exonic
1095819670 12:46463771-46463793 GCCTCCTCCATGCCCCCAGCAGG + Intergenic
1096910169 12:54975536-54975558 TCCTGCTGCCTCTCCCCAGCTGG + Intronic
1096979405 12:55719648-55719670 GCCTCCCTCCTTCCCCCTGCGGG - Intronic
1099263447 12:80413657-80413679 GCCTCCCTACTGTCACCTGCTGG - Intronic
1100528922 12:95446668-95446690 GCCTCCTGCCCCACCCCAGCAGG + Intergenic
1101449200 12:104761114-104761136 GCCTCCCTGCCCTCCCCAGCTGG + Exonic
1101526736 12:105538079-105538101 GCCTCCCACCAGTCCCAAGAGGG + Intergenic
1101679984 12:106955697-106955719 CCCTCCCAGCAGTCCCCAGCCGG - Intronic
1102278247 12:111599064-111599086 GGCTCCCGGCTGTCCCCGCCCGG - Exonic
1102780902 12:115563549-115563571 GCCTCTGGCCAGTCTCCAGCTGG - Intergenic
1103416527 12:120745331-120745353 AGCTCCAGCCTGTCCCCAGCTGG - Intergenic
1103921506 12:124401854-124401876 GCCGCCCCCCTTTCTCCAGCTGG + Intronic
1103931582 12:124453548-124453570 GCCTCCTCCCTGGCCCCTGCTGG - Intronic
1104031017 12:125065742-125065764 GGCTCCCGCCCATCCCCCGCAGG - Intronic
1104843346 12:131834865-131834887 GCCTGCCGCCTCTTCCCTGCAGG + Intronic
1104933280 12:132351667-132351689 CCATCCCTCCTGTCCCCAGAGGG - Intergenic
1104946266 12:132416216-132416238 GCCACCCACCTGCCCCGAGCTGG - Intergenic
1105845411 13:24290068-24290090 GCCTCCAGCCTGTCCTAAGCTGG - Intronic
1106344323 13:28861002-28861024 GCCTGCTGGCTCTCCCCAGCAGG - Intronic
1106409010 13:29498125-29498147 GCTGCCAGCCTGTGCCCAGCAGG - Intronic
1107732852 13:43365822-43365844 TCCTCCCGCCTGACGCCAGATGG + Intronic
1107793109 13:44022554-44022576 CCCTCCAGCCTGTGCCCTGCTGG - Intergenic
1107929876 13:45298456-45298478 GCCTGCCTCCTGTCCACAGTGGG - Intergenic
1109723922 13:66314998-66315020 GACTCCCACCTGCCACCAGCTGG - Intronic
1113722155 13:112567141-112567163 GCCTCTGGGGTGTCCCCAGCAGG - Intronic
1113770781 13:112907155-112907177 CCCTCCCGCGTGCCCCCAGGTGG - Intronic
1114461357 14:22888002-22888024 GCCTCTAGCCTGTTCCCTGCAGG - Intergenic
1114522563 14:23348303-23348325 CCTTCCCCCCTGCCCCCAGCTGG - Exonic
1114980642 14:28158702-28158724 GGCACCTGCCTGTTCCCAGCAGG + Intergenic
1118602553 14:67480850-67480872 CCCTCCCGTCTGTTACCAGCTGG - Intronic
1118604756 14:67494656-67494678 CCCACCCTCCTGTCCACAGCCGG + Intronic
1119262470 14:73245811-73245833 TCCTCCCGCCAATCCACAGCAGG + Intronic
1121456819 14:94043581-94043603 GCCTCCCGCACGCCCACAGCCGG - Intronic
1121459737 14:94065684-94065706 GCCTCCCTCCTCTCCACAGTTGG - Intronic
1122154687 14:99743015-99743037 TCCTCCTGCATGTCCCCACCCGG - Intronic
1122301585 14:100734204-100734226 GCCTCCTGCCTGTGCCCCCCTGG + Exonic
1124216725 15:27813316-27813338 TCCACCCTCCTGACCCCAGCAGG + Intronic
1124371126 15:29105340-29105362 GCCACGTGCCTGTCTCCAGCTGG + Intronic
1124495821 15:30186258-30186280 GCCCACAGCCTTTCCCCAGCTGG - Intergenic
1124747752 15:32352388-32352410 GCCCACAGCCTTTCCCCAGCTGG + Intergenic
1125128408 15:36252256-36252278 GCCTCCGGCCTTTCTCCCGCTGG - Intergenic
1125507010 15:40272847-40272869 GGCCCCCGCCTGCCCCCAGGTGG + Exonic
1127838469 15:62809747-62809769 ACCTCCCACCTGCCCACAGCAGG - Intronic
1128730477 15:70017439-70017461 GCCTACCGTGTGTCACCAGCAGG + Intergenic
1128747544 15:70125153-70125175 GCCTCCTGTCTGTGCCCAGAAGG + Intergenic
1129192249 15:73944336-73944358 GGCTGCCTCCTCTCCCCAGCTGG - Intronic
1129232827 15:74206200-74206222 GCCTCCCACCTGCCCCCTCCTGG + Intronic
1129291277 15:74569737-74569759 GCCTCCTGCCTCTGCCCACCAGG - Intronic
1131825756 15:96321825-96321847 CTCTCCCGGCAGTCCCCAGCGGG + Intergenic
1132612477 16:824283-824305 ACCTGACGCCTGTCCACAGCAGG + Intergenic
1132615688 16:840247-840269 GCCTCTCCCGTGTCCCCAGGTGG + Intergenic
1133021814 16:2970148-2970170 CCCTCCCGCCAGCACCCAGCCGG + Intronic
1133280752 16:4663854-4663876 GCCTTCAGCCTGTGCACAGCAGG + Intronic
1134027553 16:10965857-10965879 GGCTCCCTCCACTCCCCAGCAGG - Intronic
1134880251 16:17739969-17739991 GCTCCCAGCCTGACCCCAGCAGG - Intergenic
1135992469 16:27226534-27226556 GCCTCCCTGCTGTGCCCCGCAGG - Intronic
1136229559 16:28878468-28878490 GCCACCCCCCGGCCCCCAGCTGG - Exonic
1136399603 16:30010370-30010392 GCCTCCCACCTGCCACCGGCTGG - Intronic
1136518040 16:30779589-30779611 GCCTTCTCCCTCTCCCCAGCAGG + Exonic
1137061982 16:35799120-35799142 GCCTCTTGCCCCTCCCCAGCAGG - Intergenic
1137290735 16:47050361-47050383 GCCTCCCTCCCTCCCCCAGCAGG + Intergenic
1137877077 16:52006993-52007015 GCCTCACTCCTGACCCCAGCAGG - Intronic
1138419219 16:56888375-56888397 GCTACCTGCCTGGCCCCAGCTGG - Intronic
1138490278 16:57372525-57372547 GCCGCCTGCCTGGCCCCCGCCGG + Exonic
1139965503 16:70742780-70742802 GCCTCCCGCCACAGCCCAGCCGG - Intronic
1140750081 16:78015445-78015467 GCATCCAGCCTGTCCCCATCTGG - Intergenic
1141592436 16:85077660-85077682 GCCTCTCCCCAGTCCCCTGCAGG - Intronic
1142134347 16:88444748-88444770 GCCTCCCGCTGCTTCCCAGCTGG - Intergenic
1142206571 16:88785625-88785647 GCCTCCCCACGGTCCCCAGGGGG - Intergenic
1142441882 16:90103741-90103763 GCCTCCTGCCTTTCCCCACATGG - Intergenic
1142518715 17:490223-490245 GCCGCGCGCCTCTTCCCAGCCGG - Intergenic
1142642938 17:1295255-1295277 TGCTCCCAGCTGTCCCCAGCTGG + Intronic
1142679784 17:1539990-1540012 GCCTCCCGCCCAGCCCCCGCTGG + Intronic
1142763680 17:2054889-2054911 CCCTCCCACCTGTACCCACCTGG - Intronic
1142780670 17:2178981-2179003 GGCTCCAGTCTGACCCCAGCAGG - Intronic
1142893777 17:2961775-2961797 GCCTCCTGCCTGTCCCTTGAAGG + Intronic
1143125637 17:4639657-4639679 CCCTCCCGCCAGGCCCCACCGGG - Intronic
1143402840 17:6657166-6657188 CCCTCCCGCCAGGCCCCACCGGG + Intergenic
1143544714 17:7589260-7589282 GCCTCTTCCCTGTCCGCAGCGGG + Exonic
1143759070 17:9088140-9088162 GCCCCCTGCCTGTCCCCACTGGG - Intronic
1143775908 17:9198634-9198656 TCCTCCCTCCTGTGTCCAGCTGG + Intronic
1144837494 17:18164351-18164373 TCTTCCCTCCTGTCACCAGCTGG + Intronic
1145007177 17:19344458-19344480 GCCTCCCGCCTGGCCCAACTGGG - Intronic
1145263970 17:21370654-21370676 GCCTCCTCCCTGTCCCCACGTGG - Intergenic
1146716275 17:35089285-35089307 CCCTCCCACCCATCCCCAGCCGG + Exonic
1147377747 17:40032990-40033012 TCCTCCCTCCTGCCCCCAACAGG + Intronic
1147970845 17:44218733-44218755 TCCTCCCGCCTCCCCCCGGCCGG + Intronic
1148048821 17:44759416-44759438 TCCACCCACCTGTCCCCAGCTGG + Intronic
1149295648 17:55259958-55259980 GCCTCACGTCTGCCCCCACCGGG + Intergenic
1149500627 17:57149655-57149677 GCTTCCCCTCTGTGCCCAGCAGG - Intergenic
1151391752 17:73791818-73791840 GCCTCCTGTGTGTCCCCAGACGG - Intergenic
1151539771 17:74758991-74759013 GCCTCCCAGCTGTCTCCAGGAGG - Intronic
1151662579 17:75526349-75526371 GTCTCCGGCCTTTCTCCAGCTGG + Intronic
1151960622 17:77403568-77403590 GCGTGCCCCCTGGCCCCAGCAGG + Intronic
1152322209 17:79614047-79614069 GCCTCCCCGCTGCCCACAGCCGG - Intergenic
1152443464 17:80325249-80325271 GCCTCCCACCTTTCCCAATCAGG - Intronic
1152860337 17:82692637-82692659 GCCTCAGGCCTCACCCCAGCTGG + Intronic
1155170348 18:23262585-23262607 GCCTTGCACCTGCCCCCAGCAGG - Intronic
1160007073 18:75075499-75075521 GTCTCCAGCCTGTCCCCCGAGGG - Intergenic
1160171952 18:76562559-76562581 GCGTCCCGGGTGTCCTCAGCAGG - Intergenic
1160786297 19:901508-901530 GGCCCCCGTCTGTCTCCAGCAGG + Exonic
1160835304 19:1122112-1122134 CCCTCCCGATTGCCCCCAGCAGG + Intronic
1160955884 19:1691565-1691587 GCCACCTGCCTGTCCCCAAGGGG + Intergenic
1160972308 19:1775077-1775099 GCCTCCTGCCTCTCCCCGGCCGG + Intronic
1160995915 19:1881851-1881873 GCCTCCCGGGGGTGCCCAGCTGG - Intronic
1161076165 19:2286846-2286868 AGCCCCCACCTGTCCCCAGCTGG + Intronic
1161150302 19:2704052-2704074 TCCTCCAGGCTCTCCCCAGCTGG + Intergenic
1161221743 19:3120978-3121000 CCCTCCCCCAGGTCCCCAGCGGG + Exonic
1161233382 19:3186513-3186535 CCCTCTCTCCTGTCCCCAGCTGG + Intronic
1161270095 19:3385029-3385051 CCCTCCCGCCTCTGCTCAGCAGG + Intronic
1161405789 19:4090510-4090532 GGCGCCAGCCTGTCCTCAGCTGG + Exonic
1162052699 19:8044320-8044342 GCATCCCACCTGTCTCCAGGGGG - Intronic
1162287160 19:9747430-9747452 CCCTCCCCCCTCCCCCCAGCAGG + Intergenic
1162547458 19:11339307-11339329 TCCCAACGCCTGTCCCCAGCTGG + Intronic
1162797809 19:13095625-13095647 CCCTCCGGCCCGGCCCCAGCAGG - Exonic
1162897195 19:13772099-13772121 GCCTCCCCTCTCTCCCCTGCAGG + Exonic
1162938877 19:13996277-13996299 GGCTCCTGCCTGGCCCCAGAAGG + Intronic
1163831827 19:19550671-19550693 GCCTCCCTCCTTGCCCCAGATGG + Intergenic
1164527444 19:29022494-29022516 GCATGCCGGCTGTCCCCAGCAGG + Intergenic
1164707567 19:30331821-30331843 GCTTCCTCCCTGTCCCCTGCAGG + Intronic
1164743549 19:30594628-30594650 GCCCCCTGCCTCTCTCCAGCAGG - Intronic
1164761478 19:30731644-30731666 GCCTCTGGCCTGGCCCAAGCGGG + Intergenic
1165096634 19:33413297-33413319 CCCTCCCTCCTGTCCCCAGCTGG - Intronic
1165474055 19:36019303-36019325 GCCTCCCTTCTCTCCCCAGACGG - Exonic
1165719919 19:38071850-38071872 TCATCCCGCCTGTCCCAAGAAGG + Intronic
1166219097 19:41353826-41353848 GCGTCCCCCCTGCCCCCGGCCGG + Exonic
1166720619 19:44993939-44993961 GGCTCCAGCCTGCACCCAGCAGG - Intergenic
1166881894 19:45934934-45934956 GCCTCCCCCCTCCCCCCTGCCGG + Exonic
1166990405 19:46689494-46689516 GCCACCCGCCCCTCCCCATCAGG - Intronic
1167271049 19:48506505-48506527 GCCTCCCGCCAGGCCCCAGTAGG - Intronic
1167596727 19:50432134-50432156 GCCTCCCACCCGCCCCCACCGGG + Intergenic
1167621948 19:50565709-50565731 GGCTCCCTGCTGGCCCCAGCAGG + Intronic
1167638024 19:50666638-50666660 GCCTGCGGCCTGGCCCCAGCGGG - Exonic
925170028 2:1744567-1744589 GCCTCGCGCATGTGCACAGCTGG - Intronic
925294551 2:2768584-2768606 GGCACCCGTCTGTCCCAAGCAGG + Intergenic
927035366 2:19169604-19169626 CCCTCCCCTCTGCCCCCAGCAGG + Intergenic
927552204 2:24010268-24010290 CCCTCCGGGCTGCCCCCAGCTGG - Intronic
928341556 2:30447370-30447392 GCCTCCCACCTGTGACAAGCAGG - Exonic
928540349 2:32278322-32278344 GCTTCCTGCCTGTCCCCACCCGG - Intronic
929901945 2:46012525-46012547 CACTTCCCCCTGTCCCCAGCAGG + Intronic
931668629 2:64627441-64627463 GCCTCCAGCCTCTCTCCAGGAGG + Intergenic
932721435 2:74141406-74141428 GCCTCCCCTCCCTCCCCAGCAGG - Intronic
933939368 2:87232706-87232728 GCCTTGCTCCTGTCCCCAGAGGG - Intergenic
933939574 2:87234122-87234144 GCCTTGCTCCTGTCCCCAGAGGG + Intergenic
934925679 2:98380389-98380411 GCTTCCTGCCTGGCCCCAGCAGG - Intronic
936349550 2:111702513-111702535 CCCTCCCACGTGTCCACAGCTGG + Intergenic
936353561 2:111731651-111731673 GCCTTGCTCCTGTCCCCAGAGGG - Intergenic
936353765 2:111733072-111733094 GCCTTGCTCCTGTCCCCAGAGGG + Intergenic
936559311 2:113523037-113523059 GCCTGCCGCCACGCCCCAGCGGG + Intergenic
937204223 2:120225360-120225382 GTCTGCCATCTGTCCCCAGCTGG + Intergenic
937907278 2:127058464-127058486 CCACCCCGCCTGCCCCCAGCGGG - Intronic
937909555 2:127068820-127068842 TCCTCCTGCCTGGCCCCAGGTGG - Intronic
939105094 2:137939735-137939757 TCCACCAGCCTGTCCACAGCTGG - Intergenic
939592384 2:144081685-144081707 GTCTCCCTCCTGTTCCCCGCAGG - Intronic
941974360 2:171386832-171386854 CCCTCCCCCCAGACCCCAGCAGG + Intronic
942302068 2:174572031-174572053 CCCTGCCGCCTACCCCCAGCAGG - Exonic
944164056 2:196698831-196698853 CCCTCCCCCCTCTCCCCACCCGG + Intronic
947535865 2:230940134-230940156 GCCTCCCGCCTGCCCCTGGGAGG - Intronic
948059351 2:235031932-235031954 GCCTCCCTCTTGTGCCCAGATGG + Intronic
948855532 2:240728642-240728664 GCCTTGCGTCTGTCCTCAGCTGG + Intronic
948944988 2:241214971-241214993 GCCTCCAGCCCGGCCCTAGCTGG + Intronic
948982152 2:241499831-241499853 GCCTCCCGTCTGCTCTCAGCAGG + Intronic
1168965109 20:1894292-1894314 GCCTCCAGCCTCTCGCCAGTGGG + Exonic
1169130658 20:3164918-3164940 GCCTGCCGCCTGCCTCAAGCCGG - Exonic
1169474852 20:5922440-5922462 GGCTCCTGCCTCTCCCCTGCTGG - Exonic
1170104216 20:12736303-12736325 GCCTCAGGGTTGTCCCCAGCAGG - Intergenic
1171003029 20:21433893-21433915 GCCTCTCCTCTGACCCCAGCTGG - Intergenic
1172688653 20:36775527-36775549 GGCTCCCTCCTGTCCACAGGAGG + Intergenic
1173577740 20:44123933-44123955 GCTTCCTGCATTTCCCCAGCAGG - Intronic
1173579542 20:44137401-44137423 GCCTCCCGCCCCTCCCCAGGTGG + Intronic
1174264176 20:49319345-49319367 GCCCCGCGCCCGTCCCCAGCTGG - Intergenic
1175294314 20:57897830-57897852 GCCTCCCCACTGGCCCCAGGAGG + Intergenic
1175862918 20:62159716-62159738 GCCACCTGCCTGTGTCCAGCTGG + Intronic
1176113852 20:63422600-63422622 GGCTCCCGCGTGTCCTCACCTGG + Intronic
1176973314 21:15290307-15290329 GCCTCCCTCCTGTGCTCATCGGG + Intergenic
1178314574 21:31558142-31558164 GCCCCACGCGGGTCCCCAGCCGG + Intronic
1178583246 21:33853389-33853411 CCCTCCAGCTTGTCCCCAACTGG + Intronic
1179908297 21:44435342-44435364 GCCTCCCGCATCCCCCCAGTAGG - Intronic
1180950944 22:19720301-19720323 ACCTCCCTCCTGCCCACAGCTGG + Exonic
1180961505 22:19764417-19764439 GGCCCCCGGCTGTCCCCAGGCGG + Intronic
1180983729 22:19891950-19891972 GCCTGGCGCCTGGCCGCAGCTGG - Intronic
1181459469 22:23077815-23077837 GCCTTCACCCTGACCCCAGCAGG + Intronic
1181718803 22:24757413-24757435 GCCTCCCACCTTGCCCAAGCTGG - Intronic
1181973453 22:26711272-26711294 GCCTCCCAGAGGTCCCCAGCAGG - Intergenic
1182097714 22:27637358-27637380 GCCTCTGGCATGTCCCCAGGAGG + Intergenic
1182464495 22:30505893-30505915 GGCTCCCGCCTGTTCGCAGGTGG + Intergenic
1182469936 22:30542339-30542361 GCCTCCAGCCTCTCGCCAGTGGG + Intronic
1183167548 22:36159246-36159268 GCCTCCCACCTCACCCCAGATGG + Intronic
1183654601 22:39177303-39177325 CCCTCCTGCCTGTCCCCTCCCGG - Intergenic
1184393586 22:44219581-44219603 GACGCCCGCCAGTCCCCGGCTGG - Intergenic
1184437898 22:44490651-44490673 CCCTCCTGCCTGTCCCCACGTGG - Intergenic
1184551967 22:45209349-45209371 GCCTCCAGCCTGCCCCCTGCAGG + Intronic
1184634111 22:45812756-45812778 GCCTCACTCCTGTCCCAAGAAGG - Intronic
1184678048 22:46054095-46054117 GCTGCCCGCCTGCCCCTAGCCGG + Exonic
1184775072 22:46619039-46619061 GCCGCCTGACTGTGCCCAGCTGG + Intronic
1184784597 22:46665533-46665555 CCCTCCCGCCTCCCCCCACCAGG - Intronic
1184886861 22:47351902-47351924 GCCTCCAGCCTGTCTCCTCCAGG + Intergenic
1184952431 22:47853466-47853488 GCTTCCAGACTCTCCCCAGCAGG - Intergenic
1185176419 22:49329799-49329821 TCCTCCTGCCTGTCTCCAACAGG - Intergenic
1185373132 22:50470013-50470035 GTCTGCCGCCTGTCCTCTGCAGG - Intronic
950145679 3:10648129-10648151 GGTTGCCGGCTGTCCCCAGCTGG + Intronic
951709567 3:25574614-25574636 ACCTCCCGCCAGGCCCCACCTGG - Intronic
952966440 3:38623797-38623819 GCATCCCCACTGTCCCCAGCAGG - Intronic
953870194 3:46619559-46619581 GTCTCCCGCCTGTCCACTACAGG + Intronic
954628461 3:52035600-52035622 TGATCCCTCCTGTCCCCAGCTGG - Intergenic
954799000 3:53176166-53176188 GCCTTCAGCCTGACACCAGCAGG - Intronic
955518268 3:59749500-59749522 GCCCCCCGCCTCTCCCCAAGAGG - Intronic
961754512 3:129120189-129120211 GCCTCCCTCCTGCCCCAAGGTGG - Intronic
962438507 3:135389511-135389533 GCCTCCCTCCTGGCTCCTGCTGG - Intergenic
962904407 3:139789030-139789052 GCCACCAGCCTGGCCCCAGGGGG + Intergenic
964674154 3:159258838-159258860 GCCCCCAGCCTGACCCCAGGTGG + Intronic
967270183 3:187726616-187726638 GCCTCCTGCCTTGCCCCACCAGG + Intronic
968037468 3:195560132-195560154 GCCTGCAGCCTGGTCCCAGCAGG - Intergenic
968232179 3:197010664-197010686 GCCTGCCGCCTGGCCTCAGCCGG - Intronic
968362149 3:198154708-198154730 GCCTCCTGCCTTTCCCCACATGG - Intergenic
968870547 4:3239845-3239867 GCCTCCCACATGTCATCAGCAGG + Exonic
969113883 4:4859750-4859772 GCCTCCCGCCCCTCCCCAGCAGG - Exonic
971406050 4:26321334-26321356 GCCTCCCGCGCGCCTCCAGCGGG + Intronic
976445655 4:85127818-85127840 ACCTCCAGCCTGTCCCCAGCAGG + Intergenic
977516480 4:98026547-98026569 GCCTCCAGCATGTCACTAGCAGG - Intronic
980628827 4:135408247-135408269 GCCTCCTGCCCCTCCCTAGCAGG - Intergenic
980877774 4:138679284-138679306 GTGTCTCTCCTGTCCCCAGCAGG - Intergenic
985528678 5:421174-421196 GCCTCCTGCCCGGCACCAGCCGG - Intronic
985648391 5:1095807-1095829 GCTGCCCGCCTGCCCCCAGACGG - Intronic
987317100 5:16733937-16733959 GCCTCCCTCCTGCTACCAGCAGG + Intronic
988932582 5:36051113-36051135 GCCTCCCTCCTCACCCAAGCTGG - Intronic
989710076 5:44388091-44388113 CCCTCCAGCCTGTCACTAGCCGG - Intronic
990533461 5:56696930-56696952 GCCTCTCTGCTGTCCTCAGCAGG + Intergenic
996352852 5:122564415-122564437 GCCTCCCTCTTGCCCCTAGCTGG - Intergenic
997593794 5:135092663-135092685 GCCTCCTGCCTCTCTGCAGCGGG + Intronic
1001281725 5:170390903-170390925 TCCTCCCTCCTGCCTCCAGCAGG + Intronic
1001299666 5:170524618-170524640 GCCTGCTGCCTGTCCCAAGATGG + Intronic
1001309686 5:170602007-170602029 GCCTCCTGCCTCACCCCAGAGGG - Intronic
1001591125 5:172866219-172866241 TCCTCCTGCCTCTCCCCAGTTGG - Intronic
1001639256 5:173233704-173233726 GGCTCCAGCCTGGCCGCAGCAGG + Intronic
1002213535 5:177612144-177612166 GCCTCCCTCCTCTCCCCTGCTGG + Intergenic
1002316854 5:178349320-178349342 GCCTCCTGCCAGTCCTCAGTGGG - Intronic
1005736407 6:28751736-28751758 GCCTCGCATCTCTCCCCAGCTGG + Intergenic
1005742973 6:28809957-28809979 GCCTCACGTCTCTCCCCAGCTGG + Intergenic
1006599156 6:35214292-35214314 GCCCCCGGCCTGGCCCCGGCGGG + Intergenic
1007301213 6:40869311-40869333 CCCTCCTGGCTGCCCCCAGCTGG - Intergenic
1007368571 6:41411700-41411722 GCCGCCTGCCAGCCCCCAGCAGG - Intergenic
1007406217 6:41637683-41637705 GCCGCCCGGCTGGCCCCACCGGG + Intronic
1007465295 6:42047575-42047597 CCCTCCCAGCTGTACCCAGCTGG + Intronic
1007785361 6:44276555-44276577 TCCTCCCGCCTGCCCCTCGCCGG + Exonic
1007787739 6:44290871-44290893 GCATCCCACCTGGCCCCAGGTGG - Intronic
1016886336 6:148963206-148963228 CGCTCCTGCCTCTCCCCAGCTGG - Intronic
1017119921 6:151014633-151014655 CCCTGCAGCCTGTCCTCAGCAGG + Intronic
1017324517 6:153130748-153130770 CCCTCCCGGCCGCCCCCAGCAGG + Intronic
1017964997 6:159256437-159256459 GCCTCACACCTGTCCTCAGTGGG + Intronic
1019014130 6:168867452-168867474 GCCTTGAGCCTTTCCCCAGCCGG - Intergenic
1019018802 6:168900618-168900640 GGCTCCCTCCTGACCCCAGGGGG + Intergenic
1019253531 7:33999-34021 GCCTCCTGCCTTTCCCCACATGG + Intergenic
1019519280 7:1453419-1453441 TCCTCCCTCCTGCCCCCAGGAGG + Intronic
1025033007 7:55572449-55572471 GGCTCCCGCCCGCTCCCAGCCGG - Exonic
1028582445 7:92422023-92422045 TCCTGCCTCCTGTCTCCAGCTGG + Intergenic
1029111024 7:98213055-98213077 GCCACTCGCTGGTCCCCAGCGGG - Intergenic
1030246286 7:107387309-107387331 ACCTCCTGCCCCTCCCCAGCAGG - Intronic
1032117330 7:129127783-129127805 GGCGCCAGCCTGTCCTCAGCTGG - Intergenic
1034452208 7:151143079-151143101 GCATCCCCACTGTCCCCAGGGGG + Intronic
1034904333 7:154930582-154930604 GTCTCCTGCCTGTGCCCTGCAGG + Intronic
1035021910 7:155805258-155805280 GCCTCCTGCCTGCCTGCAGCCGG + Intronic
1035179593 7:157079623-157079645 GCCTTCAGCCTGACCCCAGATGG + Intergenic
1036109154 8:5878616-5878638 GCCTCCTGCATCTCCCCAGAAGG + Intergenic
1036756204 8:11472874-11472896 GCCTCCTGCCTCTGCCCAGCAGG - Intronic
1039407418 8:37325387-37325409 GCCTCCCACCTGTCCCACCCTGG + Intergenic
1039803581 8:40980684-40980706 GCCTGCATCCTGTCCCCTGCCGG - Intergenic
1040310214 8:46232987-46233009 GCCCCCGGCCTGTCCCAGGCGGG + Intergenic
1040554982 8:48470175-48470197 GCCTCCCGCTGGTCCCGGGCTGG - Intergenic
1041739094 8:61139618-61139640 GCCTTCCACCTGGCCCCAGCAGG - Intronic
1042267583 8:66925117-66925139 GCCTCCCGACGGTCCCTTGCAGG + Intergenic
1042784892 8:72536685-72536707 TCCTCCCGCCCGCCCACAGCAGG - Intergenic
1044138086 8:88611916-88611938 ACCTCCCGCCCCTCCCCAGCAGG + Intergenic
1047669239 8:127126491-127126513 GCCTGCTGCCTGTCCCCACCAGG + Intergenic
1047698579 8:127428031-127428053 GCCTCCTCACTGTCCACAGCAGG - Intergenic
1049046800 8:140158742-140158764 GCCTGCCCACTGTCCACAGCAGG - Intronic
1049255583 8:141612008-141612030 CCATCCCTGCTGTCCCCAGCTGG + Intergenic
1049667433 8:143852506-143852528 GCCTCCTCCCAGTCTCCAGCCGG + Intergenic
1049687385 8:143944362-143944384 GCCTGCCAGCTGTCCCCAGAGGG - Intronic
1049717462 8:144099702-144099724 GCTTCCCACCTGGCCCCATCAGG - Exonic
1049893544 9:93160-93182 GCCTGCCGCCACGCCCCAGCGGG - Intergenic
1050351367 9:4743182-4743204 GCCACCCCACTGTGCCCAGCAGG + Intergenic
1052769658 9:32676101-32676123 GCCTCCCGCCTGTCCCATGATGG - Intergenic
1053168468 9:35861322-35861344 TCCTCCCGCCCATCCCCAGTGGG + Intergenic
1054693619 9:68338169-68338191 GCCTGCCGCCAAACCCCAGCGGG + Intronic
1055031132 9:71772135-71772157 GCTTCCTGCCTGTCCCCCACAGG - Intronic
1056515614 9:87346413-87346435 CCCTCCTGCATGTCCCCAGACGG + Intergenic
1060793030 9:126498435-126498457 CCCTCCCACCTGTCCTCACCTGG + Intronic
1060849287 9:126860947-126860969 GACGCGCGCCTGACCCCAGCAGG - Intronic
1061390971 9:130316852-130316874 GCCTCTCCCCTGACCTCAGCAGG + Intronic
1062026649 9:134343731-134343753 TCCATCCGCCCGTCCCCAGCCGG + Intronic
1062139795 9:134949684-134949706 GACTCATGCCTGTCCTCAGCTGG + Intergenic
1062276953 9:135735817-135735839 GCCTCCTGCCTCTACCGAGCTGG + Intronic
1062343744 9:136105293-136105315 GCCACACCCCTGTCCCCAGGAGG + Intergenic
1062493722 9:136821862-136821884 GCCTCCTGGCTGCCCCCAGCCGG + Intronic
1062522419 9:136963830-136963852 TCCTCCTCCCTGCCCCCAGCCGG - Intergenic
1062623185 9:137431674-137431696 GCCTCCCGCCTGTCCCCAGCTGG - Intronic
1062746836 9:138218370-138218392 GCCTCCTGCCTTTCCCCACATGG - Intergenic
1186854287 X:13610999-13611021 GGCTCCCAGATGTCCCCAGCAGG + Intronic
1187388735 X:18872081-18872103 CCCGCCCCCCTGCCCCCAGCTGG + Intergenic
1189921028 X:45903513-45903535 CCCACCCTCCTGTCTCCAGCTGG - Intergenic
1190218144 X:48493567-48493589 ACCTTCCTCCTGACCCCAGCTGG + Intergenic
1190357606 X:49620007-49620029 CCCTGCCCCCTGTCCCCCGCAGG + Intergenic
1191634701 X:63363211-63363233 TCCTCCTGCCTGTCCTTAGCAGG + Intergenic
1200069022 X:153518650-153518672 GCCTCCCACCCCTCCTCAGCCGG - Intronic
1200089704 X:153628752-153628774 GCCTCCCTCCCTCCCCCAGCAGG + Intergenic
1200242712 X:154506294-154506316 GCCTCTCGCCTGCTCTCAGCAGG - Exonic
1201766950 Y:17580861-17580883 GCCTCCCGCTTGAACCCGGCAGG + Intergenic
1201834603 Y:18325124-18325146 GCCTCCCGCTTGAACCCGGCAGG - Intergenic