ID: 1062623188

View in Genome Browser
Species Human (GRCh38)
Location 9:137431690-137431712
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623185_1062623188 -7 Left 1062623185 9:137431674-137431696 CCAGCTGGGGACAGGCGGGAGGC 0: 1
1: 0
2: 3
3: 33
4: 351
Right 1062623188 9:137431690-137431712 GGGAGGCAGGACAGCTCTGGAGG No data
1062623179_1062623188 4 Left 1062623179 9:137431663-137431685 CCAGGAGTGACCCAGCTGGGGAC 0: 1
1: 0
2: 4
3: 26
4: 236
Right 1062623188 9:137431690-137431712 GGGAGGCAGGACAGCTCTGGAGG No data
1062623172_1062623188 26 Left 1062623172 9:137431641-137431663 CCTCCCACTGGGGTGCGAGTGAC 0: 1
1: 0
2: 1
3: 5
4: 87
Right 1062623188 9:137431690-137431712 GGGAGGCAGGACAGCTCTGGAGG No data
1062623174_1062623188 22 Left 1062623174 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1062623188 9:137431690-137431712 GGGAGGCAGGACAGCTCTGGAGG No data
1062623171_1062623188 27 Left 1062623171 9:137431640-137431662 CCCTCCCACTGGGGTGCGAGTGA 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1062623188 9:137431690-137431712 GGGAGGCAGGACAGCTCTGGAGG No data
1062623170_1062623188 28 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG 0: 1
1: 0
2: 0
3: 29
4: 312
Right 1062623188 9:137431690-137431712 GGGAGGCAGGACAGCTCTGGAGG No data
1062623183_1062623188 -6 Left 1062623183 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG 0: 1
1: 0
2: 3
3: 31
4: 325
Right 1062623188 9:137431690-137431712 GGGAGGCAGGACAGCTCTGGAGG No data
1062623173_1062623188 23 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1062623188 9:137431690-137431712 GGGAGGCAGGACAGCTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr