ID: 1062623186

View in Genome Browser
Species Human (GRCh38)
Location 9:137431677-137431699
Sequence GCTGGGGACAGGCGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623168_1062623186 19 Left 1062623168 9:137431635-137431657 CCCTCCCCTCCCACTGGGGTGCG 0: 1
1: 0
2: 5
3: 25
4: 277
Right 1062623186 9:137431677-137431699 GCTGGGGACAGGCGGGAGGCAGG No data
1062623170_1062623186 15 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG 0: 1
1: 0
2: 0
3: 29
4: 312
Right 1062623186 9:137431677-137431699 GCTGGGGACAGGCGGGAGGCAGG No data
1062623163_1062623186 26 Left 1062623163 9:137431628-137431650 CCATTGCCCCTCCCCTCCCACTG 0: 1
1: 2
2: 8
3: 139
4: 1271
Right 1062623186 9:137431677-137431699 GCTGGGGACAGGCGGGAGGCAGG No data
1062623167_1062623186 20 Left 1062623167 9:137431634-137431656 CCCCTCCCCTCCCACTGGGGTGC 0: 1
1: 1
2: 7
3: 52
4: 516
Right 1062623186 9:137431677-137431699 GCTGGGGACAGGCGGGAGGCAGG No data
1062623169_1062623186 18 Left 1062623169 9:137431636-137431658 CCTCCCCTCCCACTGGGGTGCGA 0: 1
1: 0
2: 2
3: 11
4: 182
Right 1062623186 9:137431677-137431699 GCTGGGGACAGGCGGGAGGCAGG No data
1062623179_1062623186 -9 Left 1062623179 9:137431663-137431685 CCAGGAGTGACCCAGCTGGGGAC 0: 1
1: 0
2: 4
3: 26
4: 236
Right 1062623186 9:137431677-137431699 GCTGGGGACAGGCGGGAGGCAGG No data
1062623172_1062623186 13 Left 1062623172 9:137431641-137431663 CCTCCCACTGGGGTGCGAGTGAC 0: 1
1: 0
2: 1
3: 5
4: 87
Right 1062623186 9:137431677-137431699 GCTGGGGACAGGCGGGAGGCAGG No data
1062623171_1062623186 14 Left 1062623171 9:137431640-137431662 CCCTCCCACTGGGGTGCGAGTGA 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1062623186 9:137431677-137431699 GCTGGGGACAGGCGGGAGGCAGG No data
1062623174_1062623186 9 Left 1062623174 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1062623186 9:137431677-137431699 GCTGGGGACAGGCGGGAGGCAGG No data
1062623173_1062623186 10 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1062623186 9:137431677-137431699 GCTGGGGACAGGCGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623186 Original CRISPR GCTGGGGACAGGCGGGAGGC AGG Intronic
No off target data available for this crispr